Modeling cell fate specification during early embryonic development in mouse

Size: px
Start display at page:

Download "Modeling cell fate specification during early embryonic development in mouse"

Transcription

1 Université Libre de Bruxelles Modeling cell fate specification during early embryonic development in mouse Didier Gonze Unité de Chronobiologie Théorique Faculté des Sciences Université Libre de Bruxelles Lille, 15 November 2016 Workshop "Systems Biology: modeling and formal analysis in Biology"

2 Embryonic development Zygote Cell division Distinct cell types

3 Embryonic development

4 "Differentiation tree" Early embryonic development Zhou and Huang, 2011

5 Pre-implentation embryogenesis in the mouse E = Embryonic day Chazaud, 2008

6 Stem cells and Epiblast ES Organism itself Extra-embryonic tissues (yolk sac, placenta) Hemberger et al., 2009 Embryonic stem cells (ES) are pluripotent cells derived from the early embryo (epiblast). Meregalli et al., 2011

7 Transcription factors Cell fate choice is controled by genetic regulatory networks (involving key transcription factors) and by epigenetic regulation markers of pluripotent ICM cells markers of trophectoderm Burton, Torres-Padilla (2014) Nature Reviews Molecular Cell Biology 15:

8 Binary cell fate and bistability Cross-inhibition between 2 transcription factors can account for binary cell fate choice Zhou & Huang, Trends Genet 2011

9 Binary cell fate and bistability Cross-inhibition between 2 transcription factors can account for binary cell fate choice Toggle switch (Gardner et al., 2000)

10 Nanog and Gata6 Nanog and Gata6 are the transcription factors that characterize the Epi and PrE fate, respectively Epiblastic cells : high level of the Nanog transcription factor Primitive endoderm cells: high level of the Gata6 transcription factor In Nanog -/- mutants, all cells adopt the PrE fate In Gata6 -/- mutants, all cells adopt the Epi fate Nanog Epi Gata6 PrE Guo et al., 2010

11 Nanog and Gata6 Guo et al., 2010 Gata6 and Nanog are co-expressed at increasing levels in the ICM before EPI/PrE differentiation à How? How does differentiation occur afterwards? mathematical modelling

12 Self-activations and tristability Nanog and Gata6 undergo self-activations. Cross-inhibition and auto-activation give rise to tristability. N (Nanog) G (Gata6) 2.5 Epi Nullclines Epi Trajectories 2 ICM Nanog ICM Gata6 PrE PrE See also Zhou and Huang, 2011

13 Role of FGF-ERK signalling ERK/Fgf4 signalling plays a key role in cell fate specification No ERK à no Gata6 à no PrE Over-activated ERK à all Gata6 à all PrE Fgf4 In presence of high level of Fgf4, no EPI cells are produced. (100% of the embryos do not contain Epi cells) Yamanaka et al., 2010 Frankenberg et al., 2013

14 Incorporation of FGF-ERK in the model ERK signalling interacts with the gene regulatory network G (Gata6) N (Nanog) FR (FgfR2 total) ERK (ERK actif/erk total) Fp (Fgf4)

15 Equations of the model 4 variables: G = concentration of Gata6 N = concentration of Nanog FR = concentration of Fgf4 receptor ERK = activity of the ERK pathway Key parameter: Fp = concentration of Fgf4 dg dt =! vsg1 ERK r Kag1 r + ERK + vsg2 G s $ Kig q # & " r Kag2 s + G s % Kig q + N kdg G q dn dt =! vsn1 Kin1 u Kin1 u + ERK + vsn2 N v $ # " u Kan v + N v Kin2 w & % Kin2 w + G kdn N w dfr dt = vsfr1 Kifr Kifr + N + vsfr2 G Kafr + G kdfr FR derk dt = va FR Fp Kd + Fp 1 ERK Ka +1 ERK vin ERK Ki + ERK

16 Tristability Fgf4 is the key parameter governing tristability in the core regulatory network

17 Dynamics and mechanism of specification Fgf4 secretion profile in vivo Fgf4 is high when Nanog and Gata6 start to be expressed Fgf4 decreases until the establishment of the ICM cell fate Fgf4 is not expressed by PrE cells Fgf4 is highly expressed by Epi cells Guo et al., 2010

18 Dynamics and mechanism of specification Dynamics of the system => cell-cell interactions Nanog activates the synthesis and secretion of Fgf4 in the extracellular medium FGFR2 In turn extracellular Fgf4 binds Fgf4 receptors (FgfR2) of neighbouring cells, which activate ERK signalling, leading to an increase of Gata6 and an inhibition of Nanog transcription Frankenberg et al., Dev Cell 2011

19 Dynamics and mechanism of specification G# (Gata6#)## N# (Nanog)## Incorporation of Fgf4 secretion in the model FR## (FgfR2)## Fp#(Fgf4)# FGF4 secretion ERK## (ac-ve#erk#/#total#erk)## dg dt =! vsg1 ERK r Kag1 r + ERK + vsg2 G s $ Kig q # & " r Kag2 s + G s % Kig q + N kdg G q dn dt =! vsn1 Kin1 u Kin1 u + ERK + vsn2 N v $ # " u Kan v + N v Kin2 w & % Kin2 w + G kdn N w dfr dt = vsfr1 Kifr Kifr + N + vsfr2 G kdfr FR Kafr + G derk dt = va FR Fp Kd + Fp 1 ERK Ka +1 ERK vin ERK Ki + ERK

20 Dynamics and mechanism of specification Average FGF4 concentration depends on the 2 cells Heterogeneous FGF4 distribution (=> parameter γ)

21 Dynamics and mechanism of specification Cell 1 Both cells initially co-express Nanog and Gata6 In a second phase, Cell 1 differentiates into Epi Cell 2 differentiates into PrE Cell 2

22 Mechanism of specification in a "toy" 2-cell model (1) Fgf4 concentration is initially in the domain of tristability (initial conditions). Gata6 and Nanog are very low in both cells. EPI PrE ICM ICM PrE EPI

23 Mechanism of specification in a "toy" 2-cell model (2) Fgf4 concentration decreases due to its degradation in the extracellular medium. Both cells tends to the intermediary ICM state EPI Fgf4 Fgf4 PrE ICM ICM PrE EPI

24 Mechanism of specification in a "toy" 2-cell model (3) The cell that perceives slightly less Fgf4 jumps to the Epi state and starts to secrete large amounts of Fgf4 (high Nanog). Fgf4 thus increases. EPI Fgf4 Fgf4 PrE ICM ICM PrE EPI

25 Mechanism of specification in a "toy" 2-cell model (4) At high Fgf4 concentration the second cell jumps to the PrE state. EPI Fgf4 Fgf4 PrE ICM ICM PrE EPI

26 Spatial organisation salt & pepper pattern After a transient increase of both Nanog & Gata6, they tend to be mutually exclusive. High-Nanog cells (Epi) and high- Gata6 cells (PrE) first appear to be well mixed (salt & pepper pattern, see stages E3.5-E4). In a sebsequent step (E4.5), a sorting process takes place: Epi cells move to the border, close to the cavity, whereas PrE cells rather concentrate in the inside of the embryo.

27 Model of a population of 25 cells - salt & pepper pattern

28 Model of a population of 25 cells - salt & pepper pattern

29 Model of a population of 25 cells - salt & pepper pattern t=0 t=26 t=35 t=50

30 Model of a population of 25 cells - prediction (1) Prediction: earlier specification of Epiblastic cells Model prediction: Average time for specification: Experiments: At the 32-cell stage Epi cells : 18 (arbitrary time units) PrE cells: 28 (arbitrary time units) Epi cells are specified a bit earlier than PrE cells. ICM EPI PrE

31 Model of a population of 25 cells - prediction (2) Prediction: Gata6 +/- heterozygous mutant Experiments: Model: EPI PrE Assumption : the level of Gata6 expression is reduced by 30% in the Gata6 +/- mutant

32 Model of a population of 25 cells - mutant Nanog -/- In Nanog -/- mutant, ERK inhibitor impacts the expression of Gata6 (D-D'') Cell composition of embryos after different timing of ERK inhibitor treatment. When ERK inhibitor is administrated early, Gata6 does not accumulate (D, D'). When ERK inhibitor is administrated late, Gata6 accumulates (D''). Frankenberg et al, Dev Cell 2011

33 Model of a population of 25 cells - mutant Nanog -/- Statistics on the 25-cell model Bifurcation analysis on the singlecell model

34 Effect of interfering with the Fgf/ERK signalling pathway Epi ICM PrE va=0 simulates the treatment with Fgf/Erk inhibitors vex=0.12 simulates the addition of exogenous Fgf4

35 Possible origin of randomness Key assumption in our model: Local extracellular concentration of Fgf4 is subject to noise (γ) The salt-and-pepper pattern can indeed not be rescued by the addition of exogenous (hence homogenous) Fgf4 in Fgf4 -/- embryos Kang et al., 2013 Other possible sources of heterogeneity: molecular noise (intrinsic variability) cell division (unequal partition of the molecules into the daughter cells, variability in the cell division time, spatial reorganization, etc)

36 Internal fluctuations as an alternative source of randomness? Simulation of the model in presence of molecular fluctuations (Gillespie)

37 Internal fluctuations as an alternative source of randomness? Heterogeneity in extracellular Fgf4 Internal fluctuations

38 Towards a 3D, multi-scale model...

39 Towards a 3D, multi-scale model...

40 Towards a 3D, multi-scale model... Effect of cell division Influence of period of division (τ) Too short period leads to an undeveloped embryo Influence of noise on individual cell division (δ) No influence Influence of noise on the extracellular Fgf4 (γ) A certain amount of noise (heterogeneity) is necessary for the appearance of the salt and pepper pattern Influence of noise on concentrations at division (η) Noise can substitute (or combine with) the Fgf4 heterogeneities

41 Conclusions New specification mechanism, based on self-modulated tristability. The model accounts for observations on the Wild-Type and on mutant embryos, in normal conditions and when the embryos are treated with substances interfering with the Fgf/Erk pathway. The model leads to testable predictions (earlier specification of Epiblastic Cells, Gata6 +/- mutants). The model suggests that the existence of heterogeneities in extracellular Fgf4 signalling is the most probable source of randomness responsible for the salt-and-pepper pattern. The model is currently extended to include cell division and the 3D dynamics. Bessonnard et al. (2014) Development 141: De Mot et al. (2016) Biophys. J 110:

42 Acknowledgments Unité de Chronobiologie Théorique, ULB Laurane De Mot Alen Tosenberger Geneviève Dupont Albert Goldbeter Financial support Claire Chazaud GReD Clermont-Ferrand Sylvain Bessonnard Institut Pasteur Paris Michel Cohen-Tannoudji Institut Pasteur Paris

43 Appendix

44 Huang model Nanog (X) Gata6 (Y)

45 Network architecture

Heterogeneities in Nanog Expression Drive Stable Commitment to Pluripotency in the Mouse Blastocyst

Heterogeneities in Nanog Expression Drive Stable Commitment to Pluripotency in the Mouse Blastocyst Article Heterogeneities in Nanog Expression Drive Stable Commitment to Pluripotency in the Mouse Blastocyst Graphical Abstract Authors Panagiotis Xenopoulos, Minjung Kang,..., Stefano Di Talia, Anna-Katerina

More information

FGF4 is required for lineage restriction and salt-and-pepper distribution of primitive endoderm factors but not their initial expression in the mouse

FGF4 is required for lineage restriction and salt-and-pepper distribution of primitive endoderm factors but not their initial expression in the mouse AND STEM CELLS 267 Development 140, 267-279 (2013) doi:10.1242/dev.084996 2013. Published by The Company of Biologists Ltd FGF4 is required for lineage restriction and salt-and-pepper distribution of primitive

More information

Computational Models for Cell Reprogramming

Computational Models for Cell Reprogramming Computational Models for Cell Reprogramming Computational Models for Cell Reprogramming 1 Pluripotent Cells EuroStemCell web page Computational Models for Cell Reprogramming 2 Early Embryonic Development

More information

Synthetic Biology and Rational Design Keith Shearwin University of Adelaide

Synthetic Biology and Rational Design Keith Shearwin University of Adelaide Synthetic Biology and Rational Design Keith Shearwin University of Adelaide Synthetic biology what is it? Analogy with engineering Learning by building: natural and synthetic gene circuits 1 (1) (2) 2

More information

A Survey of Genetic Methods

A Survey of Genetic Methods IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA

More information

Mechanisms of embryonic stem cell division and differentiation

Mechanisms of embryonic stem cell division and differentiation Mechanisms of embryonic stem cell division and differentiation Josephine Wbite.'.... Department of Molecular Biosciences (Biochemistry) The University of Adelaide Adelaide, South Australia Submitted for

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Design Principles in Synthetic Biology

Design Principles in Synthetic Biology Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University

More information

1.2 Geometry of a simplified two dimensional model molecule Discrete flow of empty space illustrated for two dimensional disks.

1.2 Geometry of a simplified two dimensional model molecule Discrete flow of empty space illustrated for two dimensional disks. 1.1 Geometric models of protein surfaces. 3 1.2 Geometry of a simplified two dimensional model molecule. 5 1.3 The family of alpha shapes or dual simplicial complexes for a two-dimensional toy molecule.

More information

Concepts and Methods in Developmental Biology

Concepts and Methods in Developmental Biology Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation

More information

(Manuscript submitted to Nature Struct. Mol. Biol but rejected)

(Manuscript submitted to Nature Struct. Mol. Biol but rejected) DENKER, H.-W.: Totipotency of stem cells: Plasticity vs. self-organization capacity Comment on: ISHIUCHI, T., ENRIQUEZ-GASCA, R., MIZUTANI, E., BOSKOVIC, A., ZIEGLER- BIRLING, C., RODRIGUEZ-TERRONES, D.,

More information

The bimodally expressed microrna mir-142 gates exit from pluripotency

The bimodally expressed microrna mir-142 gates exit from pluripotency The bimodally expressed microrna mir-142 gates exit from pluripotency Hanna L. Sladitschek and Pierre A. Neveu Corresponding author: Pierre A. Neveu, European Molecular Biology Laboratory Review timeline:

More information

Stem Cel s Key Words:

Stem Cel s Key Words: Stem Cells Key Words: Embryonic stem cells, Adult stem cells, ips cells, self-renewal, differentiation, pluripotent, multipotent, Inner cell mass, Nuclear transfer (Therapeutic cloning), Feeder cells,

More information

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

More information

4 th Exam is Thursday, December 9. Review session will be at 5:00 PM Wednesday, December 8

4 th Exam is Thursday, December 9. Review session will be at 5:00 PM Wednesday, December 8 4 th Exam is Thursday, December 9 Review session will be at 5:00 PM Wednesday, December 8 Final Exam Final exam will be Dec. 16, 8:00-10:00 AM Yellow Sheets: You will be allowed to put whatever you want

More information

7.22 Example Problems for Exam 1 The exam will be of this format. It will consist of 2-3 sets scenarios.

7.22 Example Problems for Exam 1 The exam will be of this format. It will consist of 2-3 sets scenarios. Massachusetts Institute of Technology Department of Biology 7.22, Fall 2005 - Developmental Biology Instructors: Professor Hazel Sive, Professor Martha Constantine-Paton 1 of 10 7.22 Fall 2005 sample exam

More information

Embryonic Stem Cell Differentiation and Morphogenesis

Embryonic Stem Cell Differentiation and Morphogenesis University of Miami Scholarly Repository Open Access Dissertations Electronic Theses and Dissertations 2017-06-28 Embryonic Stem Cell Differentiation and Morphogenesis Yue Meng University of Miami, mengyue07448@gmail.com

More information

Job Description Postdoctoral Research Scientist (PRG-PD-BB) Length of appointment Three years in the first instance

Job Description Postdoctoral Research Scientist (PRG-PD-BB) Length of appointment Three years in the first instance Job Description Postdoctoral Research Scientist (PRG-PD-BB) Department Epigenetics Grade BI 6 Salary range 30,751 to 34,166 per annum Length of appointment Three years in the first instance Location Babraham

More information

PhysicsAndMathsTutor.com. Question Number. Answer Additional guidance Mark. 1(a) 1. reference to stem cells being {totipotent / pluripotent} ;

PhysicsAndMathsTutor.com. Question Number. Answer Additional guidance Mark. 1(a) 1. reference to stem cells being {totipotent / pluripotent} ; 1(a) 1. reference to stem cells being {totipotent / pluripotent} ; 2. can specialise or differentiate / can give rise to {differentiated / specialised} cells ; 3. idea that these can replace damaged cells

More information

Job Description Postdoctoral Research Scientist

Job Description Postdoctoral Research Scientist Job Description Postdoctoral Research Scientist Department Epigenetics Grade BI 6 Salary range 30,751 to 34,166 per annum Length of appointment Up to 18 months Location Babraham Institute Working Hours

More information

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals: TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene

More information

Solution Key Problem Set

Solution Key Problem Set Solution Key- 7.013 Problem Set 5-2013 Question 1 During a summer hike you suddenly spot a huge grizzly bear. This emergency situation triggers a fight or flight response through a signaling pathway as

More information

GENE EXPRESSSION. Promoter sequence where RNA polymerase binds. Operator sequence that acts as a switch (yellow) OPERON

GENE EXPRESSSION. Promoter sequence where RNA polymerase binds. Operator sequence that acts as a switch (yellow) OPERON GENE EXPRESSSION 1 GENE REGULATION IN PROKARYOTES Bacteria can turn genes on or off depending on their environment Prokaryotes have operons clusters of related genes and regulatory sequences Promoter sequence

More information

Assuring Pluripotency of ESC and ipsc Lines

Assuring Pluripotency of ESC and ipsc Lines Assuring Pluripotency of ESC and ipsc Lines Introduction Compared to other cell types, stem cells have the unique ability to self-renew their populations by dividing into identical daughter stem cells

More information

Modeling Periodic Aspect of Limb Pattern Formation

Modeling Periodic Aspect of Limb Pattern Formation Forum Forma, 27, S33 S37, 2012 Takashi Miura Department of Anatomy and Developmental Biology, Kyoto University Graduate School of Medicine, Yoshida Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan E-mail address:

More information

CHAPTER 21 GENOMES AND THEIR EVOLUTION

CHAPTER 21 GENOMES AND THEIR EVOLUTION GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of

More information

Interplay Between Intracellular Ca 2+ Oscillations and Ca 2+ -stimulated Mitochondrial Metabolism

Interplay Between Intracellular Ca 2+ Oscillations and Ca 2+ -stimulated Mitochondrial Metabolism Interplay Between Intracellular Ca 2+ Oscillations and Ca 2+ -stimulated Mitochondrial Metabolism Benjamin Wacquier 1, Laurent Combettes 2,3, Guy Tran Van Nhieu 4,5,6,7, and Geneviève Dupont 1,* 1 Unité

More information

A systems approach to biology

A systems approach to biology A systems approach to biology SB200 Lecture 2 18 September 2008 Jeremy Gunawardena jeremy@hms.harvard.edu I do not hold formal office hours. Please send me an e-mail if you have questions or would like

More information

Models of Tet-On System with Epigenetic Effects

Models of Tet-On System with Epigenetic Effects Models of Tet-On System with Epigenetic Effects Russ Harmer, Jean Krivine, Élise Laruelle, Cédric Lhoussaine, Guillaume Madelaine, Mirabelle Nebut To cite this version: Russ Harmer, Jean Krivine, Élise

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

Supplementary Data. Supplementary Table S1.

Supplementary Data. Supplementary Table S1. Supplementary Data Supplementary Table S1. Primer Sequences for Real-Time Reverse Transcription-Polymerase Chain Reaction Gene Forward 5?3 Reverse 3?5 Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA

More information

Long non-coding RNAs and Autophagy in Embryonic stem cells. Lei Han

Long non-coding RNAs and Autophagy in Embryonic stem cells. Lei Han Long non-coding RNAs and Autophagy in Embryonic stem cells Lei Han 2011-12-21 Contents Embryonic Stem Cells (ESCs) Long non-coding RNA in ESCs and paper Autophagy in ESCs and paper Embryonic Stem Cells

More information

Single-Cell Profiling of Epigenetic Modifiers Identifies PRDM14 as an Inducer of Cell Fate in the Mammalian Embryo

Single-Cell Profiling of Epigenetic Modifiers Identifies PRDM14 as an Inducer of Cell Fate in the Mammalian Embryo Cell Reports Article Single-Cell Profiling of Epigenetic Modifiers Identifies PRDM14 as an Inducer of Cell Fate in the Mammalian Embryo Adam Burton, 1,6 Julius Muller, 2,6 Shengjiang Tu, 4 Pablo Padilla-Longoria,

More information

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4

More information

V8: Modelling the switching of cell fate

V8: Modelling the switching of cell fate V8: Modelling the switching of cell fate Aim : develop models for the architecture of coupled epigenetic and genetic networks which describe large changes in cellular identity (e.g., induction of pluripotency

More information

Extrinsic regulation of pluripotent stem cells Martin F. Pera 1 & Patrick P. L. Tam 2,3

Extrinsic regulation of pluripotent stem cells Martin F. Pera 1 & Patrick P. L. Tam 2,3 NATURE Vol 465 10 June 2010 doi:10.1038/nature09228 REVIEW INSIGHT Extrinsic regulation of pluripotent stem s Martin F. Pera 1 & Patrick P. L. Tam 2,3 During early mammalian development, as the pluripotent

More information

Overview. Introduction. Biological model. Physical and Chemical properties of our glue. Mathematical modeling. Conclusions

Overview. Introduction. Biological model. Physical and Chemical properties of our glue. Mathematical modeling. Conclusions Overview Introduction Biological model Physical and Chemical properties of our glue Mathematical modeling Conclusions Introduction Model : Caulobacter crescentus GRAM Motile or sessile cell Sessile stage

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTRY INFORMTION DOI:.38/ncb Kdmb locus kb Long isoform Short isoform Long isoform Jmj XX PHD F-box LRR Short isoform XX PHD F-box LRR Target Vector 3xFlag Left H Neo Right H TK LoxP LoxP Kdmb Locus

More information

Molecular Medicine. Stem cell therapy Gene therapy. Immunotherapy Other therapies Vaccines. Medical genomics

Molecular Medicine. Stem cell therapy Gene therapy. Immunotherapy Other therapies Vaccines. Medical genomics Molecular Medicine Molecular Medicine Stem cell therapy Gene therapy Tumor therapy Immunotherapy Other therapies Vaccines Genetic diagnostics Medical genomics Medication Diagnostics medicine: old desire

More information

The many faces of Pluripotency: in vitro adaptations of a continuum of in vivo states

The many faces of Pluripotency: in vitro adaptations of a continuum of in vivo states Morgani et al. BMC Developmental Biology (2017) 17:7 DOI 10.1186/s12861-017-0150-4 REVIEW The many faces of Pluripotency: in vitro adaptations of a continuum of in vivo states Sophie Morgani 1,2, Jennifer

More information

Expanded View Figures

Expanded View Figures yako Yachie-Kinoshita et al Predictive control of pluripotency Molecular Systems iology Expanded View Figures Figure EV1. General strategy of the simulation. The properties of synchronous (i) and asynchronous

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

Cellular Reprogramming and Controllability of Complex Systems

Cellular Reprogramming and Controllability of Complex Systems Cellular Reprogramming and Controllability of Complex Systems University of Maryland and ISR April 25, 2016 Roger Brockett John A. Paulson School of Engineering and Applied Science Harvard University 1

More information

Mesoderm Formation. Fate map of early gastrula. Only two types of mesoderm are induced. Mesoderm induction by the vegetal hemisphere

Mesoderm Formation. Fate map of early gastrula. Only two types of mesoderm are induced. Mesoderm induction by the vegetal hemisphere Fate map of early gastrula Mesoderm Formation Animal hemisphere forms ectoderm (lacks ) Sperm Entry Point dbl dbl brachyury Vegetal hemisphere forms endoderm (requires ) dbl goosecoid Marginal zone forms

More information

V4: cellular reprogramming

V4: cellular reprogramming V4: cellular reprogramming Embryonic development Stem cells Differentiation ips cells Oct4 Paper4 Model of a human cell, Spiegel Online 3D-Model of the human genome, Spiegel Online Some human cells Astrocyte

More information

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals: Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated

More information

Supplementary Information. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote

Supplementary Information. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote Supplementary Information Supplementary Figures S1 to S5 and Tables S1 to S3. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote Aurélien Raveux, Sandrine

More information

Fundamental properties of Stem Cells

Fundamental properties of Stem Cells Stem cells Learning Goals: Define what a stem cell is and describe its general properties, using hematopoietic stem cells as an example. Describe to a non-scientist the current progress of human stem cell

More information

Modelling and Analysis in Bioinformatics: Simulating dynamical network models

Modelling and Analysis in Bioinformatics: Simulating dynamical network models Modelling and Analysis in Bioinformatics: Simulating dynamical network models Antti Honkela 4 October 2016 Local overview of the course Past two weeks: abstract networks Upcoming two weeks: simulating

More information

A Simple Approach to Study Designs in Complex Biochemical Pathways

A Simple Approach to Study Designs in Complex Biochemical Pathways Symposium on Complexity & Computation in the Natural Sciences A Simple Approach to Study Designs in Complex Biochemical Pathways SOMDATTA SINHA Centre for Cellular and Molecular Biology (CSIR) Hyderabad

More information

+ + Development and Evolution Dorsoventral axis. Developmental Readout. Foundations. Stem cells. Organ formation.

+ + Development and Evolution Dorsoventral axis. Developmental Readout. Foundations. Stem cells. Organ formation. Development and Evolution 7.72 9.11.06 Dorsoventral axis Human issues Organ formation Stem cells Developmental Readout Axes Growth control Axon guidance 3D structure Analysis Model + + organisms Foundations

More information

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons)

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons) Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics BIT 220 End of Chapter 22 (Snustad/Simmons) Nucleic Acids as Therapeutic Agents Many diseases (cancer, inflammatory diseases) from

More information

Developmental Biology 3230 Exam 1 (Feb. 6) NAME

Developmental Biology 3230 Exam 1 (Feb. 6) NAME DevelopmentalBiology3230Exam1(Feb.6)NAME 1. (10pts) What is a Fate Map? How would you experimentally acquire the data to draw a Fate Map? Explain what a Fate Map does and does not tell you about the mechanisms

More information

1. 40 points Retinoic acid (structure below) is a small hydrophobic molecule that is derived from vitamin A. Figure by MIT OCW.

1. 40 points Retinoic acid (structure below) is a small hydrophobic molecule that is derived from vitamin A. Figure by MIT OCW. Massachusetts Institute of Technology Department of Biology 7.22, Fall 2005 - Developmental Biology Instructors: Professor Hazel Sive, Professor Martha Constantine-Paton 1 of 9 7.22 Fall 2005 exam 2 practice

More information

Embryonic development, epigenics and somatic cell nuclear transfer - The science and its social implications -

Embryonic development, epigenics and somatic cell nuclear transfer - The science and its social implications - Embryonic development, epigenics and somatic cell nuclear transfer - The science and its social implications - Moshe Yaniv Unité d Expression Génétique et Maladies, Institut Pasteur, Paris, France September

More information

The role of FGF/Erk signaling in pluripotent cells

The role of FGF/Erk signaling in pluripotent cells REVIEW 3351 Development 137, 3351-3360 (2010) doi:10.1242/dev.050146 2010. Published by The Company of Biologists Ltd The role of FGF/Erk signaling in pluripotent cells Fredrik Lanner 1 and Janet Rossant

More information

Understanding embryonic head development. ANAT2341 Tennille Sibbritt Embryology Unit Children s Medical Research Institute

Understanding embryonic head development. ANAT2341 Tennille Sibbritt Embryology Unit Children s Medical Research Institute Understanding embryonic head development ANAT2341 Tennille Sibbritt Embryology Unit Children s Medical Research Institute Head malformations among the most common category of congenital malformations in

More information

Activity 47.1 What common events occur in the early development of animals? 1. What key events occur at each stage of development?

Activity 47.1 What common events occur in the early development of animals? 1. What key events occur at each stage of development? Notes to Instructors Chapter 47 Animal Development What is the focus of this activity? Chapter 21 provided a review of how genes act to control development. Chapter 47 reviews some of the major morphological

More information

Transgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission

Transgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission Transgenic Mice Transgenesis Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission integrates into all cells including sperm or egg Knockin mice DNA

More information

Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan. 1 day. 1 P age

Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan. 1 day. 1 P age 1 P age Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan 1 day 2 P age Introduction In this single module students will build upon their previous knowledge of basic molecular

More information

Modeling and Simulation with Hybrid Functional Petri Nets of the Role of Interleukin-6 in Human Early Haematopoiesis

Modeling and Simulation with Hybrid Functional Petri Nets of the Role of Interleukin-6 in Human Early Haematopoiesis Modeling and Simulation with Hybrid Functional Petri Nets of the Role of Interleukin-6 in Human Early Haematopoiesis Sylvie Troncale, Fariza Tahi, David Campard, Jean-Pierre Vannier, and Janine Guespin

More information

Retinoic acid orchestrates fibroblast growth factor signalling to drive embryonic stem cell differentiation

Retinoic acid orchestrates fibroblast growth factor signalling to drive embryonic stem cell differentiation AND STEM CELLS RESEARCH ARTICLE 881 Development 137, 881-890 (2010) doi:10.1242/dev.043117 2010. Published by The Company of Biologists Ltd Retinoic acid orchestrates fibroblast growth factor signalling

More information

Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development

Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development The only way to get from genotype to phenotype is through developmental processes. - Remember the analogy that the zygote contains

More information

Genetic Basis of Development & Biotechnologies

Genetic Basis of Development & Biotechnologies Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

AQA Biology A-level Topic 8: The control of gene expression

AQA Biology A-level Topic 8: The control of gene expression AQA Biology A-level Topic 8: The control of gene expression Notes Mutations Mutations are changes in the sequence of nucleotides in DNA molecules. Types of mutations include: Insertion/deletion mutations

More information

ERK and GSK3 Signaling Pathway in cipsc

ERK and GSK3 Signaling Pathway in cipsc ERK and GSK3 Signaling Pathway in cipsc (Experiment Designs & Results) Yangqing Lu, 2/21/2012 1 Background In naïve state ESC, MEK/ERK signaling pathway is dispensable for maintenance of the pluripotence

More information

Physiology Unit 3 HEMATOLOGY

Physiology Unit 3 HEMATOLOGY Physiology Unit 3 HEMATOLOGY In Physiology Today Hematocrit Percentage of blood volume that is erythrocytes 45% in men 42% in women Average blood volume in is 5 L Plasma Large amounts of organic/inorganic

More information

Direct Reprogramming of Fibroblasts into Cardiomyocytes

Direct Reprogramming of Fibroblasts into Cardiomyocytes Direct Reprogramming of Fibroblasts into Cardiomyocytes G. Hasenfuss No conflict Heart Center Heart Research Center Göttingen Georg-August-University Göttingen Cardiac Regeneration Options in 5/2011 Stem

More information

Supplemental Information

Supplemental Information Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

More information

Epigenetics, Environment and Human Health

Epigenetics, Environment and Human Health Epigenetics, Environment and Human Health A. Karim Ahmed National Council for Science and the Environment Washington, DC May, 2015 Epigenetics A New Biological Paradigm A Question about Cells: All cells

More information

Human Molecular Genetics Assignment 3 (Week 3)

Human Molecular Genetics Assignment 3 (Week 3) Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein

More information

Graded Nodal/Activin Signaling Titrates Conversion of Quantitative Phospho-Smad2 Levels into Qualitative Embryonic Stem Cell Fate Decisions

Graded Nodal/Activin Signaling Titrates Conversion of Quantitative Phospho-Smad2 Levels into Qualitative Embryonic Stem Cell Fate Decisions Graded Nodal/Activin Signaling Titrates Conversion of Quantitative Phospho-Smad2 Levels into Qualitative Embryonic Stem Cell Fate Decisions Kian Leong Lee 1,2 *., Sandy Keat Lim 2,3,4., Yuriy Lvovich Orlov

More information

ANAT2341 Embryology Introduction: Steve Palmer

ANAT2341 Embryology Introduction: Steve Palmer ANAT2341 Embryology Introduction: Steve Palmer Course overview Course lecturers specializations and roles Steve Palmer 9385 2957 Course overview Summary, aims and expected outcomes Course overview Graduate

More information

Polaris and Callisto: Advances in Cellular Biology. Jordan Moore Senior Field Applications Specialist

Polaris and Callisto: Advances in Cellular Biology. Jordan Moore Senior Field Applications Specialist Polaris and Callisto: Advances in Cellular Biology Jordan Moore Senior Field Applications Specialist Single-Cell Biology Number of cells The population average is a lie average Transcripts per cell Gene

More information

I.New Explanations of Inheritance A. Understanding Gene Function 1. Prokaryote gene regulation a. genes that code for enzymes

I.New Explanations of Inheritance A. Understanding Gene Function 1. Prokaryote gene regulation a. genes that code for enzymes I.New Explanations of Inheritance A. Understanding Gene Function 1. Prokaryote gene regulation a. genes that code for enzymes using lactose are expressed only when lactose is present b. Expression of this

More information

Biochemistry 111. Carl Parker x A Braun

Biochemistry 111. Carl Parker x A Braun Biochemistry 111 Carl Parker x6368 101A Braun csp@caltech.edu Central Dogma of Molecular Biology DNA-Dependent RNA Polymerase Requires a DNA Template Synthesizes RNA in a 5 to 3 direction Requires ribonucleoside

More information

Lecture 20: Drosophila melanogaster

Lecture 20: Drosophila melanogaster Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3

More information

A critical review of single-cell RNA sequencing-based genetic profiling for human embryos

A critical review of single-cell RNA sequencing-based genetic profiling for human embryos A critical review of single-cell RNA sequencing-based genetic profiling for human embryos Motivation Embryonic development is a highly complex process that requires precise spatial and temporal regulations.

More information

Cell and Developmental Biology

Cell and Developmental Biology ITMO Cell biology, development and evolution CEA ARIIS CNRS CHRU CIRAD EFS CPU INRIA INSERM FONDATION MERIEUX INERIS INRA INSTITUT PASTEUR INSTITUT CURIE IRD INSTITUT MINES-TELECOM IRBA IRSN UNICANCER

More information

Cell sorting, cell tension and morphogenesis. Morphogenesis: Big Questions

Cell sorting, cell tension and morphogenesis. Morphogenesis: Big Questions Cell sorting, cell tension and morphogenesis Morphogenesis: Big Questions How are tissues formed from populations of cells? How are organs constructed from tissues? How do organs form in particular locations,

More information

We are walking and standing with parts of our bodies which could have been used for thinking had they developed in another part of the embryo.

We are walking and standing with parts of our bodies which could have been used for thinking had they developed in another part of the embryo. We are walking and standing with parts of our bodies which could have been used for thinking had they developed in another part of the embryo. Hans Spemann, 1943 Reading from Chapter 3 - types of cell

More information

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and

More information

7.013 Practice Quiz

7.013 Practice Quiz MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel 7.013 Practice Quiz 2 2004 1 Question 1 A. The primer

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

Nature Biotechnology: doi: /nbt.4166

Nature Biotechnology: doi: /nbt.4166 Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

More information

Stochasticity in Cell and Developmental Processes

Stochasticity in Cell and Developmental Processes Stochasticity in Cell and Developmental Processes Workshop Programme 17th 20th October 2010 Cumberland Lodge, Berkshire, UK Stochasticity in Cell and Developmental Processes Scientific Organisers: James

More information

Because ES cells maintain the ability to undergo differentiation to all cell lineages, they can provide a universal cell source

Because ES cells maintain the ability to undergo differentiation to all cell lineages, they can provide a universal cell source STEM CELLS OPINION Embryonic stem-cell culture as a tool for developmental cell biology Shin-Ichi Nishikawa, Lars Martin Jakt and Takumi Era Abstract The cell biology of the early processes of mammalian

More information

Neural Induction. Chapter One

Neural Induction. Chapter One Neural Induction Chapter One Fertilization Development of the Nervous System Cleavage (Blastula, Gastrula) Neuronal Induction- Neuroblast Formation Cell Migration Mesodermal Induction Lateral Inhibition

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our

More information

We are walking and standing with parts of our bodies which could have been used for thinking had they developed in another part of the embryo.

We are walking and standing with parts of our bodies which could have been used for thinking had they developed in another part of the embryo. We are walking and standing with parts of our bodies which could have been used for thinking had they developed in another part of the embryo. Hans Spemann, 1943 Reading from Chapter 3 - types of cell

More information

Induced Pluripotent Stem Cell

Induced Pluripotent Stem Cell Induced Pluripotent Stem Cell When eventually mastered, the processes involved in the obtaining, cultivating and differencing ESC into cells of clinical interest, another practical limitation should be

More information

History of the CFTR chase

History of the CFTR chase Module II: Molecular and cellular phenotype Discuss the history of the gene. When was the gene discovered? How was the gene cloned? (Be brief.) Discuss the cellular phenotype. What cells or tissues are

More information

The 39-Phosphoadenosine 59-Phosphosulfate Transporters, PAPST1 and 2, Contribute to the Maintenance and Differentiation of Mouse Embryonic Stem Cells

The 39-Phosphoadenosine 59-Phosphosulfate Transporters, PAPST1 and 2, Contribute to the Maintenance and Differentiation of Mouse Embryonic Stem Cells The 39-Phosphoadenosine 59-Phosphosulfate Transporters, PAPST1 and 2, Contribute to the Maintenance and Differentiation of Mouse Embryonic Stem Cells Norihiko Sasaki 1, Takuya Hirano 1, Tomomi Ichimiya

More information

ANAT 2341 Embryology Lecture 18 Stem Cells

ANAT 2341 Embryology Lecture 18 Stem Cells ANAT 2341 Embryology Lecture 18 Stem Cells 29 September 2010 Dr Antonio Lee Neuromuscular & Regenera

More information

Using Synthetic Biology to Identify a Human Papillomavirus Infection

Using Synthetic Biology to Identify a Human Papillomavirus Infection Using Synthetic Biology to Identify a Human Papillomavirus Infection Lactoguard Byron Alexander Jacobs Computational and Applied Mathematics Honours, School of Computational and Applied Mathematics, University

More information

species- Mus musculus Engineering the mouse genome David Ornitz

species- Mus musculus Engineering the mouse genome David Ornitz species- Mus musculus Engineering the mouse genome David Ornitz How do we analyze gene function in mice? Gene addition (transgenic approach) Permits GOF, DN and knockdown experiments Ectopic (spatial or

More information

Nanog Is the Gateway to the Pluripotent Ground State

Nanog Is the Gateway to the Pluripotent Ground State Nanog Is the Gateway to the Pluripotent Ground State Jose Silva, 1,2,6, * Jennifer Nichols, 1,3,6 Thorold W. Theunissen, 1,2 Ge Guo, 1,2 Anouk L. van Oosten, 1,2 Ornella Barrandon, 1,2 Jason Wray, 1,2

More information

HD1 - Introduction to Human Development

HD1 - Introduction to Human Development Human Development Ed Laufer, PhD Course Director elaufer@columbia.edu Ping Feng Course Administrator pf2013@columbia.edu Michael Shen, PhD Patricia Ducy, PhD Michael Gershon, MD Cathy Mendelsohn, PhD Richard

More information