XactEdit Cas9 Nuclease with NLS User Manual
|
|
- Augusta Shaw
- 6 years ago
- Views:
Transcription
1 XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE K, CE , CE , CE , CE Table of Contents Product Information and Storage Conditions 1 Overview 2 Product Description 2 Product Specifications 2 Additional Required Materials 3 Protocols 4 Using XactEdit Cas9 Nuclease with NLS for In Vitro DNA digestion 4 Using XactEdit Cas9 Nuclease with NLS for In Vivo DNA digestion 6 Appendix A: Representative Data 7 XactEdit Cas9 Nuclease In Vitro Activity Assay 7 XactEdit Cas9 Nuclease In Vivo Activity Assay 7 Appendix B: Negative Control guide RNA Template 8 Product Information and Storage Conditions XactEdit Cas9 Nuclease with NLS Kit Catalog Number CE K Quantity Component Amount Concentration Storage 1 vial XactEdit Cas9 Nuclease with NLS* 50 µg 1 mg/ml Negative Control grna Template 10 µl** 25 µm 10X XactEdit Digestion Buffer 0.5 ml Nuclease-free water 0.5 ml *Avoid repeated freeze/thaw cycles. Aliquot if necessary. See Appendix B: Negative Control guide RNA Template on page 8 for sequence information. ** Shipped lyophilized. See Prepare In Vitro Transcription Template on page 4 for resuspension instructions. XactEdit Cas9 Nuclease with NLS Recombinant Protein 20 C Catalog Number Quantity Component Amount Concentration Storage CE CE vial 5 vials (50 µg each) XactEdit Cas9 Nuclease with NLS 50 µg 250 µg CE vial 250 µg CE vial 1000 µg 1 mg/ml 20 C 10 mg/ml Avoid repeated freeze/thaw cycles. Aliquot if necessary. Synthetic Genomics, Inc. syntheticgenomics.com REV PN CE1000-M
2 Overview Product Description Product Specifications XactEdit Cas9 Nuclease with NLS is a purified recombinant Streptococcus pyogenes Cas9 protein containing a nuclear localization signal (NLS) for targeting into the nucleus. XactEdit Cas9 Nuclease with NLS has been formulated to perform highly efficient RNA-guided DNA digestion in vitro. This recombinant Cas9 protein complexes with guide RNA to form an RNA-protein complex (RNP). Introducing RNPs into cells creates double-stranded DNA breaks (DSBs) which have been used for a variety of precise genome-editing studies, such as homologous knock-in and gene knock-out. RNP delivery is non-replicative in the cell and therefore has minimal off-target effects, an advantage over other delivery methods. XactEdit Cas9 Nuclease with NLS is suitable for use with immortalized cell lines and primary cells. XactEdit Cas9 Nuclease with NLS Presentation Concentration Purity Endotoxin level RNase activity DNase activity In vitro activity Recombinant Streptococcus pyogenes Cas9 nuclease with N terminal modification of 8X His tag and SV40 NLS 25 mm Tris-HCl, ph 7.4, 300 mm NaCl, 0.1 mm EDTA, 1 mm DTT, 50% glycerol 1 mg/ml for Catalog Number series CE mg/ml for Catalog Number series CE1001 Values based on absorbance at 280 nm with extinction coefficient at 0.76 (mg/ml) -1 cm -1 > 90%, RP-HPLC > 90%, SDS-PAGE < 10 EU/mg, by LAL assay < LOD by fluorescence-based RNase assay (detection limit < U of RNase) < 0.01 unit DNase I per 100 µg of Cas9, by fluorescence-based DNase Assay > 80% of target DNA at 5.4 nm is digested with 50 µg of Cas9 with equal molar ratio of guide RNA at 37 C for 1 hour. 2
3 Additional Required Materials For In Vitro DNA Digestion The following materials are not included with the XactEdit Cas9 Nuclease with NLS Kit, but are required for in vitro DNA digestion. User Supplied Materials Item Linearized DNA template containing T7 promoter and target grna coding sequence grna synthesis kit RNA clean-up kit Materials for RNA quantitation Recommended Kit and Supplier User defined MEGAScript T7 Transcription Kit (Thermo Fisher Cat No. AM1334) or equivalent kit or components RNA Clean & Concentrator -25 (Zymo Cat No. R1017) or equivalent Qubit RNA BR Assay Kit (Thermo Fisher Cat. No. Q10210) or equivalent 2% agarose or 10% TBE-urea gels Any reliable supplier of high-quality RNAse-free pipet tips materials for molecular biology applications High-fidelity DNA polymerase Phusion polymerase (Thermo Fisher Cat No. F530) or equivalent For In Vivo DNA Targeting and Cleavage The following materials are not included with the XactEdit Cas9 Nuclease with NLS Kit, but are required for in vivo DNA targeting and cleavage. User Supplied Materials Item Cell type of interest Electroporation apparatus Recommended Item User defined Neon Transfection System or equivalent Transfection reagent Neon Transfection Kit, 10 µl or 100 µl grna Custom designed to target DNA sequence-of-interest 3
4 Protocols Using XactEdit Cas9 Nuclease with NLS for In Vitro DNA digestion Materials DNA template ( ng) XactEdit Cas9 Nuclease with NLS Target-specific guide RNA 10X XactEdit Digestion Buffer Nuclease-free water (Optional) Negative Control grna template Design and Generate a Template for grna Production 1. Define a target site by screening your targeted DNA for an nt protospacer sequence followed by a protospacer adjacent motif (PAM), 5 -NGG-3. The intended cleavage site will be 3 4 nucleotides upstream of NGG. Note: The nt target protospacer sequence in the genomic DNA must be followed by a PAM sequence of NGG. This motif is essential for DNA cleavage, but is not included in the grna sequence. The immediate 12 nt located 5 of the PAM is the seed sequence and is necessary for efficient cleavage. A perfect match between your seed sequence and non-target loci should be avoided when designing grnas as mismatches close to the PAM site tend to abolish DNA cleavage. 2. Synthesize complementary oligonucleotides that contain a T7 promoter sequence, the targetspecific spacer sequence, and a guide RNA scaffold. These oligonucleotides will be annealed (see the protocol in the following section) to form a double-stranded oligonucleotide that will serve as a template for in vitro transcription for generating your grna. A double-stranded template example is shown below: T7 Promoter Spacer Sequence Scaffold 5 -TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3 3 -ATTATGCTGAGTGATATCCNNNNNNNNNNNNNNNNNNCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAAAAA-5 NN = Potential Cleavage Site Prepare In Vitro Transcription Template The ds oligonucleotide described above will be the template for grna production with in vitro transcription. Use the following procedure to denature and anneal your complementary oligonucleotides. 1. Bring each oligonucleotide to a concentration of 50 µm using 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl. 2. Combine the oligonucleotides in a 1:1 molar ratio. 3. For the Negative Control grna Template (provided with XactEdit Cas9 Nuclease Kit only), resuspend the contents of the tube with 10 µl of 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl. (Using a negative control is optional but highly recommended.) 4. Transfer 10 ul of the combined oligonucleotides to a PCR tube. 5. Denature oligonucleotides (including Negative Control grna Template, if applicable) at 95 C for 5 minutes. Slowly cool ( 0.1 C /second) to 25 C. 6. Add 240 µl nuclease-free water to the annealed oligonucleotides create a 2 μm stock grna template. The annealed ds oligonucleotide template is now ready for in vitro transcription. We recommend storing aliquots of the ds oligonucleotide template at 20 C for 6 months. 4
5 In Vitro Transcription to produce grna Although individual components may be used for in vitro transcription, we recommend using an in vitro transcription kit (e.g. MEGAScript T7 Transcription Kit, Thermo Fisher Cat No. AM1334) to simplify the reaction and reduce the potential for RNase contamination. 1. Combine the following components on ice: Component Volume 10X T7 Reaction Buffer 1 µl NTP Mixture (75 mm each) (1 µl ATP, 1 µl CTP, 1 µl GTP, 1 µl UTP) 4 µl 2 µm grna template from Prepare In Vitro Transcription Template 4 µl T7 RNA Polymerase 1 µl Total* 10 µl *The total reaction volume may be scaled up to 20 µl for increased yield. 2. Gently mix and incubate the reaction at 37 C for 2 hours. 3. Recover the grna using a silica spin column procedure (e.g. the RNA Clean & Concentrator, Zymo Cat. No. R1017). 4. Quantify grna by absorbance or fluorescent quantification. 5. Aliquot grna and store at 80 C. Note: To prevent RNA damage or the introduction of nuclease to the sample due to handing, avoid multiple freeze/thaw cycles. Prepare an In Vitro Digestion Template In Vitro Digestion Design a template to screen for the specificity and effectiveness of your grna. The template should contain the target site for grna and can be a plasmid, PCR-amplified amplicon, restriction-digest fragment, or synthetic DNA. The template will be used for in vitro digestion followed by agarose gel analysis. This target should be of a sufficient length and have the grna target site in a location that will allow you to easily visualize cleavage of the fragment on an agarose gel. 1. Combine the following components: Component Amount 10X XactEdit Digestion Buffer 3 µl grna, from step 5 of In Vitro Transcription to produce grna XactEdit Cas9 Nuclease with NLS DNA template in TE or PCR buffer, from Prepare an In Vitro Digestion Template ng 2. Bring the total volume of the reaction to 30 µl with nuclease-free water and mix by gently pipetting up and down. 3. Incubate reactions at 37 C for 1 hour. 4. Transfer reactions to 80 C for 2 minutes. 5. Evaluate the digestion by running µl of the reaction on a 2% agarose gel. 500 ng 100 ng 5
6 Using XactEdit Cas9 Nuclease with NLS for In Vivo DNA digestion Deliver Cas9 to cells Electroporation is the most effective means of delivering XactEdit Cas9 Nuclease with NLS to cells. Although lipid-based transfection methods can be used, we highly recommend electroporation for best results. Use the following guidelines as a starting point for optimizing in vivo digestion. For high efficiency delivery, optimize conditions (e.g., voltage and pulse duration) based on your selected cell type and electroporation apparatus. 1. Combine XactEdit Cas9 Nuclease and grna. We recommend using a molar ratio between 1:1 and 1:2 (Cas9:gRNA) as a starting point. Note: You will need to empirically determine the optimal amount of XactEdit Cas9 and grna for a given cell type and your particular experimental design. Beginning optimization with 1 µg of XactEdit Cas9 and 200 ng of grna is a typical starting point. To minimize the total volume delivered, use XactEdit Cas9 Nuclease at a concentration of 10 mg/ml (Catalog Numbers CE and CE ). 2. Mix the RNP complex by gentle pipetting and incubate at room temperature for minutes. Note: The RNP complex is stable at room temperature for up to 2 hours. 3. Mix the RNP complex with your cell suspension of choice. 4. Perform electroporation according to the recommendations and parameters for your cell line and electroporator. 5. Plate cells under appropriate growth conditions and allow hours of recovery. 6. To evaluate off-target activity, use a T7 endonuclease I (T7E1) assay or sequence analysis (optional). 6
7 Appendix A: Representative Data XactEdit Cas9 Nuclease In Vitro Activity Assay MW XactEdit Cas9 / grna bp Emx1 amplicon 487 bp cleaved fragment 283 bp cleaved fragment grna (ng) XactEdit Cas9 (ng) Figure 1. XactEdit Cas9 Nuclease (NLS) In Vitro Activity Assay. The gel image above shows RNA-guided Cas9 endonuclease activity targeting a 770 bp homeobox transcription factor Emx1 amplicon. Specific cleavage by the XactEdit Cas9: grna complex generates two fragments (283 bp and 487 bp). In each lane, 100 ng of Emx1 amplicon was incubated with indicated amount of guide RNA (grna) and XactEdit Cas9 protein. The data indicate that XactEdit Cas9 protein effectively and specifically cleaves the substrate at the target site. The molecular weight (MW) marker shown in lane 1 is 1 kb ladder. XactEdit Cas9 Nuclease In Vivo Activity Assay A B 770 bp Emx1 amplicon 487 bp cleaved fragment 283 bp cleaved fragment MW XactEdit Cas9 Neg Cas9 Supplier Neg MW % Cleavage SGI-DNA Lot 1 SGI-DNA Lot 2 Supplier T Supplier N Figure 2. XactEdit Cas9 Nuclease (NLS) In Vivo Activity Assay. The in vivo nuclease activity of two different lots of XactEdit Cas9 nuclease were compared to that of Cas9 nuclease from supplier T and N. For each assay, Emx1 gene Cas9:gRNA complexes were formed using 1 µg of Cas9 and 200 ng of in vitro transcribed guide RNA. Complexes were introduced into HEK 293T cells by electroporation. Cas9 double strand break (DSB) frequency was examined by a mutation detection assay (A) and MiSeq analysis (B). (A) Mutated sequences created by DSB are shown as cleaved products in agarose gel electrophoresis indicating Cas9 induced DSB sites. Lanes 1 and 8 are molecular weight (MW) marker Quick-Load 2-Log DNA ladder. (B) MiSeq sequencing at the target site provides a quantitative analysis on the percentage of cleavage. Data are presented as the mean with standard deviation of three replicates. 7
8 Appendix B: Negative Control guide RNA Template Sequences Oligonucleotide 1: 5 -TAATACGACTCACTATAGGTAGCGAACGTGTCCGGCGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3 Oligonucleotide 2: 5 -AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACACGCCGGACACGTTCGCTACCTATAGTGAGTCGTATTA-3 Presentation Concentration Lyophilized 25 µm per oligonucleotide upon reconstitution with 10 µl of 10 mm Tris-HCl, 1 mm EDTA and 50 mm NaCl, ph 8. Technical Services Trademark Information Label License Research Use Only Intended Use For technical assistance, please contact technical services at techservices@sgidna.com. XactEdit is a trademark and Synthetic Genomics is a registered trademarks of Synthetic Genomics Inc. MEGAscript, Qubit, and Neon are registered trademarks of Thermo Fisher Scientific. RNA Clean & Concentrator is a trademark of Zymo Research Corporation. Quick-Load is a registered trademark of New England Biolabs, Inc. MiSeq is a trademark of Illumina, Inc. Except as otherwise agreed in writing by our authorized representative, this product is for INTERNAL RESEARCH USE ONLY AND NOT FOR HUMAN, ANIMAL, THERAPEUTIC OR DIAGNOSTIC USE. For additional information about your rights under this research license, please see our website at sgidna.com. Research use only. Not for diagnostic and/or human use. Product information and additional resources are available at sgidna.com 2016 Synthetic Genomics Inc. All rights reserved. Synthetic Genomics, Inc.
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationCRISPR Ribonucleoprotein (RNP) User Manual
CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised
More informationDuraScribe T7 Transcription Kit
DuraScribe T7 Transcription Kit Cat. Nos. DS010910 and DS010925 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA170E DuraScribe T7 Transcription Kit 7/2017 1 1. Introduction The
More informationAmpliScribe T7-Flash Transcription Kit
AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction
More informationGenomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065
INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),
More informationZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067
INSTRUCTION MANUAL ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 Highlights 96-well plate recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage,
More informationDuraScribe T7 Transcription Kit
DuraScribe T7 Transcription Kit 10 Reactions Cat. No. DS010910 25 Reactions Cat. No. DS010925 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationAmpliScribe T7-Flash Biotin-RNA Transcription Kit
AmpliScribe T7-Flash Biotin-RNA Transcription Kit Cat. No. ASB71110 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA276E AmpliScribe T7-Flash Biotin-RNA Transcription Kit 12/2016
More informationTECHNICAL BULLETIN. FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli
FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli Catalog Number FNCAS9PROT Storage Temperature 20 C TECHNICAL BULLETIN Product Description FnCas9 protein is a recombinant
More informationGenomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011
INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),
More informationFor Research Use Only Ver
Page 0 INSTRUCTION MANUAL RNA Clean & Concentrator -5 Catalog Nos. R1013 & R1014 (supplied with DNase I) R1015 & R1016 Highlights Quick, 5 minute recovery of ultra pure RNA ( 17 nt) from enzymatic reactions,
More informationCELLSCRIPT RNA for Translation in Cells
TM RNA for Translation in Cells Cat. No. C-ACM04037 INTRODUCTION The AmpliCap-Max T7 High Yield Message Maker Kit produces capped RNA by in vitro transcription using T7 RNA polymerase and the standard
More informationAmpliScribe T 7 Aminoallyl-RNA Transcription Kit
Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationProtocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7
More informationNextera DNA Sample Prep Kit (Roche FLX-compatible)
Cat. Nos. FL09115, FL091120, and FLBC0950 The is designed to prepare genomic DNA libraries compatible with the Roche 454 Genome Sequencer FLX System, with standard FLX chemistry. Nextera technology* employs
More informationElectroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System)
Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein
More informationDNase I Treatment Kit
DNase I Treatment Kit (version A1) Catalog No. 25502 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263 Fax: 760
More informationAlt-R CRISPR-Cpf1 System:
user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationAlt-R CRISPR-Cas9 system:
Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research
More informationHiScribe. T7 Quick High Yield RNA Synthesis Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2050S 50 reactions Version 2.
RNA ENZYMES & GENE ANALYSIS HiScribe T7 Quick High Yield RNA Synthesis Kit Instruction Manual NEB #E2050S 50 reactions Version 2.1 1/17 NEB #S1560S be INSPIRED drive DISCOVERY stay GENUINE This product
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationNextera DNA Sample Prep Kit
Nextera DNA Sample Prep Kit (Roche FLX-compatible) Cat. Nos. FL09115, FL091120, and FLBC0950 * Covered by patents issued and pending. Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook
More informationNZYGene Synthesis kit
Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm
More informationEnGen sgrna Synthesis Kit, S. pyogenes
RNA ENZYMES & GENE ANALYSIS EnGen sgrna Synthesis Kit, S. pyogenes Instruction Manual NEB #E3322S 20 reactions Version 2.0 7/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research
More informationPreparing Samples for Analysis of Small RNA
Preparing Samples for Analysis of Small RNA Topics 3 Introduction 4 Kit Contents and Equipment Checklist 6 Isolate Small RNA by Denaturing PAGE Gel 9 Ligate 5' RNA Adapters 12 Ligate 3' RNA Adapters 15
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationLigation Independent Cloning (LIC) Procedure
Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationNxGen phi29 DNA Polymerase
NxGen phi29 DNA Polymerase Please read carefully and thoroughly before beginning FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll
More informationNEBNext RNase III RNA Fragmentation Module
SAMPLE PREPARATION NEBNext RNase III RNA Fragmentation Module Instruction Manual NEB #E6146S 100 reactions NEBNext RNase III RNA Fragmentation Module Table of Contents: Description....2 Applications....2
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationUser Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption
User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)
More informationPreparing Samples for Analysis of Small RNA Using the Oligo Only Kit
Preparing Samples for Analysis of Small RNA Using the Oligo Only Kit FOR RESEARCH ONLY Topics 3 Introduction 4 Kit Contents, User-Supplied Consumables, and Equipment Checklist 6 Isolate Small RNA by Denaturing
More informationEfficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
More informationTHE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04
PAGE: 1 of 13 SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04 AUTHOR: Nicholas Marko PRIMARY REVIEWERS: Renee Rubio, Bryan Frank 1. PURPOSE This protocol describes the procedure for amplifying RNA
More informationCat. Nos. NT09115, NT091120, NT , NT , and NTBC0950 DISCONTINUED
Nextera DNA Sample Prep Kit (Roche Titanium-compatible) Cat. Nos. NT09115, NT091120, NT0911-50, NT0911-96, and NTBC0950 DISCONTINUED The Nextera DNA Sample Prep Kit is designed to prepare genomic DNA libraries
More informationChIP DNA Clean & Concentrator Catalog Nos. D5201 & D5205
Page 0 INSTRUCTION MANUAL ChIP DNA Clean & Concentrator Catalog Nos. D5201 & D5205 Highlights Quick (2 minute) recovery of ultra-pure DNA from chromatin immunoprecipitation (ChIP) assays, cell lysates,
More informationLabeling Protocol for mytags Immortal Libraries
5840 Interface Drive, Suite 101 Ann Arbor MI 48103 1 (734) 998 0751 techsupport@arborbiosci.com Labeling Protocol for mytags Immortal Libraries March 2018 Version 1.5 Contents Reagents and Equipment...
More informationDuplex-specific nuclease
Innovative Biotechnology Company www.evrogen.com Duplex-specific nuclease Product Cat.# Size Duplex-specific nuclease, lyophilized EA1 5 units* Duplex-specific nuclease, lyophilized EA2 units* Duplex-specific
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Oligo Clean & Concentrator Catalog Nos. D4060 & D4061 Highlights Quick (2 minute) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes, salts, enzymes, nucleotides,
More informationAccuScript High Fidelity 1 st Strand cdna Synthesis Kit
AccuScript High Fidelity 1 st Strand cdna Synthesis Kit INSTRUCTION MANUAL Catalog #200820 Revision B.01 For In Vitro Use Only 200820-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
More informationEnGen Mutation Detection Kit
DNA MODIFYING ENZYMES EnGen Mutation Detection Kit Instruction Manual NEB #E3321S 25 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.
More informationAlt-Ring the genome with CRISPR- Cas9
Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1 Integrated DNA Technologies The Custom Biology Company 2 IDT was founded by a scientist
More informationBIOO LIFE SCIENCE PRODUCTS. NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) BIOO Scientific Corp V13.01
BIOO LIFE SCIENCE PRODUCTS NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) Catalog #: 4201-01 (16 reactions) BIOO Scientific Corp. 2013 V13.01 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product
More informationAbsolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions
Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationFast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using a spin-column.
INSTRUCTION MANUAL ZymoPURE Plasmid Miniprep Kit Catalog Nos. D4209, D4210, D4211 & D4212 (Patent Pending) Highlights Fast and reliable purification of up to 100 µg of transfection-grade plasmid DNA using
More informationINCOGNITO T7 Ψ-RNA Transcription Kit
INTRODUCTION Cat. No. C-ICTY110510 The * is optimized for high-yield synthesis of pseudouridinecontaining RNA (Ψ-RNA) by in vitro transcription (IVT) of a DNA template that has a properly-oriented phage
More informationA Recommended Procedure for Real-Time Quantitative TaqMan PCR for Roundup Ready Canola RT73 Monsanto Biotechnology Regulatory Sciences
Page 1 of 7 Overview Purpose & Scope This procedure describes an event-specific real-time TaqMan PCR method for determination of the relative content of Roundup Ready canola RT73 (hereafter referred to
More informationTaKaRa MiniBEST Plasmid Purification Kit Ver.4.0
Cat. # 9760 For Research Use TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Shipping and Storage... 4 IV. Preparation
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationCRISPR 101: Optimizing Your Gene Editing Experiments
CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager Agenda 1 Technology Overview 2 Experimental Decisions 3
More informationGenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
More informationZymoclean Large Fragment DNA Recovery Kit
INSTRUCTION MANUAL Zymoclean Large Fragment DNA Recovery Kit Catalog Nos. D4045 & D4046 Highlights Quick (15 minute) spin column recovery of large-sized DNA (e.g., genomic, plasmid (BAC/PAC), viral, phage,
More informationI-Blue Midi Plasmid Kit. I-Blue Midi Plasmid Kit. (Endotoxin Free) IBI SCIENTIFIC. Instruction Manual Ver For Research Use Only.
Instruction Manual Ver. 05.11.17 For Research Use Only I-Blue Midi Plasmid Kit & I-Blue Midi Plasmid Kit (Endotoxin Free) IB47180, IB47190 (2 Preparation Sample Kit) IB47181, IB47191 (25 Preparation Kit)
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5090 SingleShot Probes Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot Probes Kit prepares genomic DNA (gdna) free RNA directly from cell culture
More informationQuick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection
INSTRUCTION MANUAL Select-a-Size DNA Clean & Concentrator Catalog No. D4080 Highlights Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double
More informationQuick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double size selection
INSTRUCTION MANUAL Select-a-Size DNA Clean & Concentrator Catalog No. D4080 Highlights Quick and easy 7 minute protocol to select for 300 bp, 200 bp, 150 bp, 100 bp, 50 bp DNA fragments or perform a double
More informationZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063
INSTRUCTION MANUAL ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 Highlights Quick, high-throughput (96-well) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes,
More informationTorsional Constraints of DNA Substrates Impact Cas9 Cleavage
Supporting Information Torsional Constraints of DNA Substrates Impact Cas9 Cleavage Michael H. Räz, Kumi Hidaka, Shana J. Sturla, Hiroshi Sugiyama, *,, and Masayuki Endo *, Institute for Integrated Cell-Material
More informationFast-Link DNA Ligation Kits
Fast-Link DNA Ligation Kits Cat. Nos. LK0750H and LK6201H Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA086E Fast-Link DNA Ligation Kits 6/2017 1 1. Introduction The Fast-Link
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationCELLSCRIPT RNA for Translation in Cells
TM CELLSCRIPT RNA for Translation in Cells INCOGNITO T7 -RNA Transcription Kit Cat. No. C-ICTY110510 INTRODUCTION The INCOGNITO T7 -RNA Transcription Kit* is optimized for high-yield synthesis of pseudouridinecontaining
More informationPurification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost
Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen
More informationNEXTflex Cystic Fibrosis Amplicon Panel. (For Illumina Platforms) Catalog # (Kit contains 8 reactions) Bioo Scientific Corp V17.
NEXTflex Cystic Fibrosis Amplicon Panel (For Illumina Platforms) Catalog #4231-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2017 V17.02 This product is for research use only. Not for use in diagnostic
More informationCELLSCRIPT RNA for Translation in Cells
TM CELLSCRIPT RNA for Translation in Cells Cat. No. C-PAP5104H INTRODUCTION The uses ATP as a substrate for template-independent addition of adenosine monophosphates to the 3'-hydroxyl termini of RNA.
More informationAlt-R CRISPR-Cas9 System:
genome editing user guide Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complex into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationMicroarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Quick-RNA Fecal/Soil Microbe Microprep Kit Catalog No. R2040 Highlights Quick, 10 minute isolation of total RNA (~10 µg) from various soil and fecal samples using ultra-high density
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Quick-RNA Whole Blood Catalog Nos. R1201 Highlights Purify high-quality total RNA (including small/micro RNAs) from whole and partitioned blood samples. Compatible with commonly used
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationYeaStar Genomic DNA Kit Catalog No. D2002
Instructions YeaStar Genomic DNA Kit Catalog No. D2002 Table of Contents General Information...... 1 Package Contents Ordering Information General Description...... 2 Protocol I.......... 2 Protocol II.
More informationCircLigase II ssdna Ligase
Cat. Nos. CL9021K and CL9025K www.lucigen.com MA298E-CircLigase II ssdna Ligase 2/2018 1 1. Introduction CircLigase II ssdna Ligase is a thermostable ligase that catalyzes iintramolecular ligation (i.e.,
More informationENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system
ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see
More informationProcedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
More informationLipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit)
Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationSuperiorScript III cdna Synthesis Kit Instruction Manual
SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More informationSUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity
SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University
More informationNEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V15.
NEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA-5143-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2015-2018 V15.07 This product is for research use only. Not for use in diagnostic procedures.
More informationSupplementary Protocol: CIRCLE-seq Library Preparation
Supplementary Protocol: CIRCLE-seq Library Preparation Reagent Gentra Puregene Tissue Kit Qubit dsdna BR Assay Kit Agencourt AMPure XP magnetic beads High throughput, with bead, PCR-free Library Preparation
More informationZymo-Spin Technology. The microcentrifuge column that revolutionized nucleic acid clean-up
Zymo-Spin Technology The microcentrifuge column that revolutionized nucleic acid clean-up Overview A Comprehensive Solution for DNA and RNA Clean-Up High-quality, inhibitor-free DNA and RNA is crucial
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationTB Green Premix Ex Taq II (Tli RNaseH Plus)
Cat. # RR820A For Research Use TB Green Premix Ex Taq II (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AGY1013N. See section IV.
More informationTelomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog # reactions
Telomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog #8928 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect chromosomes
More informationSunScript One Step RT-PCR Kit
SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...
More informationSunScript TM Reverse Transcriptase RNaseH+
Reverse Transcriptase RNaseH+ INDEX Ordering Information...3 Kit Contents...3 Source...3 Activity Unit Definition...3 Inactivation...3 Shipping and Storage...3 Handling...3 Quality Control Assays...4 Reagents
More information