Supplementary Appendix

Size: px
Start display at page:

Download "Supplementary Appendix"

Transcription

1 Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Blanken MO, Rovers MM, Molenaar JM, et al. Respiratory syncytial virus and recurrent wheeze in healthy preterm infants. N Engl J Med 2013;368: DOI: /NEJMoa

2 Appendix Respiratory Syncytial Virus and Recurrent Wheeze in Healthy Preterm Infants Maarten O. Blanken, Maroeska M. Rovers, Jorine M. Molenaar, Pauline L. Winkler-Seinstra, Adam Meijer, Jan L. L. Kimpen, Louis Bont Table of Contents Supplemental Methods: Study Intervention Supplemental Methods: RSV PCR Supplemental Table S1 1

3 Methods Study Intervention Palivizumab is a humanized monoclonal antibody directed against the fusion protein of RSV and prevents hospitalization for RSV infection. 1, 2 Interventions were intramuscular injections of palivizumab 15 mg/kg or placebo during one RSV season from October 1 st or from discharge from the neonatal unit until March 10 th. A minimum of 2 and a maximum of 5 injections were given. The RSV season was defined as running from October 1 st through March 31 st based on virological data obtained from the National Institute of Public Health and the Environment (RIVM). For subjects randomized to placebo, physiological sodium chloride 0.9% solution for intramuscular injection was used. Treatment was started at the patient s home from the first week of October or within 72 hours after discharge from the neonatal hospitalization. All injections were administered at the patient s home and home visits ended after the last injection. RSV PCR Total nucleic acid was extracted from 200 µl specimen using the MagNA Pure 96 platform (Roche) and MagNA Pure 96 DNA and Viral NA Small Volume Kit (Roche). For RSV types A and B detection a duplex real-time onestep RT-PCR was performed on 5 µl total nucleic acid, using the one-step TaqMan EZ RT-PCR kit (ABI) in a final volume of 25 µl on a Lightcycler 480 (Roche). The copy DNA synthesis and amplification protocol consisted of 2 minutes at 50 C (decontamination using Uracil N-glycosylase), 30 minutes at 55 C (reverse transcription), 5 minutes at 95 C (inactivation Uracil N-glycosylase) and 45 cycles of 20 seconds at 94 C and 1 minute at 55 C, with primers 5 -TGA ACA ACC CAA AAG CAT CA-3 and 5 -CCT AGG CCA GCA GCA TTG-3 and probe 5-6Fam-AAT TTC CTC ACT TCT CCA GTG TAG TAT TAG G-BHQ1-3 for RSV type A (in house design) and primers 5-GAT GGC TCT TAG CAA AGT CAA GTT AA-3 and 5 -TGT CAA TAT TAT CTC CTG TAC TAC GTT GAA-3 and probe 5 -YY-TGA TAC ATT AAA TAA GGA TCA GCT GCT GTC ATC CA- BHQ1-3 for RSV type B 3, both PCRs targeting the nucleocapsid gene of RSV. 2

4 Table S1: Baseline Characteristics Palivizumab Placebo (n=214) (n=215) Male (%)** 125 (58%) 94 (44%) Birth Weight gram (95%CI) 2294 ( ) 2289 ( ) Gestational Age weeks (95%CI) 34+3 ( ) 34+3 ( ) Multiple birth (%) 38 (19%) 36 (18%) Type of feeding (%) Breastfeeding and formula 90 (44%) 107 (53%) Breastfeeding 59 (29%) 49 (24%) Formula 54 (27%) 46 (23%) Maternal smoking during pregnancy (%) 32 (15%) 34 (16%) Parental smoking Mother (%) 33 (15%) 36 (17%) Father (%) 57(27%) 62 (29%) Siblings (%) 82 (44%) 85 (45%) Age mother (median (range) 31 (19-48) 32 (18-44) Age father (median (range) 34 (21-55) 35 (22-52) Atopy Mother (%) 85 (40%) 72 (34%) 3

5 Physician diagnosis Asthma 22 (11%) 24 (12%) Physician diagnosis Hay fever 48 (24%) 45 (23%) Physician diagnosis Eczema 48 (24%) 30 (15%) Atopy Father (%) 73 (34%) 80 (37%) Physician diagnosis Asthma 27 (14%) 21 (11%) Physician diagnosis Hay fever 44 (22%) 52 (26%) Physician diagnosis Eczema 29 (15%) 27 (14%) Household pets (%) 97 (48%) 98 (49%) Daycare attendance (%) 103 (48%) 113 (53%) Sibling attending daycare (%) 75 (37%) 79 (40%) Doses palivizumab received (median 4 (1-5) 4 (2-5) (range) **: p<0.01 Reference List 1. Palivizumab, a humanized respiratory syncytial virus monoclonal antibody, reduces hospitalization from respiratory syncytial virus infection in high-risk infants. The IMpact-RSV Study Group. Pediatrics 1998;102(3 Pt 1): Feltes TF, Cabalka AK, Meissner HC et al. Palivizumab prophylaxis reduces hospitalization due to respiratory syncytial virus in young children with hemodynamically significant congenital heart disease. J Pediatr 2003;143(4): Hu A, Colella M, Tam JS, Rappaport R, Cheng SM. Simultaneous detection, subgrouping, and quantitation of respiratory syncytial virus A and B by real-time PCR. J Clin Microbiol 2003;41(1):

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table

More information

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

Supplementary Figure 1A A404 Cells +/- Retinoic Acid Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

Hes6. PPARα. PPARγ HNF4 CD36

Hes6. PPARα. PPARγ HNF4 CD36 SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa

More information

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

Legends for supplementary figures 1-3

Legends for supplementary figures 1-3 High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Y-chromosomal haplogroup typing Using SBE reaction

Y-chromosomal haplogroup typing Using SBE reaction Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G

More information

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013 Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3 Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts

More information

Supplemental material

Supplemental material Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%) SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian

More information

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

PCR analysis was performed to show the presence and the integrity of the var1csa and var- Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc

More information

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+ ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin

More information

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

More information

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas

More information

Multiplexing Genome-scale Engineering

Multiplexing Genome-scale Engineering Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt

More information

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)

More information

Detection and quantification of bovine polyomavirus by real-time PCR

Detection and quantification of bovine polyomavirus by real-time PCR Page 1 of 5 EU FP VII PROJECT VITAL STANDARD OPERATING CREATED: REVISED: APPROVED: David Rodríguez Lázaro: 18-02-2010 FERA: 28-03-2010 Wim Van der Poel: 31-03-2010 Page 2 of 5 WARNING All samples and controls

More information

Supplemental Table 1. Primers used for PCR.

Supplemental Table 1. Primers used for PCR. Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT

More information

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated

More information

Drug Use Evaluation: Synagis (palivizumab) Summary of Findings:

Drug Use Evaluation: Synagis (palivizumab) Summary of Findings: Drug Use Research & Management Program Oregon State University, 500 Summer Street NE, E35, Salem, Oregon 97301-1079 Phone 503-945-5220 Fax 503-947-1119 Drug Use Evaluation: Synagis (palivizumab) Summary

More information

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB

More information

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification. RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C

More information

SUPPORTING INFORMATION FILE

SUPPORTING INFORMATION FILE Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of

More information

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information. Construction of Lasso Peptide Fusion Proteins Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

More information

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature11496 Cl. 8 Cl. E93 Rag1 -/- 3H9 + BM Rag1 -/- BM CD CD c-kit c-kit c-kit wt Spleen c-kit B22 B22 IgM IgM IgM Supplementary Figure 1. FACS analysis of single-cell-derived pre-b cell clones.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,

More information

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below). Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very

More information

ORFs and genes. Please sit in row K or forward

ORFs and genes. Please sit in row K or forward ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms

More information

Fig. S1: Nkx2.2 is specifically deleted in the intestinal epithelium.

Fig. S1: Nkx2.2 is specifically deleted in the intestinal epithelium. Fig. S1: Nkx2.2 is specifically deleted in the intestinal epithelium. PCR of representative tissues with oligonucleotides to identify recombination of the Nkx2.2flox allele. Nkx2.2 is specifically deleted

More information

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer

More information

NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples

NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples VERSION 2.0 SUMMARY This procedure describes the use of nested Sequence-Based

More information

Supporting Online Information

Supporting Online Information Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical

More information

Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB

Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse

More information

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

II 0.95 DM2 (RPP1) DM3 (At3g61540) b Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111

More information

S4B fluorescence (AU)

S4B fluorescence (AU) A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000

More information

1.0 Abstract. Palivizumab P Study Results Final

1.0 Abstract. Palivizumab P Study Results Final 1.0 Abstract Title: Prospective, Multi-Center, Observational Program to Assess RSV Hospitalization Rate in Population of Children at High-risk of Serious RSV Illness Who Received Palivizumab Immunoprophylaxis

More information

Lecture 11: Gene Prediction

Lecture 11: Gene Prediction Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are

More information

Gene synthesis by circular assembly amplification

Gene synthesis by circular assembly amplification Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

Respiratory Syncytial Virus Prophylaxis Program Saskatchewan Protocol Season

Respiratory Syncytial Virus Prophylaxis Program Saskatchewan Protocol Season Respiratory Syncytial Virus Prophylaxis Program Saskatchewan Protocol 2018-2019 Season Respiratory Syncytial Virus (RSV) is the most common cause of lower respiratory tract illness and hospitalization

More information

MacBlunt PCR Cloning Kit Manual

MacBlunt PCR Cloning Kit Manual MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were 1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription

More information

Supporting Information

Supporting Information Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT

More information

Lecture 19A. DNA computing

Lecture 19A. DNA computing Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11 11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In

More information

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores. 1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction

More information

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)

SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is

More information

PCR-based Markers and Cut Flower Longevity in Carnation

PCR-based Markers and Cut Flower Longevity in Carnation PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso

More information

Det matematisk-naturvitenskapelige fakultet

Det matematisk-naturvitenskapelige fakultet UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday

More information

Inhibition of Hepatitis C Virus Replication by GS-6620, A Potent C-Nucleoside Monophosphate Prodrug

Inhibition of Hepatitis C Virus Replication by GS-6620, A Potent C-Nucleoside Monophosphate Prodrug Inhibition of Hepatitis C Virus Replication by, A Potent C-Nucleoside Monophosphate Prodrug Running Title: In Vitro Pharmacology of Authors: Joy Y. Feng et al. Supplementary Information Table S1. RNA primer

More information

Drug Utilization Review: Palivizumab (Synagis ; Medimmune)

Drug Utilization Review: Palivizumab (Synagis ; Medimmune) Background Respiratory syncitial virus (RSV) is a highly contagious virus that is estimated to infect nearly all children by 3 years of age, and is the leading cause of serious lower respiratory tract

More information

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

More information

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA

More information

HARVARD PILGRIM HEALTH CARE RECOMMENDED MEDICATION REQUEST GUIDELINES

HARVARD PILGRIM HEALTH CARE RECOMMENDED MEDICATION REQUEST GUIDELINES Generic Brand HICL HCN Exception/Other PALIVIZUMAB SYNAGIS 18564 Synagis may be covered during the RSV season from October 15, 2017 and March 31, 2018. If the PA is received prior to October 15, 2017,

More information

Supplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C.

Supplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C. arbitrary At1g02813 unit expressed protein Relative mrna amount 5.0 4.0 3.0 (X3.7) (X118) (X1.7) 5.6% act At1g06990 GDSL-motif lipase 3.0 (X2.2) /hydrolase (X39) (X1.3) 2.8% act At1g23590 expressed protein

More information

Supplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.

Supplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development. qrt-pcr RT-PCR Relative pri-mir-8 level 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) BR-C E74 mtl rrna Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) Supplementary Figure 1.

More information

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa

More information

Wet Lab Tutorial: Genelet Circuits

Wet Lab Tutorial: Genelet Circuits Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic

More information

-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and

-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and Supplementary Materials Supplementary Figure 1: Myopia induction was performed using uniocular -10 and -15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and results at 2, 4 and

More information

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp

More information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic

More information

Nova Scotia Guidelines for Respiratory Syncytial Virus Infection Prophylaxis ( )

Nova Scotia Guidelines for Respiratory Syncytial Virus Infection Prophylaxis ( ) 5850/5980 University Avenue PO Box 9700 Halifax, NS B3K 6R8 Canada Tel: 902-470-8888 www.iwk.nshealth.ca Oct 14 Nova Scotia Guidelines for Respiratory Syncytial Virus Infection Prophylaxis (2014-2015)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. RNA/DNA sequences used in this study 2. Height and stiffness measurements on hybridized molecules 3. Stiffness maps at varying concentrations of target DNA 4. Stiffness measurements on RNA/DNA hybrids.

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*

More information

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells

More information

Wheeze, Asthma, and Lung Function: Latest Insights on the Long-Term Impact of Severe RSV in Infancy

Wheeze, Asthma, and Lung Function: Latest Insights on the Long-Term Impact of Severe RSV in Infancy Wheeze, Asthma, and Lung Function: Latest Insights on the Long-Term Impact of Severe RSV in Infancy Dr Simoes, thank you for contributing to this Independent Medical Education activity. We invite you to

More information

High-throughput cloning and expression in recalcitrant bacteria

High-throughput cloning and expression in recalcitrant bacteria High-throughput cloning and expression in recalcitrant bacteria Eric R Geertsma & Bert Poolman Supplementary text and figures: Supplementary Figure 1 Frequency of SfiI sites yielding identical 3 extensions

More information

Supplementary Information

Supplementary Information Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials

More information

Supporting Information

Supporting Information Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting

More information

Evaluation of DNA/RNA Protect Swabs with Shigella Sonnei Spiked Stool Samples Eija Hyytia-Trees, D.V.M. Ph.D.

Evaluation of DNA/RNA Protect Swabs with Shigella Sonnei Spiked Stool Samples Eija Hyytia-Trees, D.V.M. Ph.D. Evaluation of DNA/RNA Protect Swabs with Shigella Sonnei Spiked Stool Samples Eija Hyytia-Trees, D.V.M. Ph.D. Foodborne and Diarrheal Diseases Branch Centers for Disease Control and Prevention Atlanta,

More information

Dynamic enhancer-gene body contacts during transcription elongation

Dynamic enhancer-gene body contacts during transcription elongation Dynamic enhancer-gene body contacts during transcription elongation Kiwon Lee, Chris C.-S. Hsiung,, Peng Huang, Arjun Raj, *, and Gerd A. Blobel Division of Hematology, The Children s Hospital of Philadelphia,

More information

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko

More information

Respiratory Syncytial Virus (RSV) Just another virus or not? Doris Makari, MD Senior Director, Scientific Affairs Nov 16th, 2012

Respiratory Syncytial Virus (RSV) Just another virus or not? Doris Makari, MD Senior Director, Scientific Affairs Nov 16th, 2012 Respiratory Syncytial Virus (RSV) Just another virus or not? Doris Makari, MD Senior Director, Scientific Affairs Nov 16th, 2012 Key Points RSV is not just another virus to infants RSV is the leading cause

More information

for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides

for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis

More information

Clinical Policy: Palivizumab (Synagis) Reference Number: ERX.SPA.124 Effective Date: Last Review Date: 08.17

Clinical Policy: Palivizumab (Synagis) Reference Number: ERX.SPA.124 Effective Date: Last Review Date: 08.17 Clinical Policy: (Synagis) Reference Number: ERX.SPA.124 Effective Date: 10.01.16 Last Review Date: 08.17 Revision Log See Important Reminder at the end of this policy for important regulatory and legal

More information

2

2 1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene

More information

Supplemental Data. Jones et al. Plant Cell. (2010) /tpc

Supplemental Data. Jones et al. Plant Cell. (2010) /tpc IAA synthesis rate Supplemental Data. Jones et al. Plant Cell. ()..5/tpc..7856 Supplemental Figure. Root tip specific IAA biosynthesis after induction of the CKX gene. 6 DAG pmdc7:atckx seedling roots

More information

Supplementary Information

Supplementary Information Supplementary Information Microbead-based biomimetic synthetic neighbors enhance survival and function of rat pancreatic β-cells Wei Li, a Samuel Lee, b Minglin Ma, a, f Soo Min Kim, b Patrick Guye, c

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Xie YL, Chakravorty S, Armstrong DT, et al. Evaluation of a

More information

Annex 6.2 CDC real-time measles RT-PCR protocol targeting measles N gene (75 nt region)

Annex 6.2 CDC real-time measles RT-PCR protocol targeting measles N gene (75 nt region) Annex 6.2 CDC real-time measles RT-PCR protocol targeting measles N gene (75 nt region) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to develop

More information

Lewis x/cd15 expression in human myeloid cell differentiation. is regulated by sialidase activity

Lewis x/cd15 expression in human myeloid cell differentiation. is regulated by sialidase activity Lewis x/cd15 expression in human myeloid cell differentiation is regulated by sialidase activity Samah Zeineb Gadhoum 1, 2 and Robert Sackstein* 1, 2, 3, 4 From the Departments of Dermatology 1 and Medicine

More information

General protocol for the quantification of adenovirus by real-time PCR

General protocol for the quantification of adenovirus by real-time PCR Page 1 of 5 EU FP VII PROJECT VITAL STANDARD OPERATING General protocol for the quantification of CREATED: REVISED: APPROVED: David Rodríguez Lázaro: 10/02/2010 FERA: 28/03/2010 Wim Van der Poel: 31/03/2010

More information

A netlike rolling circle nucleic acid amplification technique

A netlike rolling circle nucleic acid amplification technique Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2014 Supplementary Information A netlike rolling circle nucleic acid amplification technique Xiaoli Zhu,

More information