Standard Operating Procedure (SOP) for Bacteroides thetaiotaomicron human marker qpcr Assay
|
|
- Teresa Richardson
- 6 years ago
- Views:
Transcription
1 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 1 9/13/2010 Standard Operating Procedure (SOP) for Bacteroides thetaiotaomicron human marker qpcr Assay References: Yampara-Iquise, H., Zheng, G., Jones, J.E. and Carson, C.A. (2008) Use of a Bacteroides thetaiotaomicron-specific Alpha-1-6, mannanase quantitative PCR to detect human faecal pollution in water. J Appl Microbiol 105, Roche Applied Science Light Cycler 480 Operator s manual.
2 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 2 9/13/2010 Recommended Quality Control Procedures: Users must wear gloves at all times and avoid direct hand contact with qpcr reagents to avoid contamination. Use separate designated spaces for reagent preparation and sample addition. Do not move the pipet tips, microtube racks, microtubes, pipettes and other supplies from one space to another. Routinely wipe the hood/bench surfaces with 70% alcohol and UV-disinfect for 15 minutes before and after use. Store reagents in appropriate conditions as per the manufacturer s product manual. 1. Preparation of B. thetaiotaomicron α-1-6, mannanase gene real-time PCR quantification standard solution for the standard curve: Genomic DNA from B. thetaiotaomicron VPI 5482was purchased from American Type Culture Collection, VA, USA (ATCC Number: 29148D-5) and was used for the standardization of qpcr assay Amplification by conventional PCR: a) A section of (~522bp) α-1-6, mannanase gene was amplified from the B. thetaiotaomicron DNA by conventional PCR using the primer set (forward primer 5 GCGGTACACATAACGGG 3 and reverse primer 5 GTTGCCAGTAGATATAAGTCGATT -3 ). b) PCR reaction mixture (total volume of 25µL) was prepared according to the following table. Components of the PCR mix for one reaction: Ingredients Volume /reaction HotStar Taq Master Mix 14.0 µl Forward Primer (10 µm stock) Reverse Primer (10 µm stock) Molecular Grade water 1.0 µl 1.0 µl 6.0 µl DNA template 3.0 µl Total final volume 25.0 µl
3 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 3 9/13/2010 c) PCR thermal cycling program is listed as following. PCR program for amplification of a section of 23srDNA gene. PCR step Cycles Target temperature Hold time (hh:mm:ss) Initial activation 1 95 C 00:10:00 Amplification 35 Denaturation 95 C 00:00:30 Annealing 58 C 00:00:30 Extension 72 C 00:00:60 Final Extension 1 72 C 00:08:00 d) Check the PCR product by agarose gel (1.2%, w/v) electrophoresis (100 V for ~ 1-1.5hrs). A single, discrete band should be observed close to 522 bps maker in the gel Cloning: Clone target alpha-mannanase gene into TOPO vector and transform plasmid vector into TOP10 Competent E. coli cells. Fresh PCR products were cloned into plasmid vector (pcr 2.1 TOPO ) and the plasmid vectors were transformed into TOP10 Competent E. coli cells (One Shot Chemical Transformation) based on TOPO TA Cloning Instruction Manual (Invitrogen, Carlsbad, CA). Things to be done before starting this experiment: Set-up a water bath or heat-block to 42 C. Warm the vial of S.O.C. medium to room temperature. Warm selective plates at 37 C for 30 minutes. Spread 40 μl of 40 mg/ml X-gal on each LB plate and incubate at 37 C until ready for use. (X-gal preparation: 40 mg/ml X-gal in dimethylformamide (DMF)) Thaw on ice 1 vial of One Shot cells for each transformation. a) Prepare a cloning reaction (total volume of 6 µl) based on the table below. Reagent Volume Fresh PCR product 3 µl Salt Solution 1 µl Sterile Water 1 µl TOPO vector 1 µl Final Volume 6 µl b) Mix reaction gently and incubate for 5 minutes at room temperature. c) Place the reaction on ice. d) Add 2 µl of the TOPO Cloning reaction into a vial of One Shot Chemically Competent E. coli cells and mix gently (do not mix by pipetting or vortex).
4 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 4 9/13/2010 e) Incubate on ice for 5 minutes. f) Heat- shock the cells for 30 seconds at 42 C without shaking. g) Immediately transfer the tubes to ice. h) Add 250 μl of room temperature S.O.C. medium. Cap the tube tightly and shake the tube horizontally (200 rpm) at 37 C for 1 hour. i) Spread µl of the transformation on prewarmed selective plates and incubate overnight at 37 C.(The plates should be spread with 40 μl of 40 mg/ml X-gal and incubate at 37 C until ready for use.) j) Pick several (~5) white colonies and grow in 0.5 ml LB amp50 media overnight (or hours) at 37 C. (A single, well-isolated colony is used to inoculate one LB amp50 medium.). k) Add 0.5 ml 40% glycerol, mix thoroughly, and store the E. coli cells (carrying plasmid vectors with target 23srDNA gene) in -20 C freezer Purification of plasmid DNA The plasmid DNA is purified using the QIAGEN Plasmid miniprep. a. Resuspend pelleted bacterial cells in 250 μl Buffer P1 and transfer to a microcentrifuge tube. If LyseBlue reagent has been added to Buffer P1, vigorously shake the buffer bottle to ensure LyseBlue particles are completely dissolved. The bacteria should be resuspended completely by vortexing or pipetting up and down until no cell clumps remain. b. Add 250 μl Buffer P2 and mix thoroughly by inverting the tube 4 6 times. Mix gently by inverting the tube. Do not vortex, as this will result in shearing of genomic DNA. If necessary, continue inverting the tube until the solution becomes viscous and slightly clear. Do not allow the lysis reaction to proceed for more than 5 min. If LyseBlue has been added to Buffer P1 the cell suspension will turn blue after addition of Buffer P2. Mixing should result in a homogeneously colored suspension. If the suspension contains localized colorless regions or if brownish cell clumps are still visible, continue mixing the solution until a homogeneously colored suspension is achieved. c. Add 350 μl Buffer N3 and mix immediately and thoroughly by inverting the tube 4 6 times. To avoid localized precipitation, mix the solution thoroughly, immediately after addition of Buffer N3. Large culture volumes (e.g. 5 ml) may require inverting up to 10 times. The solution should become cloudy. If LyseBlue reagent has been used, the suspension should be mixed until all trace of blue has gone and the suspension is colorless. A homogeneous colorless suspension indicates that the SDS has been effectively precipitated.
5 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 5 9/13/2010 d. Centrifuge for 10 min at 13,000 rpm (~17,900 x g) in a table-top microcentrifuge. A compact white pellet will form. e. Apply the supernatants from step 4 to the QIAprep spin column by decanting or pipetting. f. Centrifuge for s. Discard the flow-through. g. Recommended: Wash the QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for s. Discard the flow-through. h. Wash QIAprep spin column by adding 0.75 ml Buffer PE and centrifuging for s. i. Discard the flow-through, and centrifuge for an additional 1 min to remove residual wash buffer. Important: Residual wash buffer will not be completely removed unless the flow-through is discarded before this additional centrifugation. Residual ethanol from Buffer PE may inhibit subsequent enzymatic reactions. j. Place the QIAprep column in a clean 1.5 ml microcentrifuge tube. To elute DNA, add 50 μl Buffer EB (10 mm Tris Cl, ph 8.5) or water to the center of each QIAprep spin column, let stand for 1 min, and centrifuge for 1 min Sequencing of PCR product In order to confirm if PCR products are cloned, sequencing of the plasmid is needed. - Preparation of primer and DNA sample for sequence at MSU RTSC The guideline of preparation of primer and DNA sample can be followed according the RTSF website The sequencing center located at S18 Plant Biology Building. - Retrieving sequencing Data Login to the MSU Research Technology Support Center Finch Server. (The lab Username is jbr and password is w5uac0a.r) Click the folders icon at the left side of the screen and then the number under the # Chromats column. Select the sequence data under the Label column. Blast the sequence at NCBI site and analyze the results
6 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 6 9/13/ Quantify purified plasmid DNA Purified plasmid DNA was quantified by spectrophotometer (NanoDrop ND-1000). a) Run 2 µl of molecular grade water as blank. b) Add 2 µl of purified plasmid DNA to the detection tip of NanoDrop ND-1000 to measure the plasmid DNA concentration. c) Repeat measurement 5 times. Ignore the lowest and highest values and average rest of 3 data points. d) Convert the average concentration from ng/µl to copies/reaction. ~4,311 base pair ~660 g/mole/base pair 2,845,260 g/mole. [3,931 bp (pcr 2.1 TOPO plasmid vector) bp (PCR products) = 4,311 bp]. 1 ng ~2,845,260 g/mole mole. (~ mole) (~ copies/mole) copies. Therefore, 1ng/µL plasmid DNA equals to copies/µl (or copies/reaction) Preparation of real-time PCR standard Real time PCR standard can be prepared by diluting in either PCR graded water or negative sample or the elution buffer in which the plasmid DNA was eluted. a) Prepare a standard with molecular grade water Prepare the standard with molecular grade water according to the following table: Components of standard with molecular grade water: Standard Volume of water Volume/Conc of Standard (copies/rxn) (ul) (ul/ copies/rxn) / / / / / / / 10 1 a) Dispense appropriated volume of mixture prepared into each standard tube. Label the tube accordingly.
7 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 7 9/13/2010 b) Mix the newly prepared standard completely and briefly centrifuge to remove drops from the lid or sidewall of the centrifuge tube and mix by pipetting up and down before used for the next serial dilution Quantification of the standard B. thetaiotaomicron α-1-6, mannanase gene by real-time PCR to obtain the standard curve: Ten fold dilutions of standard plasmid were quantified by using following primers and probe, forward primer 5 CATCGTTCGTCAGCAGTAACA3,Reverse primer 5 - CCAAGAAAAAGGGACAGTGG-3 and Probe FAM-ACCTGCTG-BHQ ( Probe ordered through Roche Universal Probe Library; UPL probe # 62). The analysis of this section is further described in section Quantification of B. thetaiotaomicron α-1-6, mannanase gene by real-time PCR from environmental samples and/or standards: 1. Program the LightCycler real-time PCR system (as given below) 2. Wear lab coat, and glove. 3. Disinfect the PCR Preparation Station (i.e., Misonix PCR Prep Station) using 70% EtOH, UV light and/or DNAZap (Ambion). 4. Thaw 5X LightCycler Taqman 480 Probe Master Mix, 10 µm forward primer, 10 µm reverse primer, Magnesium chloride, PCR-grade water, samples and standards. 5. Prepare a super mix for n+2 reactions (n = total samples) in a 1.5 ml centrifuge tube at the PCR Prep Station according to the table. Components of the PCR mix for one reaction in the real-time PCR assay: Ingredients LightCycler Taqman 480 Probe Master Mix BthF primer 1 (10µM stock) Bth R primer 2 (10µM stock) EcuidAProbe 3 (10 µm stock) Volume /reaction 10 µl 0.4 µl 0.4 µl 0.2 µl PCR-grade water 4 µl Total final volume 15 µl
8 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 8 9/13/ Mix the super mix completely and briefly centrifuge to remove drops from lid or sidewall of the centrifuge tube. 7. Dispense 15 µl of the super mix into each LightCycler 96 well plate. 8. Add 5 µl of DNA template from the standards prepared into each assigned well at the sample adding station. 9. Seal the well plate with provided parafilm. Hold the foil by the two outside perforated edges. Separate the foil from the protective coating by pealing the corner of the inner crease and remove the protective layer. Hold the foil by the two edges that still have protective coating still attached. Make sure not to unnecessarily touch the foil with no protective layer results will be affected. Put the foil onto the micro well plate; while making sure that the same side of the foil that was touching the protective coating is the one that will be making contact with the micro well Plate. Square the foil with the micro well plate and place it on to it. Gently push the outside four corners of the foil to make sure it is gently in place. While holding the micro well plate firmly, use the foil applicator to seal each well in place by running one side of it firmly over each well. If a crease forms over the wells get a new foil and start over. Tear off both perforated edges. 10. Bring to the salad spinner and place it in the bottom. Give it 1-2 complete compressions and use the black stop button to stop it spinning 11. Load the 96 well plate into the Roche LightCycler Put reagents, samples, and standard solution back to -20 C freezer. Clean-up the PCR Prep Station and the Sample Addition Station Analyzing the data using Lightcycler Saving the standard curve The standard curve can be saved for future quantification. To save the standard curve, click Standard curve (In Run) and select Save as external. Name the standard curve accordingly. In order to use previously saved standard curve for quantification of unknown samples, each batch of the reaction should contain at least a duplicated standard with the same concentration as one point of the saved standard curve Operation and Programming of LightCycler 480 real-time PCR machine a. Computer login a) Turn on the computer. b) Click the Lightcycler Software icon. Login window will appear. Username is lab and password is rose_lab123. (Log off the computer after turning it on and login again to get the computer started)
9 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 9 9/13/2010 b. PCR reaction programming 1. Click new experiment in the overview menu. 2. The new experiment window should now appear. 3. Set the program conditions (Table 1) and select the ( ) PCR step Cycles Target Temperature Hold Time (hh:mm:ss) Initial Activation 1 95 C 00:15:00 Amplification 50 Denaturation 95 C 00:00:15 Annealing 60 C 00:00:60 Extension 72 C 00:00:05 Cooling 1 40 C 00:00:30 4. Click Start Run 5. Save in appropriate folder 6. Select Subset Editor 7. Choose ABS Quantification 8. Click (+) and name subset appropriately 9. Highlight the appropriate numbers of cells via the mouse and control key then click Apply. 10. Click the Sample Editor 11. Click Toggle View 12. Choose the subset you made prior. 13. Check or uncheck the correct Absorption Wavelength for your samples. (Uncheck the filter) 14. If replicates are present in your micro well plate highlight the replicates and select Make Replicates. 15. Name the samples, give their concentrations if know and give them the distinction of standard (10^6 or 10^5), unknown, negative control, or positive control. 16. Click Experiment to view progress. 17. Upon completion click Analysis and select Abs Quant/ 2 nd Der Max and select the subset and click ( ). 18. Check if lines are appropriate. If not check to see if ABS is incorrect if so change it and see if it has an effect. If yes then calculate then click Calculate. Choose STD external. Select hubactheta std located near the bottom of the list. Recalculate. 19. If creating a standard curve then select the STD Curve button and save as external. 20. Click Report **Must Save For the Report Button to Become Activate** 21. Click Subset that was used 22. Click General tab and X the boxes for Setting, Results, Amp Curve, Standard Curve and STATS also samples if desired. 23. Click Generate 24. Save in folder and print.
10 Asli Aslan, Sangeetha Srinivasan & Joanna Pope Page 10 9/13/ Calculating qpcr Concentrations into qpcr Equivalent Cells/100mL Example Calculation Starting Volume= 1000 ml Pelleted down= 3 ml entire 3 ml used for extraction 200 µl Extracted DNA Volume 1000 ml x _ 5 µl = Assayed Volume 200 µl Copies = Copies/Rxn ) (value from LC 480 e.g * 10^3) ml Assayed Volume Divide by number of copies of target gene/cell (e.g. 1 for α-mannanase) _qpcr eq. cells _ = Copies/Rxn (qpcr concentrations) x mL Assayed Volume
Presto Mini Plasmid Kit
Instruction Manual Ver. 03.06.17 For Research Use Only Presto Mini Plasmid Kit PDH004 (4 Preparation Sample Kit) PDH100 (100 Preparation Kit) PDH300 (300 Preparation Kit) Advantages Sample: 1-7 ml of cultured
More informationQIAfilter Plasmid Midi Kit (Cat #: 12243)
QIAfilter Plasmid Midi Kit (Cat #: 12243) Things to do before starting Add the provided RNase A solution to Buffer P1 before use. Use one vial of RNase A (centrifuge briefly before use) per bottle of Buffer
More informationHurricane Miniprep Kit PROTOCOL
Hurricane Miniprep Kit PROTOCOL Description: The Hurricane Miniprep Kit is designed for purification of up to 25 ug of high purity plasmid DNA from a starting volume of 2-5 ml of bacterial culture. The
More informationTIANpure Mini Plasmid Kit
TIANpure Mini Plasmid Kit For purification of molecular biology grade DNA www.tiangen.com PP080822 TIANpure Mini Plasmid Kit Kit Contents Storage Contents RNaseA (10 mg/ml) Buffer BL Buffer P1 Buffer P2
More informationI-Blue Midi Plasmid Kit. I-Blue Midi Plasmid Kit. (Endotoxin Free) IBI SCIENTIFIC. Instruction Manual Ver For Research Use Only.
Instruction Manual Ver. 05.11.17 For Research Use Only I-Blue Midi Plasmid Kit & I-Blue Midi Plasmid Kit (Endotoxin Free) IB47180, IB47190 (2 Preparation Sample Kit) IB47181, IB47191 (25 Preparation Kit)
More informationInterLab Study: Plasmid amplification
igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven InterLab
More informationRapid amplification of cdna ends (RACE)
Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE
More informationComplete protocol in 110 minutes Enzymatic fragmentation without sonication One-step fragmentation/tagging to save time
Molecular Cloning Laboratories Manual Version 1.2 Product name: MCNext UT DNA Sample Prep Kit Cat #: MCUDS-4, MCUDS-24, MCUDS-96 Description: This protocol explains how to prepare up to 96 pooled indexed
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq
More informationTIANpure Midi Plasmid Kit
TIANpure Midi Plasmid Kit For purification of molecular biology grade DNA www.tiangen.com Kit Contents Storage TIANpure Midi Plasmid Kit Contents RNaseA (10 mg/ml) Buffer BL Buffer P1 Buffer P2 Buffer
More informationGeneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free)
Geneaid Maxi Plasmid Kit & Geneaid Maxi Plasmid Kit (Endotoxin Free) PM002, PME02 (2 Preparation Sample Kit) PM010, PME10 (10 Preparation Kit) PM025, PME25 (25 Preparation Kit) Instruction Manual Ver.
More information7.13 Experimental Microbial Genetics
MIT OpenCourseWare http://ocw.mit.edu 7.13 Experimental Microbial Genetics Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. 7.13 Fall 2008 Page
More informationTIANpure Mini Plasmid Kit II
TIANpure Mini Plasmid Kit II For purification of molecular biology grade DNA www.tiangen.com/en DP140918 Kit Contents Storage TIANpure Mini Plasmid Kit II Contents RNase A (10 mg/ml) Buffer BL Buffer P1
More informationTaKaRa MiniBEST Plasmid Purification Kit Ver.4.0
Cat. # 9760 For Research Use TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Shipping and Storage... 4 IV. Preparation
More informationVDL101.3 CLONING TRANSGENE INTO pad5f35
Purpose 1.1. The purpose of this protocol is to transfer a transgene from the pshuttlex plasmid to pad5/f35. 1.2. The starting material is 10 μg plasmid DNA. 1.3. This procedure is routinely performed
More informationAmplicon Library Preparation Method Manual. GS FLX Titanium Series October 2009
GS FLX Titanium Series 1. Workflow 3. Procedure The procedure to prepare Amplicon libraries is shown in Figure 1. It consists of a PCR amplification, performed using special Fusion Primers for the Genome
More informationITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector
Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph
More informationPlasmid DNA Extraction Miniprep Kit
BIO BASIC Plasmid DNA Extraction Miniprep Kit 9K-006-0009s (10 preps) 9K-006-0009 (100 preps) 9K-006-0010 (200 preps) For Research Use Only Index Plasmid DNA Extraction Miniprep Kit Introduction 3 Important
More informationCTNNB Mutation Analysis Kit
CTNNB1 32-37 Mutation Analysis Kit For quantitative detection of mutations in codons 32-37 in the CTNNB1 gene by qpcr 50 tests For research use only. Developing Innovative, Noninvasive cfdna tests for
More informationTIANprep Yeast Plasmid Kit
TIANprep Yeast Plasmid Kit For fast and convenient purification of plasmid DNA from yeast www.tiangen.com/en DP130227 TIANprep Yeast Plasmid Kit Kit Contents Storage (Spin Column) Cat.no. DP112 Contents
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationEZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK
EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications
More informationPlasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only
Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple
More informationUpdated August well High-multiplexing Tagmentation and Amplification Robyn Tanny August Company Kit Catalog Number.
96-well High-multiplexing Tagmentation and Amplification Robyn Tanny August 2015 This protocol uses the following purchased reagents: Company Kit Catalog Number Illumina Nextera DNA Sample Preparation
More informationApplication Protocol: Isolation of Genomic DNA from fresh and fixed rare cells
REPRODUCTION AND USE This document is protected by copyright and it cannot be used or shared without permission from Vortex Biosciences, Inc. Such permission is given on condition that Vortex Biosciences
More informationMag-Bind Ultra-Pure Plasmid DNA 96 Kit. M x 96 preps M x 96 preps
M1258-00 1 x 96 preps M1258-01 4 x 96 preps December 2015 Table of Contents Introduction...2 Kit Contents/Storage and Stability...3 Preparing Reagents...4 Plasmid Protocol with Lysate Clearance via Centrifugation...5
More informationPCR Detection of Genetically Modified (GM) Foods Protocol
PCR Detection of Genetically Modified (GM) Foods Protocol Purpose Isolate DNA from corn-based food so that the Polymerase Chain Reaction can be used to determine whether the selected foods have been genetically
More informationPresto Soil DNA Extraction Kit
Instruction Manual Ver. 02.23.17 For Research Use Only Presto Soil DNA Extraction Kit Advantages SLD004 (4 Preparation Sample Kit) SLD050 (50 Preparation Kit) SLD100 (100 Preparation Kit) Sample: 250-500
More informationAuPreP Plasmid Midi Kit Cat. #: PMD12-143LT (25 preps/kit) PMD12-145LT (50 preps/kit)
AuPreP Plasmid Midi Kit Cat. #: PMD12-143LT (25 preps/kit) PMD12-145LT (50 preps/kit) AuPreP Plasmid Midi Kit is designed for rapid isolation of plasmid DNA of superior quality from an average of 25-100
More informationHELINI White spot Syndrome virus [WSSV] Real-time PCR Kit
HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,
More informationFast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using a spin-column.
INSTRUCTION MANUAL ZymoPURE Plasmid Miniprep Kit Catalog Nos. D4209, D4210, D4211 & D4212 (Patent Pending) Highlights Fast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using
More informationPlasmid Maxiprep Plus Purification Kit
Plasmid Maxiprep Plus Purification Kit Cat. # : DP01MX-P10/ DP01MX-P20 Size : 10/20 Reactions Store at RT For research use only 1 Description: The Plasmid Maxiprep Plus Purification Kit provides simple,
More informationHetero-Stagger PCR Cloning Kit
Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer
More informationBio-Rad Laboratories, Inc Alfred Nobel Dr. Hercules, CA USA (510) Rev C
Bio-Rad Laboratories, Inc. 2000 Alfred Nobel Dr. Hercules, CA 94547 USA (510) 741-1000 1-800-424-6723 4110111 Rev C Aurum Plasmid Mini Kit Instruction Manual For technical service, call your local Bio-Rad
More informationPlasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions
Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions Maxim Biotech, Inc. 780 Dubuque Avenue, So. San Francisco, CA 94080, U.S.A. Tel: (800) 989-6296
More informationMolecular Methods in Microbial Ecology
Molecular Methods in Microbial Ecology Kristin Gribble 508-289-7194 kgribble@mbl.edu Lillie 305 Tuesday 10/23/18 Introduction, Extraction of DNA from Winogradsky columns Run DNA products on gel Thursday
More informationPlasmid Maxiprep Plus Purification Kit. Cat. # : DP01MX-P10/ DP01MX-P20 Size : 10/20 Reactions Store at RT For research use only
Plasmid Maxiprep Plus Purification Kit Cat. # : DP01MX-P10/ DP01MX-P20 Size : 10/20 Reactions Store at RT For research use only 1 Description: The Plasmid Maxiprep Plus Purification Kit provides simple,
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationCLONING INVERTED REPEATS IN HIGH THROUGHPUT
CLONING INVERTED REPEATS IN HIGH THROUGHPUT This protocol is calculated for cloning one 96 well plate 1. design primers: as standard we include a EcoRI restriction site on the 5 primer and XbaI on the
More informationGenome Reagent Kits v2 Quick Reference Cards
Chromium Genome Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Genome Library Kit & Gel Bead Kit v2, 16 rxns PN-120258 Chromium Genome Chip Kit v2, 48 rxns PN-120257 Chromium i7 Multiplex
More informationEndoFree Maxi Plasmid Kit
EndoFree Maxi Plasmid Kit For purification of ultrapure plasmid DNA with high yields www.tiangen.com/en DP121221 EndoFree Maxi Plasmid Kit Kit Contents Storage (Spin Column) Cat.no. DP117 Contents RNase
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More informationIon AmpliSeq Library Kit 2.0
QUICK REFERENCE Ion AmpliSeq Library Kit 2.0 DNA Library Preparation with 1- or 2-Pool Panels Using qpcr Quantification Catalog Numbers 4475345, 4480441, 4480442, 4479790, A31133, A31136, A29751 Pub. No.
More informationSite-directed mutagenesis of proteins
IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction
More informationpgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions
pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases Cat. # : GVT202 Size : 20 Reactions Store at -20 For research use only 1 pgm-t Cloning Kit Cat. No.: GVT202 Kit Contents
More informationProtocol for amplification of measles sequencing window (N-450)
Annex 7.1 Protocol for amplification of measles sequencing window (N-450) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to develop their own
More informationEZ-10 SPIN COLUMN HANDBOOK
EZ-0 SPIN COLUMN HANDBOOK EZ-0 Spin Column Plasmid DNA Mini Kit EZ-0 Spin Column PCR Products Purification Kit EZ-0 Spin Column DNA Gel Extraction Kit Version 20.0 Rev 3/23/205 ISO900 Certified 20 Konrad
More informationminipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk!
minipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk! An E. coli outbreak affects astronaut food aboard the International Space Station. DNA samples from two food racks are analyzed to determine
More informationAurum Plasmid Mini Kit. Instruction Manual. Bio-Rad Laboratories, Inc Alfred Nobel Dr. Hercules, CA USA (510)
Bio-Rad Laboratories, Inc. 2000 Alfred Nobel Dr. Hercules, CA 94547 USA (510) 741-1000 1-800-424-6723 Aurum Plasmid Mini Kit Instruction Manual For technical service, call your local Bio-Rad office, or
More informationFavorPrep Blood / Cultrued Cell Total RNA Purification Mini Kit. User Manual
TM FavorPrep Blood / Cultrued Cell Total RNA Purification Mini Kit User Manual Cat. No.: FABRK 001 (50 Preps) FABRK 001-1 (100 Preps) FABRK 001-2 (300 Preps) For Research Use Only v.1101 Introduction FavorPrep
More informationSoil DNA Extraction Kit
Instruction Manual Ver. 09.23.16 For Research Use Only Soil DNA Extraction Kit Advantages IB47800 (4 Preparation Sample Kit) IB47801 (50 Preparation Kit) IB47802 (100 Preparation Kit) Sample: 250-500 mg
More informationPowerSoil DNA Isolation Kit
PowerSoil DNA Isolation Kit Catalog No. Quantity 12888-50 50 Preps 12888-100 100 Preps Instruction Manual Introduction The PowerSoil DNA Isolation Kit* is comprised of a novel and proprietary method for
More informationIntroduction. Kit components. 50 Preps GF-PC-050. Product Catalog No. 200 Preps GF-PC Preps GF-PC Preps SAMPLE
Introduction The GF-1 PCR Clean Up Kit is a system designed for rapid clean up of DNA bands ranging from 100bp to 20kb. The GF-1 PCR Clean Up Kit contains special buffers to provide the correct salt concentration
More informationPlasmid Midiprep Purification Kit
Plasmid Midiprep Purification Kit Cat. # : DP01MD/ DP01MD-100 Size : 20/100 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Purification Kit provides simple rapid protocol
More informationHELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)
HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems
More informationBiol/Chem 475 Spring 2007
Biol/Chem 475 Spring 2007 Goal of lab: For most of the quarter, we will be exploring a gene family that was first discovered in fruitlfies and then found to be present in humans and worms and fish and
More informationFosmidMAX DNA Purification Kit
Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationAlkaline Lysis Large Scale Plasmid Preparation
Alkaline Lysis Large Scale Plasmid Preparation 1. Set up 10 ml overnight culture. 2. Add overnight to 500 mls of sterile LB with appropriate selective agent (e.g amp, tet...) 3. Incubate at 37 C with shaking
More informationProductInformation. Genomic DNA Isolation Kit. Product No. GDI-3 Technical Bulletin No. MB-275 May 2000 TECHNICAL BULLETIN
Genomic DNA Isolation Kit Product No. GDI-3 Technical Bulletin No. MB-275 May 2000 TECHNICAL BULLETIN ProductInformation Product Description Sigma s Genomic DNA Isolation Kit isolates genomic DNA from
More informationRayBio Genomic DNA Magnetic Beads Kit
RayBio Genomic DNA Magnetic Beads Kit Catalog #: 801-112 User Manual Last revised January 4 th, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100
More informationFragment Library Preparation
Fragment Library Preparation 5500 Series SOLiD Systems QUICK REFERENCE Note: For safety and biohazard guidelines, refer to the Safety section in the Fragment Library Preparation: 5500 Series SOLiD Systems
More informationRNA Extraction Protocol CELLINK GelMA
1 00600500469.GOT Date: 11-Dec-2018 Author: PG, Version: 1 RNA Extraction Protocol CELLINK GelMA This is a suggested procedure, please adjust according to your experimental needs. Protocol aim The aim
More informationLow cost and non-toxic genomic DNA extraction for use in molecular marker studies.
Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and
More informationUltraClean Midi Plasmid Prep Kit
UltraClean Midi Plasmid Prep Kit Catalog No. Quantity 12700-20 20 Preps Instruction Manual Please recycle Version: 05232014 1 Table of Contents Introduction... 3 Protocol Overview... 3 Flow Chart... 4
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationpgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20
pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl
More informationPresto Stool DNA Extraction Kit
Instruction Manual Ver. 10.21.17 For Research Use Only Presto Stool DNA Extraction Kit Advantages STLD004 (4 Preparation Sample Kit) STLD050 (50 Preparation Kit) STLD100 (100 Preparation Kit) Sample: 180-200
More informationVDL100.2 CLONING TRANSGENE INTO padenox
1. Purpose 1.1. The purpose of this protocol is to transfer a transgene from the pshuttlex plasmid to padenox. 1.2. The starting material is 10 μg plasmid DNA. 1.3. This procedure is routinely performed
More informationGRS Genomic DNA Kit BroadRange - #GK
revised: 18 05 2012 printed: 21 05 2012 GRS Genomic DNA Kit BroadRange - #GK06.0100 (FOR RESEARCH ONLY) Sample : up to 200µl of whole blood (fresh or frozen), up to 25 mg of tissue, up to 25mg of paraffinembedded
More informationMD60002 MD MD62002
MagSi-DNA saliva Art.No. MD60002 MD61002 - MD62002 Product Manual Version 1.0 22/01/2015 Table of Contents 1. General Information...3 1.1 Intended Use...3 1.2 Kit specifications...3 1.3 Basic principle...3
More informationGel/PCR Extraction Kit
Gel/PCR Extraction Kit Item No: EX-GP200 (200rxns) Content Content Binding Buffer BD Wash Buffer PE Elution Buffer (10 mm Tris-HCl, ph 8.5) Spin Columns EX-GP200 80 ml 20 mlx3 10 ml 200 each Description
More informationThe fastest, easiest, most reliable method for purification of up to 1.2 mg of ultra-pure endotoxin-free plasmid DNA.
INSTRUCTION MANUAL ZymoPURE - Express Plasmid Midiprep Kit Catalog No. D4213 (Patent Pending) Highlights Innovative ZymoPURE - Express pellet-free procedure bypasses the standard cell-pelleting and resuspension
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More informationMarathon TM cdna Amplification Kit Protocol-at-a-Glance
(PT1115-2) Marathon cdna amplification is a fairly complex, multiday procedure. Please read the User Manual before using this abbreviated protocol, and refer to it often for interpretation of results during
More informationEXPERIMENT 8 CLONING THE PROMOTER REGION OF THE GENE OF INTEREST (GENE TWO)
EXPERIMENT 8 CLONING THE PROMOTER REGION OF THE GENE OF INTEREST (GENE TWO) Purposes: 1. (Long term) To determine the activity of the promoter of the gene of interest at the cellular and tissue levels
More informationBRCA MAQ USER GUIDE Version 1.0
BRCA MAQ USER GUIDE Version 1.0 For Copy Number Analysis Assays IFU604 v170797 www.multiplicom.com 2012 Multiplicom NV, all rights reserved Table of Contents Introduction to Multiplex Amplicon Quantification...2
More informationUltraClean 6 Minute Mini Plasmid Prep Kit
UltraClean 6 Minute Mini Plasmid Prep Kit Catalog No. Quantity 12300-50 50 Preps 12300-100 100 Preps 12300-250 250 Preps Instruction Manual Introduction Use the UltraClean 6 Minute Mini Plasmid Prep Kit
More informationThermo Scientific GeneJET Plant Genomic DNA Purification Mini Kit #K0791, #K0792
PRODUCT INFORMATION Thermo Scientific GeneJET Plant Genomic DNA Purification Mini Kit #K0791, #K0792 Pub. No. MAN0016131 Rev. Date 12 October 2016 (Rev. A.00) Read Storage information (p. 2) before first
More informationPresto 96 Well gdna Bacteria Kit
Presto 96 Well gdna Bacteria Kit 96GBB02 (2 x 96 well plates/kit) 96GBB04 (4 x 96 well plates/kit) 96GBB10 (10 x 96 well plates/kit) Instruction Manual Ver. 05.04.17 For Research Use Only Advantages Sample:
More informationBACMAX DNA Purification Kit
Cat. No. BMAX044 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 212 10/2012 1 EPILIT212 Rev. A
More informationLarge DNA Fragments Extraction Kit
Instruction Manual Ver. 04.25.17 For Research Use Only Large DNA Fragments Extraction Kit DFL004 (4 Preparation Sample Kit) DFL100 (100 Preparation Kit) DFL300 (300 Preparation Kit) Advantages Efficient:
More informationEXPERIMENT 4 CLONING THE UPSTREAM REGION OF THE GENE OF INTEREST
EXPERIMENT 4 CLONING THE UPSTREAM REGION OF THE GENE OF INTEREST Purpose: To determine the activity of the promoter of the gene of interest at the cellular and tissue levels in Arabidopsis plants via the
More informationUltraClean Endotoxin-Free Mini Plasmid Prep Kit
UltraClean Endotoxin-Free Mini Plasmid Prep Kit Catalog No. Quantity 12311-100 100 Preps Instruction Manual Please recycle Version: 11172015 1 Table of Contents Introduction... 3 Protocol Overview... 3
More informationAccurately and reproducibly quantify as little as 20 fg of bacterial DNA using real-time PCR.
INSTRUCTION MANUAL Femto Bacterial DNA Quantification Kit Catalog No. E2006 Highlights Accurately and reproducibly quantify as little as 20 fg of bacterial DNA using real-time PCR. High specificity and
More informationRNAprep pure Kit (For Cell/Bacteria)
RNAprep pure Kit (For Cell/Bacteria) For purification of total RNA from cultured animal cells and bacteria www.tiangen.com RP090326 RNAprep pure Kit (For Cell/Bacteria) Kit Contents (Spin Column) Cat.
More informationNote: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology
Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content
More informationPCR Cloning Protocol
Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning This experiment was designed by Dylan Dodd, based on research completed in Dr. Isaac Cann s lab*, with modifications and editing of content
More informationProtocol for DNA extraction from FFPE Samples
25, ave Georges Lemaître - B-6041 Gosselies (Belgique) Tel : +32 (0)71 37 85 27 - Fax : +32 (0)71 34 78 79 Protocol for DNA extraction from FFPE Samples Step 1. Paraffin Removal 1 Equilibrate a heat block
More informationEZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK
EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 5.0 Rev 03/25/205 Table of Contents Introduction 2 Limitations of Use 2 Features 2 Applications 2 Storage 2
More informationBlood DNA Extraction Kit
H A N D B O O K Blood DNA Extraction Kit NP-BD-050 050 Preps www.genetixbiotech.com Contents Page No COMPONENTS Kit Contents Reagents, Consumables and Equipment not provided with the kit SAFETY INSTRUCTIONS
More informationApplication of Molecular Biology tools for cloning of a foreign gene
IFM/Kemi Linköpings Universitet September 2013/LGM Labmanual Project course Application of Molecular Biology tools for cloning of a foreign gene Table of contents Introduction... 3 Amplification of a gene
More informationULTRAPrep PLASMID DNA KIT
ULTRAPrep RNA Tissue Total RNA isolation from cultured human and animal cells ULTRAPrep RNA Cell Culture Total RNA isolation from cultured human and animal cells 2 2 6-024-01-0 6-024-02-0 6-021-01-0 6-021-02-0
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationProtocol: Isolation of genomic DNA with NucleoSpin Blood XL Maxi kit
Last modified: November 2018; minor formatting Last reviewed: November 2018 Protocol: Isolation of genomic DNA with NucleoSpin Blood XL Maxi kit Purpose: this protocol is used to isolate gdna from frozen
More information(Spin Column) For purification of DNA and RNA from formalin-fixed, paraffin-embedded. tissue sections. Instruction for Use. For Research Use Only
AmoyDx FFPE DNA/RNA Kit (Spin Column) For purification of DNA and RNA from formalin-fixed, paraffin-embedded tissue sections Instruction for Use For Research Use Only Instruction Version: B1.0 Revision
More informationmdi Stool Genomic DNA Miniprep Kit User Guide ADVANCED MICRODEVICES PVT. LTD. Membrane Technologies 21, Industrial Area, Ambala Cantt (INDIA)
Stool Genomic DNA Miniprep Kit User Guide ADVANCED MICRODEVICES PVT. LTD. 21, Industrial Area, Ambala Cantt - 133001 (INDIA) ADVANCED Tel: 0171-2699290, MICRODEVICES 2699471, 2699274 PVT. LTD. 21, Fax:
More informationSuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit
SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets
More informationRibonucleic acid (RNA)
Ribonucleic acid (RNA) Ribonucleic acid (RNA) is more often found in nature as a singlestrand folded onto itself. Cellular organisms use messenger RNA (mrna) to convey genetic information (using the nitrogenous
More informationTissue Acetyl-Histone H4 ChIP Kit
Tissue Acetyl-Histone H4 ChIP Kit Catalog Number KA0672 48 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More information