CBI Toolbox Tour 2015
|
|
- Dana Gregory
- 6 years ago
- Views:
Transcription
1 CBI Toolbox Tour 2015
2 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper
3 Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated Dual Syringe Titration System Peltier Thermostatted Stopped-Flow Scanning Emission Monochromator
4 Intensity AU x Intensity (AU) LI-COR Odyssey CLx imaging system Gel documentation system which uses 2 IR lasers for scanning as opposed to white light imaging. Useful for quantitation of coomassie stained gels (dynamic range 10ng 20mg). Also useful for quantifying western blots using IR-dye labeled secondary antibodies over a 4000 fold range of concentration. Capability to do 2 colour westerns. Coomassie stained purified protein Western Blot purified protein [Protein] μm Additional applications In-cell westerns Mouse imaging Nucleic acid imaging Tissue section analysis [Protein] pm
5 Waters Synapt G2Si HDX Sensitive + Fast Data Analysis CheA peptides identified! More CF peptides identified 27 new peptides found in Synapt spectra (~100% coverage) Micro-tof and Synapt spectra Not yet found in Synapt spectra receptor fragment Deuterium Incorporation kinase: off on off on CheW CheA Time (min) 1000 Previous study: 27 CF peptides by MS/MS, 87% coverage
6 Malvern Zetasizer Measures Zeta Potential Isoelectric Point Particle Size Molecular Weight Source: Malvern Technical Notes
7 Capabilities: BioTek Synergy 2 Microplate Reader Absorbance Fluorescence Intensity Fluorescence Polarization Luminescence Ex (nm) Em (nm) 485* 528* *50 nm FITC in 50 μl yields 1000x signal-to-noise Acquisition Modes: Endpoint Kinetic Area Scanning Spectral Scanning Other Features: Incubator Shaker Timer Basic Data Analysis Compatible with most plate types Contact Eugenia Clerico: eclerico@biochem.umass.edu Plate Type 48-well 96-well 384-well 1536-well Sample Volume ~500 μl ~100 μl ~50 μl ~5 μl
8 Interaction analysis study signal transduction pathways using crosslinkers to trap, isolate and identify interactions between proteins, membrane receptors and nucleic acids Conjugation create custom conjugates by covalently linking biomolecules, eg: proteins, nucleic acids, drugs, peptides, hormones metabolites and cellular organelles. Immobilization - immobilize antibodies and other proteins, nucleic acids or cells to resin, the extracellular matrix, chips, slides or nanoparticles. In vivo crosslinking trap protein complexes in live cells by treating cells with membrane permeable crosslinking reagents. Labeling tag proteins or nucleic acids with various reporters, such as fluorophores. Structural analysis study proteins oligomerization or the formation of heterologous protein complexes by mapping binding sites. Antigen preparation crosslink antigens to carrier proteins for animal immunization/antibody produciton. Protein alkylation chemically block amino acid functional groups on proteins. Amine-to-Amine Sulfhydryl-to-Carbohydrate Sulfhydryl-to-Sulfhydryl Photoreactive Amine-to-Sulfhydryl Chemoselective Ligation Membrane Permeable Carboxyl-to-Amine (click chemistry metabolic labeling) (In vivo crosslinking)
9 SEC-MALS Size Exclusion Chromatography with Multi-Angle Light Scattering Detection dn I Mc scattered Properties Measured: dc -Absoute M w and rms radius, R g (size distribution) -Small aggregates/oligomers -Hydrodynamic radius, R h (from DLS) -Conjugate analysis (Gylcosylation, PEGylation) -Conformation from on-line DLS (unfolded, compact) 2 DAWN MALS detector Optilab T-rex dri detector Embedded WyattQELS DLS module LC s UV detector (Agilent) ASTRA software (Wyatt) Location: LSL N260 Wide-range of samples: Polymers and proteins including biologics like mabs, protein-drug conjugates, viruses, and nanoparticle drug-delivery vehicles
PRODUCT DATA SHEET. Carboxylated Fluorescent Gold Nanoparticles. Description. Characteristics
PRODUCT DATA SHEET Carboxylated Fluorescent Gold Nanoparticles Description Cytodiagnostics carboxylated fluorescent gold nanoparticles is a unique product that combines our Cyto fluorescent dyes and gold
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide
ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide Protein name and full primary structure, by providing a NCBI (or UniProt) accession
More informationLecture 5: 8/31. CHAPTER 5 Techniques in Protein Biochemistry
Lecture 5: 8/31 CHAPTER 5 Techniques in Protein Biochemistry Chapter 5 Outline The proteome is the entire set of proteins expressed and modified by a cell under a particular set of biochemical conditions.
More informationALP (alkaline phosphatase) calibrators were analyzed manually in microtiter plates to find the linearity range by following this protocol:
Exam Mol 3008 May 2009 Subject 1 (15p) ALP (alkaline phosphatase) calibrators were analyzed manually in microtiter plates to find the linearity range by following this protocol: Reaction solutions: 50
More informationIMPACT OF HIGHER ORDER COMPLEXES ON BIOMARKER TARGET QUANTITATION
IMPACT OF HIGHER ORDER COMPLEXES ON BIOMARKER TARGET QUANTITATION SURENDRAN RAJENDRAN Bristol-Myers Squibb Immunogenicity and Bioassay Summit 2014 - Immunogenicity Assessment & Clinical Relevance - Assay
More informationMicroarray Industry Products
Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase
More informationMulti-Volume Based Protein Quantification
A p p l i c a t i o n G u i d e Multi-Volume Based Methods Why Quantify Proteins? Proteins are central to our understanding of biology. In cells, they are multipurpose: from actin providing structural
More information2-Dimensional Electrophoresis
2-Dimensional Electrophoresis Proteomics Pathway Proteomics Pathway History of 2-DE 1956 -paper & starch gel 1975 -Coupling of IEF & SDS-PAGE IPG-IEF 2DE-Techniques Immobilized ph Gradient IsoElectric
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different
More informationOdyssey Fc Imaging System Infrared fluorescent and chemiluminescent imaging in one system!
Odyssey Infrared Imaging System A fundamental change in western blot analysis Odyssey Fc Imaging System Infrared fluorescent and chemiluminescent imaging in one system! Accurate Quantification Wide linear
More informationnanodsf 2bind: Your service provider for biophysical characterization of proteins Precisely revealing protein folding and stability
nanodsf Precisely revealing protein folding and stability 2bind: Your service provider for biophysical characterization of proteins This booklet was written and designed by 2bind 08 2015 Any reproduction
More informationDescription. Lipodin-Pro TM - Protein Transfection Reagent. 1. Kit Benefits
Description Lipodin-Pro TM - Protein Transfection Reagent The delivery of proteins inside living cells represents an alternative to nucleic acids transfection and a powerful strategy for functional studies
More informationInnovative Solutions for Drug Discovery and Life Sciences Research
Innovative Solutions for Drug Discovery and Life Sciences Research Unleash your brilliance Advancing cell and protein analysis technologies for your landmark scientific achievements Molecular Devices is
More informationAn Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators
A p p l i c a t i o n N o t e An Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators Brad Larson and Peter Banks, BioTek Instruments, Inc., Winooski, VT Bruce Sherf,
More informationSynergy NEO HTS Multi-Mode Microplate Reader and Life Technologies Reagents
A p p l i c a t i o n G u i d e Synergy NEO HTS Multi-Mode Microplate Reader and Life Technologies Reagents High Performance Multi-Detection Capabilities that Span the Small Molecule Drug Discovery Process
More informationAgilent AssayMAP Platform BIOLOGICS SAMPLE PREPARATION INTELLIGENTLY AUTOMATED
Agilent AssayMAP Platform BIOLOGICS SAMPLE PREPARATION INTELLIGENTLY AUTOMATED SIMPLIFY BIOLOGICS SAMPLE PREPARATION The Agilent AssayMAP platform is an open access, walkaway automation solution specifi
More informationA Comprehensive Workflow to Optimize and Execute Protein Aggregate Studies
A Comprehensive Workflow to Optimize and Execute Protein Aggregate Studies Combining Size Exclusion Chromatography with Method Development and Light Scattering Application Note Biotherapeutics and Biosimilars
More informationSpectraMax Paradigm Microplate Reader
SpectraMax Paradigm Microplate Reader User-upgradeable Multi-Mode Detection Platform BENEFITS Flexible design allows for single or dual excitation and emission High speed detection and excellent sensitivity
More informationCharacterization of mab aggregation using a Cary 60 UV-Vis Spectrophotometer and the Agilent 1260 Infinity LC system
Characterization of mab aggregation using a Cary 60 UV-Vis Spectrophotometer and the Agilent 1260 Infinity LC system Application Note Biopharmaceuticals Authors Arunkumar Padmanaban and Sreelakshmy Menon
More informationspecial offers from your protein biology resource
special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research
More informationFlow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
More informationUV Fluorescence Polarization as a Means to Investigate Protein Conformational and Mass Change
A p p l i c a t i o n N o t e UV Fluorescence Polarization as a Means to Investigate Protein Conformational and Mass Change Using Intrinsic Tryptophan Fluorescence in Conjunction with UV-capable Polarizers
More informationSolutions for the Core and Protein Laboratory: MassHunter Walkup
Solutions for the Core and Protein Laboratory: MassHunter Walkup Jade C. Byrd MS Software Product Manager Page 1 Common Challenges in Characterizing Biomolecules Molecular size (insulin is 5 kda, mabs
More informationOverview of Solulink Products. June 2011
Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical
More informationExtracting Pure Proteins from Cells
Extracting Pure Proteins from Cells 0 Purification techniques focus mainly on size & charge 0 The first step is homogenization (grinding, Potter Elvejhem homogenizer, sonication, freezing and thawing,
More informationSpectraMax Multi-Mode Microplate Readers
SpectraMax Multi-Mode Microplate s Your applications, your modes, your choice > upgradeable platform for changing lab needs > three-mode cuvette port FOR ASSAY DEVELOPMENT > Dual monochromator tunability
More informationDino-Lite knowledge & education. Fluorescence Microscopes
Dino-Lite knowledge & education Fluorescence Microscopes Dino-Lite Fluorescence models Smallest fluorescence microscope in the world Revolution to biomedical and educational applications Flexible Easy
More informationRapid and Simple Quantification of DNA and Protein Using the VICTOR Nivo Multimode Plate Reader
APPLIATION NOTE Multimode Detection Authors: Maria Kuzikov Roman Kanke Fraunhofer IME ScreeningPort Hamburg, Germany Rapid and Simple Quantification of DNA and Protein Using the VITOR Nivo Multimode Plate
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationBiomolecular Interaction Analytics using MicroScale Thermophoresis
Biomolecular Interaction Analytics using MicroScale Thermophoresis The Monolith NT.115 Dinorah Leyva, Ph.D. NanoTemper Technologies Inc. 395 Oyster Point Blvd. Suite 135, South San Francisco, CA www.nanotemper-technologies.com
More informationFamily of Imaging Systems
Family of Imaging Systems QUANTITATIVE WESTERN BLOTS HIGH SENSITIVITY WIDE, LINEAR DYNAMIC RANGE NO FILM OR DARKROOM WIDE RANGE OF APPLICATIONS Family of Imaging Systems The Standard for Western Blot Technology
More informationDetermining fluorescence Limit of Detection with Nanoparticle Tracking Analysis (NTA)
Determining fluorescence Limit of Detection with Nanoparticle Tracking Analysis (NTA) FLUORESCENCE DETECTION PARTICLE SIZE PARTICLE CONCENTRATION Introduction The ability to detect nanoparticle fluorescence
More informationTechnical Manual. Transcreener KINASE Assay Transcreener KINASE Plus Assay
Technical Manual Transcreener KINASE Assay Transcreener KINASE Plus Assay Transcreener KINASE Assay and Transcreener KINASE Plus Assay Catalog # 3003-1K, 3003-10K, 3004-1K & 3004-10K 1.0 Introduction p.2
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationMore choices, better detection.
3 Protein Detection More choices, better detection. Perform Western blotting experiments faster and easier with our new Thermo Scientific Pierce G2 Fast Blotter and accessories, and push your microscopy
More informationMST Starting Guide Monolith NT.115
MST Starting Guide Monolith NT.115 Contents 1. How to design an experiment 2. Before you start 3. Assay Setup Pretests 4. Assay Setup 5. MST-experiment using temperature control 6. Data Interpretation
More informationBiomedical Applications of Molecular Spectroscopy
Biomedical Applications of Molecular Spectroscopy Mike Kayat B&W Tek, Inc 19 Shea Way Newark, DE 19713 United States of America +1 302 368 7824 mikek@bwtek.com 1 Overview Molecular spectroscopy is a large
More informationAnalysis of Protein Biopharmaceuticals
Analysis of Protein Biopharmaceuticals Comprehensive cgmp Services at Every Stage of Drug Development Amazing where you can go At Solvias, we work closely with you Solvias provides comprehensive services
More informationSupporting Information. A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid. Detection Of Alzheimer's Disease
Supporting Information A Fluorogenic Resveratrol-Confined Graphene Oxide For Economic and Rapid Detection Of Alzheimer's Disease Xiao-Peng He, 1 Qiong Deng, 1 Liang Cai, 1 Chang-Zheng Wang, 1,2 Yi Zang,*,2
More informationMolecular Characterization of Biotherapeutics The Agilent 1260 Infi nity Multi-Detector Bio-SEC Solution with Advanced Light Scattering Detection
Molecular Characterization of Biotherapeutics The Agilent 126 Infi nity Multi-Detector Bio-SEC Solution with Advanced Light Scattering Detection Application Note Biologics and Biosimilars Authors Sonja
More information1) Western Blot: It`s based on Electrophoresis.
Today we will begin our lecture with Immunoassays. They are methods to detect proteins in samples or in cells rather than to purify them. We have two methods: 1) Western Blot 2) ELIZA 1) Western Blot:
More informationDirect visualization, sizing and concentration measurement of fluorescently labeled nanoparticles using NTA
Direct visualization, sizing and concentration measurement of fluorescently labeled nanoparticles using NTA NANOSIGHT RANGE Visualize and Measure Nanoparticle Size and Concentration PARTICLE SIZE PARTICLE
More informationImaging of BacMam Transfected U-2 OS Cells
A p p l i c a t i o n N o t e Imaging of BacMam Transfected U-2 OS Cells Optimization of Transfection Conditions Using the Cytation 3 Multi- Mode Reader and Gen5 Data Analysis Software Paul Held Ph. D.
More informationAlamarBlue Cell Viability Assay Reagent
668PR A Geno Technology, Inc. (USA) brand name G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com AlamarBlue Cell Viability Assay Reagent (Cat.# 786-921, 786-922 & 786-923) think proteins!
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10324 Fig. S1: Two dimensional IEF/SDS-PAGE/Western blot analysis of RBC lysate crosslinked with 4 mm BS 3. The blot was probed with αsyn antibody C20. Fig. S2: SDS-PAGE/silver stain
More informationInnovations To Meet Your Needs
Innovations To Meet Your Needs Cooled CCD Camera 1340 x 1037 pixel resolution for greatest image quality 12-bit precision provides 3 orders of linear dynamic range Windows and Power Macintosh Software
More informationMitoBiogenesis In-Cell ELISA Kit (Colorimetric)
PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis
More informationIn-Cell Western QUANTITATIVE CELL-BASED ASSAYS ACCURATE QUANTIFICATION MULTIPLEX DETECTION HIGH SENSITIVITY DIRECT DETECTION
In-Cell Western QUANTITATIVE CELL-BASED ASSAYS ACCURATE QUANTIFICATION MULTIPLEX DETECTION HIGH SENSITIVITY DIRECT DETECTION IMMUNOFLUORESCENT-BASED ASSAY MULTIPLE TARGETS In-Cell Western QUANTITATIVE
More informationPIPETMAX 268, Coomassie (Bradford) Protein Assay, Molecular Biology, Automation, Pipetting System, PIPETMAN
Increased Efficiency of the Coomassie (Bradford) Protein Assay for Protein Content Determination Using Simple Automated Liquid Handling vs. Manual Procedures Keywords Introduction Application Note CL0113
More informationN-domain and p97 ATPase activity SUPPLEMENTAL DATA
SUPPLEMENTAL DATA ATPase assay based on malachite green system ATPase assays were performed using malachite green system (19,54) to obtain kinetic parameters. The assays were performed in reaction mixture
More informationPEPperCHIP Immunoassay Protocol
Support: Phone: +49 6221 7264489 Fax: +49 6221 7264475 Email: Website: Address: pepperchip@pepperprint.com www.pepperprint.com PEPperPRINT GmbH, Rischerstr. 12, 69123 Heidelberg, Germany Table of Content:
More informationHuman IGFBP7 ELISA Pair Set
Human IGFBP7 ELISA Pair Set Catalog Number : SEK13100 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General ELISA
More informationPRODUCT DATA SHEET. Carboxylated Gold Nanoparticles. Description. Features. Storage. Applications. Handling. Characteristics
PRODUCT DATA SHEET Carboxylated Gold Nanoparticles Description Cytodiagnostics carboxylated gold nanoparticles are available with two different lengths of PEG surface spacers, i.e. 3000Da and 5000Da offering
More informationSupporting Information. Cationic Conjugated Polymers-Induced Quorum Sensing of Bacteria Cells
Supporting Information Cationic Conjugated Polymers-Induced Quorum Sensing of Bacteria Cells Pengbo Zhang, Huan Lu, Hui Chen, Jiangyan Zhang, Libing Liu*, Fengting Lv, and Shu Wang* Beijing National Laboratory
More informationOCTOPLUS QPLEX FLUORESCENCE IMAGER. for fast & powerful fast 2D Gel image acquisition
OCTOPLUS QPLEX FLUORESCENCE IMAGER for fast & powerful fast 2D Gel image acquisition Octoplus QPLEX Fluorescence Imager The new Octoplus QPLEX fluorescence imager sets a novel standard fluorescence 2D
More information2 Liquid chromatography of biomolecules
2 Liquid chromatography of biomolecules Proteins, peptides, DNA, RNA, lipids, and organic cofactors have various characteristics such as electric charge, molecular weight, hydrophobicity, and surface relief.
More informationMore on fluorescence
More on fluorescence Last class Fluorescence Absorption emission Jablonski diagrams This class More on fluorescence Common fluorophores Jablonski diagrams to spectra Properties of fluorophores Excitation
More informationStrategies in proteomics
Strategies in proteomics Systems biology - understand cellpathways, network, and complex interacting (includes Genomics, Proteomics, Metabolomics..) Biological processes - characterize protein complexes,
More informationThe New Wave in Spectroscopy FS-2 FluoroMate Fluorescence Spectrometer
www.scinco.com The New Wave in Spectroscopy FluoroMate FS-2 FluoroMate FS-2 FluoroMate FS-2 The SCINCO FS-2 fluorescence spectrometer delivers exceptional sensitivity for the most accurate measurements.
More informationSupplementary Figure 1. Botrocetin induces binding of human VWF to human
Supplementary Figure 1: Supplementary Figure 1. Botrocetin induces binding of human VWF to human platelets in the absence of elevated shear and induces platelet agglutination as detected by flow cytometry.
More informationWVU FLOW CYTOMETRY & SINGLE CELL CORE FACILITY
WVU FLOW CYTOMETRY & SINGLE CELL CORE FACILITY Newsletter Volume 5, issue 1 July 2018 Finding and Validating Antibodies Part 1 Inside this Issue 1-2 Finding and Validating Antibodies Part 1 3 4 Flow Cytometers
More informationApplication Note. Authors. Abstract. Ravindra Gudihal Agilent Technologies India Pvt. Ltd. Bangalore, India
Quantitation of Oxidation Sites on a Monoclonal Antibody Using an Agilent 1260 Infinity HPLC-Chip/MS System Coupled to an Accurate-Mass 6520 Q-TOF LC/MS Application Note Authors Ravindra Gudihal Agilent
More informationDetection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer. Application
Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer Application Gerd Luedke and Tobias Preckel Abstract This Application Note describes how the
More informationVisualisation, Sizing and Counting of Fluorescent and Fluorescently-Labelled Nanoparticles
Visualisation, Sizing and Counting of Fluorescent and Fluorescently-Labelled Nanoparticles Introduction Fluorescent molecules have long been used to specifically label particular structures and features
More informationAntibody drug conjugate screening and characterization
Antibody drug conjugate screening and characterization Simple and effective tools for monitoring antibody internalization Antibody drug conjugates Visual confi rmation of internalization Over the past
More informationPROTOCOL. Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) MS747 Rev.0 DESCRIPTION ADDITIONAL MATERIALS REQUIRED
PROTOCOL Monoamine Oxidase B Enzyme Specific Activity Assay Kit (human) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS747 Rev.0 DESCRIPTION MAOB Enzyme Specific Activity Assay Kit Sufficient materials
More informationFlexStation 3 Microplate Reader
FlexStation 3 Microplate Reader A five-mode microplate reader with integrated fluid transfer > five-mode reader with wide range of applications > flexible liquid transfer enables more assay conditions
More informationQS S Assist STK_FP Kit
QS S Assist STK_FP Kit Description STK FP kit is designed for use in pharmacological assays for STK based on fluorescence polarization. The kit includes assay buffer, human protein kinase, ATP/fluorescence-
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationOptical Observation - Hyperspectral Characterization of Nano-scale Materials In-situ
Optical Observation - Hyperspectral Characterization of Nano-scale Materials In-situ Research at the nanoscale is more effective, when research teams can quickly and easily observe and characterize a wide
More informationStable Isotope Labeling with Amino Acids in Cell Culture. Thermo Scientific Pierce SILAC Protein Quantitation Kits
Stable Isotope Labeling with Amino Acids in Cell Culture Thermo Scientific Pierce SILAC Protein Quantitation Kits Quantitative Analysis of Differential Protein Expression Stable isotope labeling using
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/7/e1614/dc1 Supplementary Materials for Copper-induced structural conversion templates prion protein oligomerization and neurotoxicity Chi-Fu Yen, Dilshan S.
More informationFlexStation 3 microplate reader
FlexStation 3 microplate reader A five-mode microplate reader with integrated fluid transfer > five-mode reader with wide range of applications > flexible liquid transfer enables more assay conditions
More informationProSEC 300S. Protein Characterization columns
ProSEC 300S Protein Characterization columns Agilent s ProSEC 300S is a silica-based material specifically designed for the analysis of proteins by aqueous size exclusion chromatography. With a proprietary
More informationSupplementary Information
Supplementary Information Nanofibrous Spongy Microspheres to Distinctly Release mirna and Growth Factors to Enrich Regulatory T Cells and Rescue Periodontal Bone Loss Zhongning Liu, Xin Chen, Zhanpeng
More informationPARP-1 (cleaved) Human In-Cell ELISA Kit (IR)
ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product
More informationIMMUNOPRECIPITATION TROUBLESHOOTING TIPS
IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds
More informationIntroduction to Assay Development
Introduction to Assay Development A poorly designed assay can derail a drug discovery program before it gets off the ground. While traditional bench-top assays are suitable for basic research and target
More informationN-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF
N-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF Application Note Authors Xianming Liu, Wei Zhang, Yi Du, Sheng Yin, Hong Que, and Weichang Zhou WuXi AppTec iopharmaceuticals
More informationSupporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez
Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez DNA sequences Strand Sequence 1- GGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGG
More informationImmunoaffinity Chromatography
PR120 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immunoaffinity Chromatography Teacher s Guidebook (Cat. # BE 507) think proteins! think
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationStreamline Your Antibody Enrichment Using Scalable Magnetic Bead-Based Chemistries
Streamline Your Antibody Enrichment Using Scalable Magnetic Bead-Based Chemistries Samantha Lewis, Ph.D. 2013. Webinar Outline Introduction Magnetic Bead-Based Method Overview Scalability Chemistries o
More informationMethods for Working with DNA and RNA
Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are
More informationBiochemical Analysis The Lambda Series UV/Vis Spectroscopy
Inorganic Analysis Chromatography Molecular Spectroscopy Thermal Analysis Informatics UV/Vis Spectroscopy Biochemical Analysis The Lambda Series P R O D U C T N O T E www.perkinelmer.com Bioresearch laboratories
More informationBuffers: (We recommend filtering the PBS buffer using a 0.45 µm filter before adding any supplements.)
Table of Content: 1. Components... 1 1.1 PEPperCHIP Peptide Microarray... 1 1.2 Storage... 1 1.3 Additional material to be supplied by user... 1 2. Staining protocols... 2 2.1 Overview about array handling...
More informationProtein Purification and Characterization Techniques. Nafith Abu Tarboush, DDS, MSc, PhD
Protein Purification and Characterization Techniques Nafith Abu Tarboush, DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Extracting Pure Proteins from Cells Purification techniques focus
More informationIntroduction to Biosensor. Wei Shi DianHong Shi
Introduction to Biosensor Wei Shi DianHong Shi Outline The definition of biosensor The history of biosensor The development of biosensor The working principle of biosensor The application of the biosensors
More informationSupplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3. Supplementary Figure S4
Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Figure S5 Supplementary Figure S6 Supplementary Figure S7 Supplementary Figure S8 Supplementary
More informationNEWTON 7.0 BIOLUMINESCENCE & FLUORESCENCE IMAGING IN VIVO - IN VITRO IMAGING
NEWTON 7.0 BIOLUMINESCENCE & FLUORESCENCE IMAGING IN VIVO - IN VITRO IMAGING The NEWTON s protocol driven image acquisition is as quick as it is intuitive: adjust your exposure, save, print or quantify.
More informationSapphire. Biomolecular Imager THE NEXT GENERATION OF LASER-BASED IMAGING
Sapphire Biomolecular Imager THE NEXT GENERATION OF LASER-BASED IMAGING Breakthrough image capture and analysis The Sapphire Biomolecular Imager is a next generation laser scanning system that provides
More informationMolecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
More informationA Straw-Housed Paper-based Colorimetric Antibody-antigen Sensor
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2016 Supporting Information A Straw-Housed Paper-based Colorimetric Antibody-antigen Sensor
More informationIMPROVE SPEED AND ACCURACY OF MONOCLONAL ANTIBODY BIOANALYSIS USING NANOTECHNOLOGY AND LCMS
IMPROVE SPEED AND ACCURACY OF MONOCLONAL ANTIBODY BIOANALYSIS USING NANOTECHNOLOGY AND LCMS As scientists gain an advanced understanding of diseases at the molecular level, the biopharmaceutical industry
More informationTowards an in vivo Stability Assay for ADCs and Their Metabolites in Serum by Affinity Capture LC-MS
Towards an in vivo Stability Assay for ADCs and Their Metabolites in Serum by Affinity Capture LC-MS mz (@Dr_mz13), PhD 11-Feb-2013 One of the challenges of ADCs includes the development of a method to
More informationWhy purify proteins?
Why purify proteins? Detailed studies on function Determination of structure Industrial/pharmaceutical applications Generate antibodies Amino acid sequence determination 1/16/04 Marilyn Niemann, UAB/CORD
More informationTARGETS Anti-Biotin Anti-Streptavidin Anti-FITC Anti-Phycoerythrin Anti-Mouse IgG Anti-Rabbit IgG (H+L) Anti-Human IgG (H+L)
Signal Amplifiers Genisphere s UltraAmp reagents are 3DNA dendrimers customized with a variety of labels and targeting moieties, to increase the sensitivity in any immunoassay or nucleic acid detection
More informationIn Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1
This journal is The Royal Society of Chemistry 213 In Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1 Dong-Dong Zheng, a Dong Pan, a Xiao Zha, ac Yuqing Wu,* a Chunlai
More information