Gene Expression Technology
|
|
- Lynne Wheeler
- 6 years ago
- Views:
Transcription
1 Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University
2 Gene expression Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. For a specific cell at a specific time, only a subset of the genes coded in the genome are expressed. 2
3 Gene expression regulation Gene expression is highly regulated In mutant cells vs wild-type cells In response to various stimuli (e.g. drug, light, sleep etc) At different developmental stages In different cell types (e.g. muscle cells, fibroblasts) In disease states vs healthy Gene expression is primarily regulated at the transcriptional level The number of mrna copies in a cell for a particular gene is a good indicator of corresponding protein expression level 3
4 Expression of a typical eukaryotic protein-coding gene mrna is the subject of measurement in the technologies that will be introduced today graph courtesy of Wikipedia 4
5 Candidate gene approaches Northern Blot RNA is isolated, electrophoresed on an agarose gel, transferred to a nylon membrane through a capillary or vacuum blotting system, and probed with a radioactive cdna derived from an individual gene. Radioactive signal is measured. RNase protection Extracted RNA is first mixed with radioactive cdna probes from a gene of interest to form DNA-RNA hybrid. The mixture is then exposed to RNase that specifically cleaves single-stranded RNA. Radioactive signal is measured. Real-Time PCR RNA is reverse transcribed to cdna and then quantified by real-time PCR using a fluorescent probe specific to a gene of interest. Fluorescent signal is measured. 5
6 High-throughput transcriptome profiling Transcriptome: the set of all messenger RNA (mrna) molecules, or "transcripts, produced in one or a population of cells. Hybridization based approaches: incubating fluorescently labeled cdna with microarrays. Hybridization signal is measured. cdna microarray High density olio arrays Sequencing based approaches: directly determine the cdna sequence. Count is measured. Sanger sequencing of cdna or EST libraries Serial Analysis of Gene Expression (SAGE) Massively Parallel Signature Sequencing (MPSS) RNA-Seq 6
7 Low-throughput vs High-throughput Chalcone synthase Protein kinase Actin Northern 0 10m 30m 1h 3h 6h 24h Microarray 10m 30m 1h 3h 6h 24h Advantages of high-throughput technologies High-throughput Exploratory analysis Relationship between genes Challenges in high-throughput technologies Cost Data analysis 7
8 A simplified protocol for DNA microarray experiment Prepare or purchase DNA microarray Isolate mrna from cell cultures or tissue samples Reverse transcribe mrna into cdna Label cdna or crna by incorporating fluorescently-labeled nucleotides Hybridize labeled cdna or crna to DNA microarray Wash and scan microarray in scanner Analyze data 8
9 DNA microarrays DNA microarray: a solid support (glass slide, silicon chip, etc) on which DNA of known sequence is deposited in a regular grid-like array. Spotted or printed arrays: DNA feature physically transferred from a plate or reservoir and transferred to a solid support, typically a chemically modified glass microscope slide. (Agilent, GE, ABI) Synthesized arrays: DNA features chemically synthesized in-situ on the substrate. (Affymetrix, NimbleGen, Combimatrix) 9
10 Array preparation: cdna spotted array Inserts from cdna collections or libraries are amplified using either vector-specific or gene-specific primers. PCR products are printed at specified sites on glass slides using high-precision arraying robots. Through the use of chemical linkers, selective covalent attachment of the DNA strand to the glass surface can be achieved. A movie: Schulze and Downward, Nature Cell Biol, 3:E190,
11 Array preparation: high-density oligo arrays Based on the concept of photolithography A chip with initial starting strands where the DNA will be built from Shine light through a mask to deprotect specific strands Add free nucleotides Repeat until desired length, e.g. 25 base graph courtesy of Affymetrix 11
12 Affymetrix oligonucleotide microarrays Probes are complementary to exon sequences located near the 3 end of the gene Each probe is usually 25-base long Typically pairs of oligonucleotide probes per probe set Each pair of oligonucleotides contains a perfect match oligonucleotide and a mismatch oligonucleotide (single base-pair mismatch) Mismatch probes are used as controls for nonspecific hybridization One gene is represented by one to a few probe sets HG-U133 Plus 2.0 Array comprises more than 54,000 probe sets 12
13 Affymetrix GeneChip expression array design A movie on GeneChip array preparation graph courtesy of Affymetrix 13
14 Microarray experiment: two-color arrays RNA from two different tissues or cell populations is used to synthesize singlestranded cdna in the presence of nucleotides labelled with two different fluorescent dyes (for example, Cy3 and Cy5). Both samples are mixed in a small volume of hybridization buffer and hybridized to the array surface, usually by stationary hybridization under a coverslip, resulting in competitive binding of differentially labelled cdnas to the corresponding array elements. High-resolution confocal fluorescence scanning of the array with two different wavelengths corresponding to the dyes used provides relative signal intensities and ratios of mrna abundance for the genes represented on the array. Schulze and Downward, Nature Cell Biol, 3:E190,
15 Microarray experiment: single-color arrays polya+ RNA from different tissues or cell populations is used to generate doublestranded cdna carrying a transcriptional start site for T7 DNA polymerase. During in vitro transcription, biotin-labelled nucleotides are incorporated into the synthesized crna molecules. Each target sample is hybridized to a separate probe array and target binding is detected by staining with a fluorescent dye coupled to streptavidin. Signal intensities of probe array element sets on different arrays are used to calculate relative mrna abundance for the genes represented on the array. Schulze and Downward, Nature Cell Biol, 3:E190,
16 Exon arrays Classic Affymetrix arrays keep the probes on the 3 end Affymetrix Gene 1.0 ST arrays spread the probes across all known and predicted exons in order to generate a more accurate transcript-level signal graph courtesy of Affymetrix 16
17 Tiling arrays Classic arrays use a few probes for each known or predicted gene. Tiling arrays design probes to cover the entire genome or selected genomic regions in order to produce an unbiased look at gene expression. GeneChip Human Tiling 1.0R Array Set 14-array set 25-mers oligos 35-base pair resolution over 6.5 million probes per array graph courtesy of Affymetrix 17
18 Large-scale transcriptional activity in chr. 21 and 22 Kampa et al. Genome Res, 14:331,
19 Novel RNAs identified from tiling array analysis Kampa et al. Genome Res, 14:331,
20 SAGE: overview Serial analysis of gene expression (SAGE) is a method for rapid and comprehensive analysis of gene expression. A short sequence tag (10-14bp) contains sufficient information to uniquely identify a transcript provided that that the tag is obtained from a unique position within each transcript. Sequence tags can be linked together to from long serial molecules that can be cloned and sequenced. Quantitation of the number of times a particular tag is observed provides the expression level of the corresponding transcript. graph courtesy of SAGEnet 20
21 SAGE: tagging cdna synthesized on oligo(dt) beads Digested with an anchoring enzyme that recognizes and cuts specific 4-bp DNA sequences to reveal the 3'-most restriction site Ligated to two different linkers containing the recognition site for an tagging enzyme that cuts 10-bp 3' from the anchoring enzyme recognition site to generate a SAGE tag. SAGE tags released from the oligo(dt) beads are then blunted and ligated to each other to give rise to ditags. The ditags are PCR amplified, released from the linkers by the anchoring enzyme, gel purified, serially ligated, cloned, and sequenced using an automated sequencer. Patino et al. Circulation Res, 91:565,
22 Technology comparison Hybridization based method x x x x Relatively inexpensive Customizable (for genes of interest) Analog signal Rely on existing knowledge about gene annotation or genome sequence Cross-hybridization Limited dynamic range of detection owing to both background and saturation of signals Sequencing based method x x x Digital gene expression level Doesn t rely on existing knowledge Based on expensive Sanger sequencing technology A significant portion of the short tags cannot be mapped to the genome Transcript isoforms are generally indistinguishable 22
23 RNA-Seq: new kid on the block 23 RNA-Seq: direct ultra-high-throughput sequencing of cdna.
24 RNA-Seq: overview RNAs are fragmented and converted into cdna by random priming Sequencing adaptors are added to each cdna fragment and a short sequence is obtained from each cdna using high-throughput sequencing technology. Resulting sequence reads are aligned with the reference genome or transcriptome, and classified as three types: exonic reads, junction reads and poly(a) end-reads. Alignments are used to generate a single-base resolution expression profile for each gene. Wang et al. Nature Rev Genet, 10:57,
25 RNA-Seq: technology comparison Wang et al. Nature Rev Genet, 10:57,
26 RNA-Seq: challenges Library construction Mapping the short reads from RNA-Seq to the reference genome Appropriate assignment of multi-mapping reads Identification of new alternative splice junctions Classification of reads mapping outside annotated boundaries Comparison of samples to identify differentially expressed genes 26
27 Key references Schulze and Downward. Navigating gene expression using microarrays a technology review. Nature Cell Biol, 3:E190, 2001 Wang et al. RNA-Seq: a revolutionary tool for transcriptomics. Nature Rev Genet, 10:57,
DNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationThen, we went on to discuss genome expression and described: Microarrays
In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationDifferential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes
Differential gene expression General Introduction Overview (1) Reminder of biology Major steps in microarray analysis Microarray preparation design, clone/probe selection RNA extraction, hybridization
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationIntroduction to DNA microarrays. DTU - January Hanne Jarmer
Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go Microarrays - The Concept Measure
More informationDNA Microarrays and Clustering of Gene Expression Data
DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);
More informationIntroduction to biology and measurement of gene expression
Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationComputing with large data sets
Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationSTANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host).
STANDARD CLONING PROCEDURES Shotgun cloning (using a plasmid vector and E coli as a host). 1) Digest donor DNA and plasmid DNA with the same restriction endonuclease 2) Mix the fragments together and treat
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationINTRODUCTION. The Technology of Microarrays January Hanne Jarmer
INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationMethods for Working with DNA and RNA
Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are
More informationBackground Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationGene expression. What is gene expression?
Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationGene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome
Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationBiology 644: Bioinformatics
Measure of the linear correlation (dependence) between two variables X and Y Takes a value between +1 and 1 inclusive 1 = total positive correlation 0 = no correlation 1 = total negative correlation. When
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationSingle-Cell Whole Transcriptome Profiling With the SOLiD. System
APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationMicroarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation
Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationmeasuring gene expression December 11, 2018
measuring gene expression December 11, 2018 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationFunctional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing
Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationMoc/Bio and Nano/Micro Lee and Stowell
Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationSpotted DNA Array Design. Todd Lowe BME/Bio 210 Sept 30, 2008
Spotted DNA Array Design Todd Lowe BME/Bio 210 Sept 30, 2008 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations For
More informationBasic lab techniques
Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationMolecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More information7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes
Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationNext generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento
Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information
More informationChapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining
More informationBENG 183 Trey Ideker The next generation
BENG 183 Trey Ideker The next generation Sequencing topics to be covered in today s lecture (1) Devils in the details: DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE
More informationFinding Genes with Genomics Technologies
PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationGene Expression Data Analysis
Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationIntegrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationAnalysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis
More informationCombining Techniques to Answer Molecular Questions
Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is
More informationClones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.
Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used
More information1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
More information