The tomato genome re-seq project
|
|
- Sherman Short
- 6 years ago
- Views:
Transcription
1 The tomato genome re-seq project 5 February 2013, Richard Finkers & Sjaak van Heusden
2 Rationale Genetic diversity in commercial tomato germplasm relatively narrow Unexploited genetic diversity available in land races and old varieties? Cultivated tomato has lost valuable traits during domestication Wild species - source of genetic diversity Diverse habitat Variation in flowers and fruits Variation in mating systems Most wild species can be crossed with cultivated tomato (introgression breeding)
3 Rationale Tomato Genome (Re-) Sequencing Project Identify alleles underpinning phenotypic diversity across the entire genome and entire tomato clade
4 Acknowledgement: Sjaak van Heuden, Paris market
5 Tomato fruit shape variation Rodríguez et al (2011) Plant physiology 156:
6 EU-SOL core collection 1000 landraces > 7000 landraces 200 landraces Selected landraces for (re-)sequencing Information: Marker data Phenotype data Passport data Markers 20 (7000 -> 1000) 384 (1000 -> 200) 7500 ( 200 -> 34) Acknowledgement: Dani Zamir et al. & Keygene N.V.
7 Landraces & old cultivar collection
8 Fruit phenotypes EU-SOL collection
9 Improving with exotic genetic libraries Wild tomato species are valuable candidate for novel alleles Dani Zamir, Nature Reviews Genetics 2, (December 2001)
10 Improving with exotic genetic libraries Phylogenetic relationships in the Solanum clade Moyle 2008
11 (re-)sequencing collection Lycopersicon group Arcanum group Eriopersicon group Neolycopersicon group Tree according to Anderson et al. (2010), redrawn from Moyle 2008
12 Genome Alignment Read mapping to cv. Heinz Genome structure wild tomato relatives?
13 Reference genomes: De novo assembly selection Heinz1706 Lycopersicon group LA 2157 Arcanum group LYC 4 Eriopersicon group LA 716 Neolycopersicon group
14 Data production 84 Resequenced genomes 500 bp, 2x100 bp Paired-end Illumina Average coverage 41x 3 de novo genomes (S. arcanum, S. habrochaites, S. pennellii) 170 bp, 2x 100 bp Paired end Illumina 2 kb, 2 x 100 bp Mate-paired end Illumina 8 kb matepair (454) 20 kb matepair (454) Average coverage 205x
15 Genomic sequencing libraries
16 K-mer graph 31-mer volume Millions mer histogram '001' FIT '045' FIT '046' FIT '053' FIT '054' FIT '058' FIT '072' FIT '074' FIT mer 50 frequency Data: 500 bp, 2x100 bp Paired-end Illumina Acknowledgement: Theo Borm
17 K-mer exploration Fitted modi Homozygous Heterozygous Duplicated (2x) Conclusions % heterozygosity is neglectable Duplicated portion is not neglectable Millions 31-mer volume mer histogram mer frequency '001' FIT '045' FIT '046' FIT '053' FIT '054' FIT '058' FIT '072' FIT '074' FIT
18 Genome size estimates Genomic K-mer based estimate Ignores differences GC-AT ratio Underestimation Nr Specie s Est. Size (Mb) Draft Size (Mb) %CP 01 SL Heinz SP SP LA SG SC SA SH SP Acknowledgement: Theo Borm The Tomato Genome Consortium Nature 485, (2012)
19 Optimizing assembly strategy
20 Checking assebly integrity Average completeness per 10 contigs: ALL-PATHS (96.62%) CLC-BIO (74.62%) Heinz dot plot SL2.40 ch11 region (1 Mbp)
21 Status de novo assembly genomes
22 Status de novo assembly genomes N50 N90 Longest Shortest Mean Median N Contigs Total length Heinz 1706 reference 16,467,796 3,041,128 42,121, ,428 2,847 3, ,345,411 S. habrochaites_allpaths 90,424 12, , ,409 20,461 16, ,128,396 S. habrochaites_scaf 515, ,925 3,252, ,475 9,758 5, ,277,628 S. pennellii_allpaths 64,671 7, , ,680 11,008 26, ,990,792 S. pennellii_scaf 206,135 38,969 1,269, ,209 5,932 15, ,730,072 S. arcanum_clc 18,651 2, , , , ,461,203
23 Conclusions Sequencing completed Quality and coverage threshold satisfied Cleaning resequencing data completed De novo assembly of S. habrochaites and S. pennelli comparable with tomato reference De novo assembly of S. arcanum in progress Read mapping and SNP analysis finished
24 And now the fun begins...
25 Average SNP rate/kb (vs. SL2.40)
26 Homozygous vs Heterozygous feature rate
27 Exploring the FW9-2-5 locus (Lin5) Sucrose synthase gene Cloned from S. pennellii amino acid substitutions: 2878 (Asp in LP to Glu in LE) 2932 (Asp to Asn) 2953 (Val to Leu) Fridman et al. Proc Natl Acad Sci U S A Apr 25;97(9):
28 FW9-2-5 variation (Lin5) S. galapagense
29 Needs Whole genome variant catalogue Annotation for the three wild species genomes Pan genome reconstruction How good is our sampling?
30 Perspectives Direct application for Reverse genetics studies Use identified allelic variation Calculate distance based on all genes? Better understanding of genome organization Improve introgression breeding Homozygous vs. hetrerozygous features Scan for inversions Diamond jewelry?
31 150 tomato genome consortium
32 Questions Project site: Phenotype data & Images: SOL100: or
33 Acknowledgments Data production Elio Schijlen Bas te Lintel Hekkert Quality control Saulo Aflitos Huanwen Zhu Minling Xiao Tao Ma Xiaoli Wang Data management and assembly Sandra Smit Jan van Haarst Henri van de Geest Lars Smits Jiumeng Min Jie Chen Xiaoli Wang Project management Sander Peters Richard Finkers Andries Koops Jianbo Jian Yadan Luo Li Liao Tina(Na) Xu
Possibilities & Limitations of Plant Genome Sequences for Plant Breeding
Possibilities & Limitations of Plant Genome Sequences for Plant Breeding Richard GF Visser, Wageningen UR Plant Breeding NGGI-Breeding for Crop Improvement, February 2014 Overview Sequencing and breeding
More informationNGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
More informationAdvanced breeding of solanaceous crops using BreeDB
Part 6 3 rd transplant Training Workshop - October 2014 Exploiting and understanding Solanaceous genomes Advanced breeding of solanaceous crops using BreeDB Richard Finkers Plant Breeding, Wageningen UR
More informationIntrogression Browser tutorial
Introgression Browser tutorial EU-TransPLANT Training course: exploring plant variation data Jan-Peter Nap, Sven Warris, Saulo Alves Aflitos Access at EBI: Family name A-I, please use: http://10.7.243.39:10000
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationThe Human Genome and its upcoming Dynamics
The Human Genome and its upcoming Dynamics Matthias Platzer Genome Analysis Leibniz Institute for Age Research - Fritz-Lipmann Institute (FLI) Sequencing of the Human Genome Publications 2004 2001 2001
More informationMapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More information100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES
Nanopore Community Meeting 2018 100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES Michael Schatz Johns Hopkins University, Baltimore, MD @mike_schatz @NanoporeConf #NanoporeConf
More informationSupplementary Information. The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato
Supplementary Information The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato Uri Krieger 1, Zachary B. Lippman 2 *, and Dani Zamir 1 * 1. The Hebrew University of Jerusalem Faculty
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationSupplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
More informationThe Diploid Genome Sequence of an Individual Human
The Diploid Genome Sequence of an Individual Human Maido Remm Journal Club 12.02.2008 Outline Background (history, assembling strategies) Who was sequenced in previous projects Genome variations in J.
More informationApplication of next generation sequencing of a begomovirusresistant. KASPar assay for SNP detection of the Ty1-Ty3 region
Application of next generation sequencing of a begomovirusresistant inbred to design a KASPar assay for SNP detection of the Ty1-Ty3 region Menda, N. 1, S. Strickler 1, D.M. Dunham 1, D.P. Maxwell 2, L.
More information100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes
100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes Michael Schatz January 15, 2019 PAG2019 Bioinformatics Workshop @mike_schatz Tomato Domestication & Agriculture Tomatoes are
More informationComparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing
Comparison and Evaluation of Cotton SNPs Developed by Transcriptome, Genome Reduction on Restriction Site Conservation and RAD-based Sequencing Hamid Ashrafi Amanda M. Hulse, Kevin Hoegenauer, Fei Wang,
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationOutline. The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing
Illumina Assembly 1 Outline The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing 2 Illumina Sequencing Paired end Illumina
More informationDe novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
More informationSequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
More informationHigh quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple
High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple CSIRO Livestock Industries on behalf of the International Sheep Genomics Consortium Outline of presentation
More informationNEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
More informationHCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers Lecture 7. Populations The foundation of any crop improvement program is built on populations. This session will explore population
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationNext Genera*on Sequencing II: Personal Genomics. Jim Noonan Department of Gene*cs
Next Genera*on Sequencing II: Personal Genomics Jim Noonan Department of Gene*cs Personal genome sequencing Iden*fying the gene*c basis of phenotypic diversity among humans Gene*c risk factors for disease
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationDE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
More informationSUPPLEMENTARY INFORMATION
Contents De novo assembly... 2 Assembly statistics for all 150 individuals... 2 HHV6b integration... 2 Comparison of assemblers... 4 Variant calling and genotyping... 4 Protein truncating variants (PTV)...
More informationNext Generation Genetics: Using deep sequencing to connect phenotype to genotype
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*
More informationHans Merensky Avocado Genomics Project. at the University of Pretoria
Hans Merensky Avocado Genomics Project at the University of Pretoria Compiled by Prof. Noëlani Van den Berg and Dr. Sarah Mwangi in collaboration, with members of the AvoGenome Consortium February 2017
More informationExploring structural variation in the tomato genome with JBrowse
Exploring structural variation in the tomato genome with JBrowse Richard Finkers, Wageningen UR Plant Breeding Richard.Finkers@wur.nl; @rfinkers Version 1.0, December 2013 This work is licensed under the
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationThe New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
More informationlatestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe
Overviewof Illumina s latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe Seminar der Studienrichtung Tierwissenschaften, TÜM, July 1, 2009 Overviewof Illumina
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Minghui Wang Bioinformatics Facility Cornell University DNA Sequencing Platforms Illumina sequencing (100 to 300 bp reads) Overlapping reads ~180bp fragment
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More informationFunctional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group
Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated
More informationExploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics Dario Copetti, PhD Arizona Genomics Institute The University of Arizona International
More informationDE NOVO GENOME ASSEMBLY OF THE AFRICAN CATFISH (CLARIAS GARIEPINUS)
DE NOVO GENOME ASSEMBLY OF THE AFRICAN CATFISH (CLARIAS GARIEPINUS) Kovács B. a,, Barta E. c, Pongor S. L. b, Uri Cs. a, Patócs A. b, Orbán L. d, Müller T. a, Urbányi B. a a Department of Aquaculture,
More informationFruit and Nut Trees Genomics and Quantitative Genetics
Fruit and Nut Trees Genomics and Quantitative Genetics Jasper Rees Department of Biotechnology University of the Western Cape South Africa jrees@uwc.ac.za The Challenges of Tree Breeding Long breeding
More informationCurrent Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon
Current Applications and Future Potential of High Resolution Melting at the National Clonal Germplasm Repository in Corvallis, Oregon Nahla Bassil 1, Michael Dossett 2, Vidyasagar Sathuvalli 2, Chad Finn
More informationBegomovirus resistance z Resistance TYLCV ToMoV Yield Fruit size Designation Source Spring Fall Spring Fall (kg/plant) (g)
Introduction. Five breeding lines are released that have begomovirus resistance gene Ty-3 which provides resistance to tomato yellow leaf curl virus (TYLCV), the new world virus tomato mottle virus (ToMoV),
More informationLecture 1 Introduction to Modern Plant Breeding. Bruce Walsh lecture notes Tucson Winter Institute 7-9 Jan 2013
Lecture 1 Introduction to Modern Plant Breeding Bruce Walsh lecture notes Tucson Winter Institute 7-9 Jan 2013 1 Importance of Plant breeding Plant breeding is the most important technology developed by
More informationExperimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationProceedings of the World Congress on Genetics Applied to Livestock Production,
Genomics using the Assembly of the Mink Genome B. Guldbrandtsen, Z. Cai, G. Sahana, T.M. Villumsen, T. Asp, B. Thomsen, M.S. Lund Dept. of Molecular Biology and Genetics, Research Center Foulum, Aarhus
More informationDomestic animal genomes meet animal breeding translational biology in the ag-biotech sector. Jerry Taylor University of Missouri-Columbia
Domestic animal genomes meet animal breeding translational biology in the ag-biotech sector Jerry Taylor University of Missouri-Columbia Worldwide distribution and use of cattle A brief history of cattle
More informationPharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More informationTitle: High-quality genome assembly of channel catfish, Ictalurus punctatus
Author s response to reviews Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Authors: Qiong Shi (shiqiong@genomics.cn) Xiaohui Chen (xhchenffri@hotmail.com) Liqiang Zhong (lqzhongffri@hotmail.com)
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationUsing molecular marker technology in studies on plant genetic diversity Final considerations
Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!
More informationRNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
More informationDissecting the genetic basis of grain size in sorghum. Yongfu Tao DO NOT COPY. Postdoctoral Research Fellow
Dissecting the genetic basis of grain size in sorghum Yongfu Tao Postdoctoral Research Fellow Why study grain size? The importance of grain size: Key yield component Key quality issue for grain growers
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationChapter 3: Evolutionary genetics of natural populations
Chapter 3: Evolutionary genetics of natural populations What is Evolution? Change in the frequency of an allele within a population Evolution acts on DIVERSITY to cause adaptive change Ex. Light vs. Dark
More informationDe novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationProgress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses
Progress in genomics applications in investigating abiotic stresses influencing perennial forage and biomass grasses Dr. Susanne Barth Teagasc Crops Research Centre Oak Park Carlow Irland Global challenges
More informationDirect determination of diploid genome sequences. Supplemental material: contents
Direct determination of diploid genome sequences Neil I. Weisenfeld, Vijay Kumar, Preyas Shah, Deanna M. Church, David B. Jaffe Supplemental material: contents Supplemental Note 1. Comparison of performance
More informationDe Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa
More informationSequencing and assembly of the sheep genome reference sequence
Sequencing and assembly of the sheep genome reference sequence Yu Jiang Kunming Institute of Zoology, CAS, China the International Sheep Genomics Consortium (ISGC) ISGC Presentations Yu Jiang, Kunming
More informationPrioritization: from vcf to finding the causative gene
Prioritization: from vcf to finding the causative gene vcf file making sense A vcf file from an exome sequencing project may easily contain 40-50 thousand variants. In order to optimize the search for
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationA draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
More informationFigure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from
More informationGene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
More informationTechnologies, resources and tools for the exploitation of the sheep and goat genomes.
Technologies, resources and tools for the exploitation of the sheep and goat genomes. B. P. Dalrymple, G. Tosser-Klopp, N. Cockett, A. Archibald, W. Zhang and J. Kijas. The plan The current state of the
More informationNature Genetics: doi: /ng Supplementary Figure 1. The pedigree information for American upland cotton breeding.
Supplementary Figure 1 The pedigree information for American upland cotton breeding. The integrated figure was modified from Fig. 1 to 10 in Calhoun, Bowman & May (1994). The accessions with blue color
More informationWheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationDe novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
More informationNature Genetics: doi: /ng Supplementary Figure 1. Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions.
Supplementary Figure 1 Neighbor-joining tree of the 183 wild, cultivated, and weedy rice accessions. Relationships of cultivated and wild rice correspond to previously observed relationships 40. Wild rice
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.
Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a
More informationAnchoring and ordering NGS contig assemblies by population sequencing (POPSEQ)
Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ) Martin Mascher IPK Gatersleben PAG XXII January 14, 2012 slide 1 Proof-of-principle in barley Diploid model for wheat 5 Gb
More informationFunded by the Overseas Development Administration (ODA)
Centre for Arid Zones Studies, University of Wales, UK Cambridge Laboratory, Norwich, UK ICRISAT, India Funded by the Overseas Development Administration (ODA) Early papers on QTL mapping Staple food crop
More informationNature Biotechnology: doi: /nbt.3943
Supplementary Figure 1. Distribution of sequence depth across the bacterial artificial chromosomes (BACs). The x-axis denotes the sequencing depth (X) of each BAC and y-axis denotes the number of BACs
More informationDNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing
TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence
More informationPhenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.
Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after
More informationSupplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were
Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were processed following GBS experimental design 1 and bioinformatics
More informationI.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More informationSupplementary Data 1.
Supplementary Data 1. Evaluation of the effects of number of F2 progeny to be bulked (n) and average sequencing coverage (depth) of the genome (G) on the levels of false positive SNPs (SNP index = 1).
More informationLinkage Disequilibrium
Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level
More informationHigh-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
More informationCSE182-L16. LW statistics/assembly
CSE182-L16 LW statistics/assembly Silly Quiz Who are these people, and what is the occasion? Genome Sequencing and Assembly Sequencing A break at T is shown here. Measuring the lengths using electrophoresis
More informationWhy can GBS be complicated? Tools for filtering, error correction and imputation.
Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More informationGenome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora Jerry Jenkins 1, Xiaohan Yang 2, Hengfu Yin 2, Gerald A. Tuskan 2, John C. Cushman 3, Won Cheol Yim 3, Jason
More informationHigh density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR
High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR Nils Stein, Joel Kuon, Uwe Scholz, Martin Mascher, Benjamin Kilian, Kerstin Neumann,
More informationPlant Breeding and Agri Genomics. Team Genotypic 24 November 2012
Plant Breeding and Agri Genomics Team Genotypic 24 November 2012 Genotypic Family: The Best Genomics Experts Under One Roof 10 PhDs and 78 MSc MTech BTech ABOUT US! Genotypic is a Genomics company, which
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationPathway approach for candidate gene identification and introduction to metabolic pathway databases.
Marker Assisted Selection in Tomato Pathway approach for candidate gene identification and introduction to metabolic pathway databases. Identification of polymorphisms in data-based sequences MAS forward
More informationBioinformatic analysis of Illumina sequencing data for comparative genomics Part I
Bioinformatic analysis of Illumina sequencing data for comparative genomics Part I Dr David Studholme. 18 th February 2014. BIO1033 theme lecture. 1 28 February 2014 @davidjstudholme 28 February 2014 @davidjstudholme
More informationDe novo Genome Assembly
De novo Genome Assembly A/Prof Torsten Seemann Winter School in Mathematical & Computational Biology - Brisbane, AU - 3 July 2017 Introduction The human genome has 47 pieces MT (or XY) The shortest piece
More informationTowards Personal Genomics
Towards Personal Genomics Tools for Navigating the Genome of an Individual Saul A. Kravitz J. Craig Venter Institute Rockville, MD Bio-IT World 2008 Introduce yourself Relate our experience with individual
More informationThe international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
More information