Applications of the Ion AmpliSeq Immune Repertoire Assay Plus TCRβ

Transcription

1 Applications of the Ion AmpliSeq Immune Repertoire Assay Plus TCRβ Timothy Looney, PhD Staff Scientist, Clinical Next-Generation Sequencing Division Thermo Fisher Scientific The world leader in serving science

2 Enterprise Interest Employee, Thermo Fisher Scientific

3 Overview of Oncology Portfolio Routine research Oncology research specimen Translational Molecular profiling solutions + Liquid biopsy solutions + Immuno-oncology solutions Full characterization of oncology samples Immuno-oncology solutions Oncomine Comprehensive Assay* Oncomine cfdna Assays for Lung, Breast, Colon Oncomine Immune Response Research Assay Liquid biopsy solutions Oncomine Focus Assay Oncomine Lung cfdna Research Assay Ion AmpliSeq Immune Repertoire Assay Plus - TCR Oncomine BRCA Research Assay Oncomine Breast cfdna Research Assay v2 Oncomine Mutation Load Research Assay Molecular profiling solutions Oncomine Solid Tumor Research Assay * Oncomine assays are Ion Torrent Oncomine assays Oncomine Pan-Cancer Cell- Free Research Assay Commercial product Product in development 3

4 V(D)J Recombination Creates Tremendous CDR3 Diversity Tandemly arranged variable, diversity and joining genes Chewback of the ends of the V-D-J genes at the CDR3 junction Addition of non-templated bases (N-additions) by TdT CDR1&2 CDR3 Immune Repertoire: The collection of B and T cell VDJ rearrangements present in an individual 4

5 AmpliSeq TCR Beta Long Read Assay - CDR1, 2 and 3 RNA/cDNA AmpliSeq Primers CDR1 CDR2 Leader FR1 FR2 Variable gene (V) CDR3 FR3 Diversity(D) Joining (J) Constant ~ bp Immune Response Characterization Cell Characterization for T cell Therapies Autoimmunity Biomarker Research 5

6 Unparalleled Offerings Simple and Flexible Workflow: Prepare libraries using from 10ng to 1ug of RNA starting material. Sequence up to 16 samples per chip with <48hrs turnaround. Unbiased output: V-gene primers are optimized to reproduce results from 5 RACE (no primer bias) Comprehensive: 400bp read length offers complete characterization of CDR1,2,3 CDR1 CDR2 CDR3 Highly accurate: Correction of sequencing and PCR errors leverages unique insights about TCR mrna Clonotype assignment confidence score 6

7 Rich Repertoire Analyses on Ion Reporter Read count QC metrics V-gene and allele identification Not full length Quality trimmed Perfect read Representation of different alleles Clonotype identification Clone sizes per variable gene Variable Joining CDR3 AA CDR3 NT Counts Frequency Rank TRBV3-1 TRBJ2-3 ASSQDGGQNTDTQY GCCAGCAGCCAAGATGGGGGA CAGAACACAGATACGCAGTAT Expanded clones In color TRBV3-1 TRBJ2-1 ASSQQLGEQF TRBV11-2 TRBJ2-3 ASSLTALGRSPDTQY GCCAGCAGCCAACAATTAGGT GAGCAGTTC GCCAGCAGCTTAACCGCCCTA GGCAGGAGTCCAGATACGCAG TAT TRBV28 TRBJ1-2 ASSLHHKSNYGYT GCCAGCAGTTTACATCACAAAT CTAACTATGGCTACACC TRBV29-1 TRBJ2-2 SIIIQNTGELF AGCATCATAATTCAGAACACCG GGGAGCTGTTT

8 High Accuracy Demonstrated by Spike-in Studies and Sequencing of Counted T cells Observed Plasmid Frequency Clones Detected Limit-of-detection using reference rearrangement spike-ins 1 0,1 0,01 0,001 0,0001 0, plasmid spike-in 57 copies 566 copies 5,655 copies 56,552 copies 0, ,0001 0,001 0,01 0,1 1 Plasmid Input (pg) Number of unique rearrangements (log10) 100, , ,000 3 Sequencing of Counted T cells 1, , ,000 5 Number of Input T cells Number of input T cells (log10) 8

9 Tracking the Overlap of Circulating vs Tumor-Infiltrating T cells Sequencing PBL revealed unique TCR. Diverse, polyclonal repertoire with few highly expanded T cells; Shannon diversity: clones unique to tumor shared clones -6 Sequencing tumor biopsy revealed 589 unique TCR. Oligoclonal repertoire with a small number of dominating clones; Shannon diversity: 6.78 Clone overlap for PBL and Tumor clones unique to PBL -8 Total RNA was extracted from peripheral blood leukocytes (PBL) and tumor biopsy from an individual with Stage IB squamous cell carcinoma of lung. 100ng of total RNA was used as template for TCRB sequencing. tumor frequency Log10 log10 clone frequency in in tumor log10 clonefrequency frequency in peripheral Log10 in blood PBL Pseudocount added 9

10 TRBV Gene Polymorphism: a Future Biomarker for Immune-Mediated Adverse Events? Certain TRBV alleles may increase TCR recognition of auto-antigens. Polymorphism implicated in: Rheumatoid Arthritis (McDermott 1995, Maskmowych 1992) Multiple Sclerosis (Hockertz 1998, Hibbard 1992, Seboun 1989) Narcolepsy (Han 2013, Hallmayer 2009) Type 1 Diabetes (Hughes, 2015, Pierce 2013) Asthma (Cho 2001, Moffatt 1997) Immune Mediated Adverse Events? TCR CDR CDR loops Allelic variants alter interaction of CDR1 and 2 with HLA HLA 10

11 We Evaluated TRBV Polymorphism in a Cohort of 85 Caucasians Fresh frozen tumor biopsies from 85 Caucasians undergoing treatment for melanoma were sequenced as part of a research collaboration with OmniSeq. TRBV gene polymorphism was evaluated using Ion Reporter. Sample sequences are compared to IMGT reference database. Ion Reporter Workflow FR1-C multiplex PCR Identify clonotypes Identify mismatches to IMGT This is an ongoing study. Preliminary results will be shown. Evidence-based filtering Report novel alleles Clone support Read support 11

12 Extensive TRBV Polymorphism Revealed by Long-Amplicon Sequencing Non-synonymous variants detected in 85 Caucasians Allele name Location of AA variant(s) Number of subjects having allele TRBV11-2*32k FR3 1 TRBV11-3*1k FR2 18 TRBV12-4*46k FR2 1 TRBV12-5*4k FR2 1 TRBV19*17k FR2 1 TRBV23-1*2k FR3 1 TRBV24-1*1k FR2 43 TRBV5-3*1k FR2 1 TRBV5-8*1k FR of 85 individuals carry an uncommon, non-synonymous variant absent from the IMGT database. FR1, CDR1, FR2, TRBV6-2*156k CDR2, FR3 1 TRBV6-5*106k CDR2 1 TRBV11-1*11p CDR1, FR2/CDR2 1 TRBV30*6p FR3 1 TRBV5-5*9p FR3 2 TRBV5-6*11p FR3 4 12

13 Summary We have observed extensive undocumented TRBV gene polymorphism in a cohort of 85 Caucasians who were profiled by long-amplicon TCRβ sequencing. Many of the undocumented alleles lead to amino acid changes in the TCRβ CDR and Framework regions, suggesting they may be functionally significant. The extent to which TRBV polymorphism influences the severity of immune-mediated adverse events is not yet known. TRBV gene allele typing can be performed using as little as 10ng of RNA from peripheral blood, facilitating retrospective analyses. Any non-ffpe sample containing T cell RNA is suitable for this purpose. 13