LATE-PCR. Linear-After-The-Exponential

Transcription

1 LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University, Waltham MA 2 nd Nucleic Acid Quantification Meeting, London 2003

2 Laboratory Co-Inventors Cristina Hartshorn Kenneth Pierce John Rice J. Aquiles Sanchez Lawrence J. Wangh

3 Additional Challenges The Starting of Clinical Point: Importance Pre-Implantation Genetic Diagnosis Tumor Cancer Diagnosis Problem: Small Sample Size Problem: Tissue Heterogeneity

4 Solutions to General Problems in In Vitro Diagnostics: Improved Sensitivity of Detection Increased Accuracy of Detection Increased Reliability of Detection Simpler Methods and Instrumentation Simultaneous Detection of Multiple Targets Broader Range of Applications Construction of Automated Integrated Systems Reduce Time and Cost of Detection

5 The LATE-PCR Platform Technologies Sample Preparation Reaction Methods Product Analysis Applications QuantiLyse Product Recovery Single- Stranded Probes PurAmp RT cdna LATE PCR DNA Sequencing Low-T m Probes & Analysis of Multiple Targets Genotyping

6 Hybridization & Melting of DNA Strands is Temperature-Dependent Temperature Tm, the Melting Temperature, Hybridization 50% of the Time

7 Symmetric (conventional) PCR Temperature Strand Denaturation Primer Extension n cycles Primer Annealing Probe Detection 2 n molecules

8 Limitations Real-Time of Real-Time Symmetric Symmetric PCR PCR Lower Sensitivity for Smaller Number of DNA Targets Lack of Reliability Among Replicate Samples C T Value Freeman et al., (1999) Biotechniques 26:

9 Symmetric PCR Generates High Concentrations of Both Strands Strand Denaturation Temperature Primer Extension n cycles Primer Annealing Probe Detection 2 n molecules

10 Why Does PCR Plateau? The Problem of Amplicon Strand Reannealing Amplicon Strand Reannealing Competes With Primer and Probe Binding

11 Asymmetric PCR As a Solution to Amplicon Strand Reannealing Phase I Exponential Amplification Strand Denaturation Temperature Primer Extension n cycles Primer Annealing Probe Detection 2 n molecules

12 Asymmetric PCR As a Solution to Amplicon Strand Reannealing Phase II Linear Amplification Strand Denaturation Temperature Primer Extension n cycles Primer Annealing Probe Detection n molecules

13 The Problem With Conventional Asymmetric PCR Although attractive in theory, asymmetric PCR is quite difficult to perform since the technique requires much optimization for each specific template-primer combination. It is (also) important to find the optimal ratio between the two primers and the optimal amount of starting material From:

14 The LATE-PCR Platform Technologies Sample Preparation Reaction Methods Product Analysis Applications QuantiLyse Product Recovery Single- Stranded Probes PurAmp RT cdna LATE PCR DNA Sequencing Low-T m Probes & Multiplex Probing SNP Genotyping

15 Symmetric PCR C T = 39.6 ± 1.2 LATE-PCR C T = 39.0 ± 0.8 Asymmetric PCR C T = 45.2 ± 1.2 Efficient Sensitive (does not plateau) Reliable Sanchez et al. (2003), In Preparation for Nature Biotechnology

16 The Key to LATE-PCR Primer Design Denat. Asymmetric Symmetric LATE-PCR PCR Modifies Limiting Primer So Primer That Limiting T m is Proportional Primer T m Is to Above Primer Excess Concentration Primer T m (T ml -T mx ) 0 Temperature Primer Tm Ext. Inefficient Efficient! Anneal

17 Simple Redesign of Primers Improves Amplification Efficiency and Maintains Quantitative Kinetics of Real-Time PCR Sequence nm T m ( o C) T m Symmetric PCR Conventional Asymmetric PCR LATE-PCR 5 -CCTTCTCTCTGCCCCCTGGT GCCAGGGGTTCCACTACGTAGA CCTTCTCTCTGCCCCCTGGT GCCAGGGGTTCCACTACGTAGA GCCCTTCTCTCTGCCCCCTGGT GCCAGGGGTTCCACTACGTAGA Sanchez et al. (2003), In Preparation for Nature Biotechnology

18 Validation of LATE-PCR Primer Design (T ml -T mx ) < 0 (T ml -T mx ) 0 LATE-PCR Symmetric PCR Asymmetric PCR Symmetric PCR Inefficient Efficient Sanchez et al. (2003), In Preparation for Nature Biotechnology

19 LATE-PCR: Rational Design Allows A Broad Range of Primer Ratios Sanchez et al. (2003), In Preparation for Nature Biotechnology 1:10 (T ml -T mx ) = +5.5 C Asymmetric 1:100 (T ml -T mx ) = 3.6 C 1:100 (T ml -T mx ) = +2.4 C Rule 1: (T ml T mx ) 0

20 Increasing the Value of (T ml -T mx ) also Increases Amplification Specificity genomes, Annealing Temp. 2 o C Below T m L Pierce et al. (2003), In Preparation for Nucleic Acid Res.

21 The Problem of Product Amplicon Strand Competition Target Amplicon Strands Tm X Tm A Excess Primers Product Amplicon Strands Rule 2: (Tm A Tm X ) 18 o C

22 Benefits of LATE-PCR Primer Design Increased Efficiency Improved Sensitivity (No Plateau) Flexible Use of Primer Ratios LATE-PCR Provides a Rational Framework for Efficient and Reliable Amplification of Single-Stranded DNA

23 The LATE-PCR Platform Technologies Sample Preparation Reaction Methods Product Analysis Applications QuantiLyse Product Recovery Single- Stranded Probes PurAmp RT cdna LATE PCR DNA Sequencing Low-T m Probes SNP Genotyping

24 LATE-PCR Uncouples Annealing and Detection Symmetric Symmetric PCR PCR Strand Denaturation Temperature Annealing And Detection Primer Extension

25 LATE-PCR Uncouples Annealing and Detection Strand Denaturation Symmetric LATE-PCR Symmetric PCR PCR (linear phase) Temperature Annealing And Detection Primer Extension

26 LATE-PCR Uncouples Annealing and Detection Strand Denaturation LATE-PCR (linear phase) Temperature Primer Extension Annealing Detection

27 LATE-PCR Uncouples Annealing and Detection Strand Denaturation LATE-PCR (linear phase) Temperature Primer Extension Low-T m Probes Annealing Detection

28 LATE-PCR Uncouples Annealing and Detection Strand Denaturation High-T m Probes LATE-PCR (linear phase) Temperature Primer Extension Low-T m Probes Annealing Detection

29 Advantages of Low-T m Probes: Separate Temperature Increased Window Allele Discrimination for Primer and Probe Design High-T m Molecular Beacon Melting Curve Low-T m Molecular Beacon Melting Curve Wild type Primer Probe Probe Wild type Primer Mutant 17.3 C Mutant Sanchez et al. (2003) In Preparation for Nature Biotechnology

30 Advantages of Low-T m Probes: Saturating Amounts for Increased Sensitivity High-T m Probes Low-T m Probes uM Red uM Red Fluorescence Units uM Blue 2.4uM Green 4.0uM Magenta Fluorescence Units uM Blue 2.4uM Green 4.0uM Magenta Cycle Number Cycle Number Sanchez et al. (2003), In Preparation for Nature Biotechnology

31 Benefits of Low-T m Molecular Beacons Easier to Design Not Constrained by Primer T m Improved Sensitivity Do not Affect Amplification Efficiency Increased Allele Discrimination Expands Multiplexed Amplicon Detection Low-T m Molecular Beacons Provide Versatile and Sensitive Amplicon Detection in LATE-PCR

32 The LATE-PCR Platform Technologies Sample Preparation Reaction Methods Product Analysis Applications QuantiLyse Product Recovery Single- Stranded Probes PurAmp RT cdna LATE PCR DNA Sequencing Low-T m Probes & Multiplex Probing SNP Genotyping

33 An Example of LATE-PCR Assay: Cystic Fibrosis Fluorescence Symmetric PCR Homozygous Heterozygous Mutant Cycle Number Cycle Number Fluorescence Homozygous Heterozygous Mutant LATE-PCR Cycle Number Pierce et al. (2003), In Preparation for Molecular Human Reproduction

34 The LATE-PCR Platform Technologies Sample Preparation Reaction Methods Product Analysis Applications QuantiLyse Product Recovery Single- Stranded Probes PurAmp RT cdna LATE PCR DNA Sequencing Low-T m Probes & Multiplex Probing Loss of Heterozygosity

35 The Linear Kinetics of LATE-PCR Fluorescence Units Homozygous Cycle Number - Heterozygous

36 Loss of Heterozygous and Oncogenesis + - Heterozygous

37 Simple Assay for Loss of Heterozygosity + - Piece of a Chromosome Lost

38 The American Cancer Society and National Cancer Institute recommend annual colorectal cancer screening for the more than 74 million Americans over the age of 50. In reality, only a fraction of this population is being screened routinely for this disease.

39 : Colorectal Cancer Is a Disease That Is Well Understood From a Genomics Point of View

40 Sequencing Mutant Amplicons Would Be Informative But Before Sequencing it is Critical to Suppress Amplification Errors

41 Product Evolution

42 In LATE-PCR: Double-Stranded DNA Molecules Should Remain Constant During Linear Amplification Strand Denaturation Temperature Primer Extension n cycles Primer Annealing Probe Detection n molecules

43 The Phenomenon of Product Evolution Stringent Conditions Non-Stringent Conditions No Evolution: ds-molecules Constant + Evolution: ds-molecules Increase

44 Hypotheses I to Explain Product Evolution Primer Mis-Priming Of the Single-Strands Solution: Primer Reverse Complement Denat. Primer Reverse Complement Temperature Ext. n Anneal. Detection

45 p53 Mutations found in the majority of Li-Fraumeni syndrome cases, an autosomal dominantly inherited disorder most frequently observed somatic genetic events, occurring in ~50% of all cancers 600 nucleotides

46 Amplification of the p53 Exon 7-8 Amplicon No reverse complements 600 bp Reverse complements 88 o C

47 LATE PCR Analysis of p53 gene from Single Cell Double Stranded Probe and Two Reverse Complements 1900 Fluorescence Units bp Cycle Number

48 The LATE-PCR Platform Technologies Sample Preparation Reaction Methods Product Analysis Applications QuantiLyse Product Recovery Single- Stranded Probes PurAmp RT cdna LATE PCR DNA Sequencing Low-T m Probes & Multiplex Probing SNP Genotyping

49 The Problem of Substrate Preparation for Pyrosequencing The Problem PCR in the presence of biotin-modified primer Binding of PCR products to streptavidin-coated beads Washing, discharge of strand with unmodified primer, and neutralization The Solution LATE-PCR Annealing of beadattached template to sequencing primer Add sequencing primer Pyrosequencing Analysis

50 Pyrosequencing

51 The LATE-PCR Platform Technologies Sample Preparation Reaction Methods Product Analysis Applications QuantiLyse Product Recovery Single- Stranded Probes PurAmp RT cdna LATE PCR DNA Sequencing Low-T m Probes & Multiplex Probing SNP Genotyping

52 Automated Product Recovery Strand Denaturation Temperature Primer Extension n cycles Primer Annealing Probe Detection n molecules

53 The Race Track Reaction Chamber: Amplification & Product Recovery in a Closed System Format Collection Chambers PCR Reaction Chamber

54 Benefits of the RaceTrack Reaction Chamber Unlimited Single-Strand DNA Yield Eliminates Product Evolution Enables Simultaneous Amplification of Multiple Targets Automatable No Operator Input Required The Race Track Reaction Chamber is a Closed Tube Solution for Multiplex LATE-PCR Applications

55 The LATE-PCR Platform Technologies Sample Preparation Reaction Methods Product Analysis Applications QuantiLyse Product Recovery Single- Stranded Probes PurAmp RT cdna LATE PCR DNA Sequencing CHIP FORMAT Low-T m Probes & Multiplex Probing SNP Genotyping

56 Why Will Users Adopt These Technologies? Simple One-Tube Methods for Preparation of DNA and/or RNA Primer Design Made More Rational Thermal Cycle Profiles Made More Precise and Easier to Design Probe Design Made Easier and More Reliable Rational Approaches to Analysis and Recovery of Multiple Targets SLIO: Suppression of Amplification Errors in all Forms of PCR Quantitative End Point Assays Direct DNA Sequencing PurAmp: Quantitative RT-PCR Using Internal DNA as Controls

57 Additional Advantages of LATE-PCR Compatible With Existing PCR Equipment Lower Cost (Greater Sensitivity Means Less Reagents) Ideal for Lab-On-A-Chip Format

58 LATE-PCR and Several Allied Technologies Are Available for Licensing From Brandeis University