PROTEIN SYNTHESIS. copyright cmassengale

Size: px
Start display at page:

Download "PROTEIN SYNTHESIS. copyright cmassengale"

Transcription

1 PROTEIN SYNTHESIS 1

2 DNA and Genes 2

3 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3

4 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4

5 Other Differences RNA contains the base uracil (U) DNA has thymine (T) RNA molecule is single-stranded DNA is doublestranded DNA 5

6 Structure of RNA 6

7 Central Dogma of Biology DNA codes for RNA which guides the synthesis of proteins! 7

8 . Three Types of RNA Messenger RNA (mrna) copies DNA s code & carries the genetic information to the ribosomes Ribosomal RNA (rrna), along with protein, makes up the ribosomes Transfer RNA (trna) transfers amino acids to the ribosomes where proteins are synthesized 8

9 amino acid attachment site mrna UA C anticodon trna rrna 9

10 Central Dogma of Biology Step 1 DNA codes for RNA which guides the synthesis of proteins! 10

11 TRANSCRIPTION IS HAPPENING AT THE SAME TIME AS DNA REPLICATION! 11

12 Transcription - 1 A portion of the DNA molecule unzips Recall: DNA helicase is the enzyme responsible for this! 12

13 Transcription - 2 RNA polymerase joins RNA nucleotides using the DNA strand as a template This new strand of RNA is the mrna strand 13

14 14

15 Transcription - 3 After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional 15

16 Transcription - 3 Introns, non-functional segments of DNA are snipped out of the chain Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase 16

17 Result of Transcription CAP New Transcript Tail 17

18 mrna Transcript - 4 mrna leaves the nucleus through its pores and goes to the ribosomes 18

19 The Genetic Code A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating 19

20 The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine 20

21 Name the Amino Acids GGG? UCA? CAU? GCA? AAA? 21

22 Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U C-G 22

23 Question: What would be the complementary RNA strand for the following DNA sequence? DNA 5 -GCGTATG-3 23

24 Answer: DNA 5 -GCGTATG-3 RNA 3 -CGCAUAC-5 24

25 Central Dogma of Biology Step 2 mrna creates proteins 25

26 Translation Translation is the process of decoding the mrna into a polypeptide chain to create proteins (amino acids) Ribosomes read mrna three bases or 1 codon at a time and construct the proteins 26

27 Transcription Translation 27

28 Ribosomes Composed of rrna and proteins Have two sites for trna attachment --- P and A The P site is the first to read the mrna 28

29 Step 1 mrna transcript start codon AUG must be read This signals to the ribosome to start making proteins mrna transcript 29

30 Ribosomes P Site A Site mrna A U G C U A C U U C G 30

31 Step 2 As ribosome moves, two trna with their amino acids move into site A and P of the ribosome 31

32 aa1 aa2 anticodon 1-tRNA 2-tRNA U A C G A U A U G C U A C U U C G A codon mrna 32

33 aa1 peptide bond aa2 aa3 3-tRNA anticodon hydroen bonds 1-tRNA 2-tRNA U A C G A U A U G C U A C U U C G codon G A mrna 33 A A

34 aa1 aa2 peptide bond aa3 1-tRNA U A C (leaves) 2-tRNA 3-tRNA G A A G A U A U G C U A C U U C G A Ribosomes move over one codon mrna 34

35 aa1 peptide bonds aa4 aa2 aa3 2-tRNA 3-tRNA G A U G A A A U G C U A C U U C G A 4-tRNA G C U A C U mrna 35

36 aa1 peptide bonds aa2 aa3 aa4 G 2-tRNA A U (leaves) 3-tRNA G A A A U G C U A C U U C G Ribosomes move over one codon A 4-tRNA G C mrna 36 U A C U

37 aa1 aa2 peptide bonds aa3 aa4 aa5 5-tRNA U G A 3-tRNA 4-tRNA G A A G C U G C U A C U U C G A A C U mrna 37

38 aa1 aa2 peptide bonds aa3 aa4 aa5 5-tRNA 3-tRNA G A A 4-tRNA G C G C U A C U U C G U A A C U Ribosomes move over one codon U G A mrna 38

39 aa4 aa5 aa199 Termination aa3 aa2 primary structure of a protein aa200 aa1 A C U C A U G U U mrna 200-tRNA terminator or stop codon U A G 39

40 End Product The Protein! The end products of protein synthesis is an amino acid chain that makes up a protein aa2 aa3 aa4 aa5 aa199 aa1 aa200 40

41 Messenger RNA (mrna) mrna start codon A U G G G C U C C A U C G G C G C A U A A codon 1 codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 protein methionine glycine serine isoleucine glycine alanine stop codon Amino Acid Chain aa1 aa2 aa3 aa4 aa5 aa6 peptide bonds 41

42 Beadle & Tatum Hypothesis One GENE codes for one POLYPEPTIDE (protein) 42

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

DNA, RNA, and PROTEIN SYNTHESIS

DNA, RNA, and PROTEIN SYNTHESIS DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells

More information

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose

More information

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA 6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering

Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

Molecular Genetics. Before You Read. Read to Learn

Molecular Genetics. Before You Read. Read to Learn 12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

PROTEIN SYNTHESIS. Higher Level

PROTEIN SYNTHESIS. Higher Level PROTEIN SYNTHESIS Higher Level Lesson Objectives At the end of this lesson you should be able to 1. Outline the steps in protein synthesis 2. Understand DNA contains the code for protein 3. Understand

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

TRANSCRIPTION AND TRANSLATION

TRANSCRIPTION AND TRANSLATION TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Key Concepts. Ø DNA Replication Ø Protein Synthesis Ø Transcription: Ø Translation: Ø messenger RNA (mrna)

Key Concepts. Ø DNA Replication Ø Protein Synthesis Ø Transcription: Ø Translation: Ø messenger RNA (mrna) Heredity B-4.3 Explain how DNA functions as the code of life and the blueprint for proteins. (Focus on DNA replication) B-4.4: Summarize the basic process involved in protein synthesis (including transcription

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

Proteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'

Proteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator' Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino

More information

Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part

Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part of the nucleotide sequence of the DNA into RNA. RNA

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928 HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA

More information

Why are proteins important?

Why are proteins important? PROTEIN SYNTHESIS Why are proteins important? proteins help build cell structures some proteins are enzymes that promote biological reactions Proteins are found in muscles, blood, bones, etc.. RNA RNA

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark) Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.

More information

BIOLOGY. Monday 14 Mar 2016

BIOLOGY. Monday 14 Mar 2016 BIOLOGY Monday 14 Mar 2016 Entry Task List the terms that were mentioned last week in the video. Translation, Transcription, Messenger RNA (mrna), codon, Ribosomal RNA (rrna), Polypeptide, etc. Agenda

More information

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes

More information

Protein Synthesis Foldable

Protein Synthesis Foldable Ameoba Sisters Protein Synthesis Foldable Transcription What? How? What are the steps? Location? Why? Draw a picture to represent this. Translation What? How? What are the steps? Location? Why? Draw a

More information

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein? Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

Chapter 17. From Gene to Protein. AP Biology

Chapter 17. From Gene to Protein. AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

DNA Begins the Process

DNA Begins the Process Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process

More information

Ch 10.4 Protein Synthesis

Ch 10.4 Protein Synthesis Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains

More information

The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation

The Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A

More information

Protein Synthesis Review Bi 12 /25

Protein Synthesis Review Bi 12 /25 Name: Class: _ Date: _ Protein Synthesis Review Bi 12 /25 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. A certain gene codes for a polypeptide that is

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Transcription and Translation

Transcription and Translation Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism

More information

Protein Synthesis 101

Protein Synthesis 101 Protein Synthesis 101 What is DNA? - Blueprint of Life (has the instructions for making ) - Gene = a segment of DNA which determines a ( ) - - is wrapped around protein to form - Structure was discovered

More information

Sections 12.3, 13.1, 13.2

Sections 12.3, 13.1, 13.2 Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

Chapter 7: Genetics Lesson 7.1: From DNA to Proteins

Chapter 7: Genetics Lesson 7.1: From DNA to Proteins Chapter 7: Genetics Lesson 7.1: From DNA to Proteins The spiral structure in the picture is a large organic molecule. Can you guess what it is? Here s a hint: molecules like this one determine who you

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

UNIT 7. DNA Structure, Replication, and Protein Synthesis

UNIT 7. DNA Structure, Replication, and Protein Synthesis UNIT 7 DNA Structure, Replication, and Protein Synthesis Section 3 Objectives Describe the difference between DNA and RNA. Define transcription. Define translation. Apply to rules of base pairing to replicate,

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Warm-Up: Check your Answers

Warm-Up: Check your Answers Warm-Up 1. What are the 3 components of a nucleotide? 2. What are the 4 nitrogen bases that are found in DNA? 3. What type of bonds are found between 2 nitrogen bases? 4. During DNA replication, what breaks

More information

DNA, RNA and protein synthesis

DNA, RNA and protein synthesis DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.

More information

Biology. DNA & the Language of Life

Biology. DNA & the Language of Life Biology DNA & the Language of Life Genes are Made of DNA Fredrick Griffith (1928) studied pneumonia strains (one was harmless while the other was pathogenic, or disease-causing) Made non-harmful strains

More information

AP Biology

AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

Section 3: DNA Replication

Section 3: DNA Replication Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication

More information

Biology Celebration of Learning (100 points possible)

Biology Celebration of Learning (100 points possible) Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein

More information

Replication Transcription Translation

Replication Transcription Translation Replication Transcription Translation A Gene is a Segment of DNA When a gene is expressed, DNA is transcribed to produce RNA and RNA is then translated to produce proteins. Genotype and Phenotype Genotype

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code

More information

DNA, RNA, and Protein Synthesis

DNA, RNA, and Protein Synthesis http://faculty.uca.edu/~johnc/mbi1440.htm DNA, RNA, and Protein Synthesis http://www.wappingersschools.org/rck/staff/teacherhp/johnson/visualvocab/mrna.gif DNA base pairs carry the genetic Section 12-1

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

Unit 5 DNA, RNA, and Protein Synthesis

Unit 5 DNA, RNA, and Protein Synthesis 1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic

More information

الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1

الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء. 222Cell Biolgy 1 الحمد هلل رب العالميه الذي هداوا لهذا وما كىا لىهتدي لىال أن هداوا اهلل والصالة والسالم على أشزف األوبياء 222Cell Biolgy 1 Lecture 14 222Cell Biolgy 2 DNA replication DNA replication is a semi-conservative

More information

Ribonucleic Acid (RNA) and Protein Synthesis

Ribonucleic Acid (RNA) and Protein Synthesis Ribonucleic Acid (RNA) and Protein Synthesis Section 12-3 Summary The /RNA connection and RNA are partners in the business of making proteins. is a specialist. It provides stable, permanent storage of

More information

DNA, RNA, and Protein. The Whole Story

DNA, RNA, and Protein. The Whole Story DNA, RNA, and Protein The Whole Story They didn t always know DNA was the Genetic Material. But they did know that the genetic material needed to do four things. The Master Molecule Contains Information

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016 Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Name: Period: Date: This handout will guide you through the format as you preview section 13.1 RNA in your textbook.

Name: Period: Date: This handout will guide you through the format as you preview section 13.1 RNA in your textbook. Name: Period: Date: Section 13.1 RNA How does RNA differ from DNA? How does the cell make RNA? This handout will guide you through the format as you preview section 13.1 RNA in your textbook. Part 1. Vocabulary

More information

(deoxyribonucleic acid)

(deoxyribonucleic acid) 1 The Central Dogma of Molecular Biology Mark Mayo Cypress College 2 The Central Dogma of Molecular Biology 3 Importance of Proteins There are three main kinds: structural - make up most body parts hormone

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Biology A: Chapter 9 Annotating Notes Protein Synthesis

Biology A: Chapter 9 Annotating Notes Protein Synthesis Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side

More information

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to: 1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what

More information

Name Date Class. The Central Dogma of Biology

Name Date Class. The Central Dogma of Biology Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms

More information

UNIT 3 GENETICS LESSON #41: Transcription

UNIT 3 GENETICS LESSON #41: Transcription UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have

More information

How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information

How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied

More information