Computational Biology I LSM5191
|
|
- Laurence Summers
- 6 years ago
- Views:
Transcription
1 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques
2 Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA Cloning Polymerase Chain Reaction Constructing DNA libraries Southern Blotting Northern Blotting Sequencing DNA Microarrays
3 Enzymatic tools used in molecular biology Ligases Repairs ss breaks (discontinuity) in ds DNA. Polymerases DNA polymerase I attaches to short ss region (or nick) in a mainly dsdna molecule, its polymerase activity synthesizes new strand on a ssdna template, its nuclease activity degrades the existing (old) strand as it proceeds. Use: e.g. labeling probes by nick translation. Klenow fragment (modified DNA pol I 323a.a region removed) lacks nuclease activity, retains polymerase activity (as in DNA pol I). Use: e.g. labeling probes by end-filling of stagged/sticky ends. Reverse transcriptase RNA-dependent DNA polymerase.
4 Enzymatic tools used in molecular biology DNA modifying enzymes Alkaline phosphatase Removes 5 -terminal phosphate group Polynucleotide kinase Adding phosphate groups on to free 5 -termini. Terminal deoxynucleotidyl transferase Adds one or more deoxynucleotides to the 3 -end
5 Enzymatic tools used in molecular biology Nucleases Exonucleases Exonuclease III: removes nucleotides only from the 3 -end. Bal31: removes nucleotides from both strands Endonucleases S1 nuclease: cleaves only single-stranded (ss) DNA or existing ss nicks, in a mainly dsdna molecule. DNase I: cleaves both ss and double-stranded (ds) DNA. Restriction endonuclease: cleave dsdna at specific/limited no. of sites.
6 Enzymatic tools used in molecular biology Type II Restriction endonucleases: Recognition sequence is usually a palindrome, e.g. EcoRI recognises: 5 -GAATTC-3 3 -CTTAAG-5 Isoschizomers refer to enzymes that recognize the same recognition sequence. Frequency of cutting: 6-bp recognition sequence is likely to occur once every ~4kb (4 6 ), 5-bp recognition sequence is likely to occur once every ~1kb (4 5 ) Sticky ends generated by enzyme: e.g. EcoRI Blunt ends generated by enzyme: e.g. SmaI 5 -N-N-N-C-C-C-G-G-G-N-N-N-3 3 -N-N-N-G-G-G-C-C-C-N-N-N-5 Sticky ends increase the efficiency of ligation. Adapted from Lodish et al., Molec. Cell Biol. WH Freeman.
7 Selected Restriction enzymes and their recognition sites Adapted from Lodish et al., Molec. Cell Biol. WH Freeman.
8 GEL ELECTROPHORESIS Adapted from Brown, 2001, Genomes 2 Ed., Wiley Co. and Lodish et al., Molec. Cell Biol. WH Freeman.
9 GEL ELECTROPHORESIS More accurate graphical estimation 23130bp Rough estimation by eye Est 5000bp Est 3200bp Est 2000bp Size of DNA (kb) Distance migrated (cm) 564 Log 10 nucleotide pairs 0.5% 0.7% 0.9% 1.2% 1.4% Gel concentration Distance migrated (cm)
10 Restriction Mapping
11 DNA CLONING in bacteria Plasmids as vectors Vectors are shuttle molecules that permit effective transfer and propagation in bacteria of the piece of DNA (to be cloned). Plasmids are extrachromosomal self-replicating DNA molecules. DNA could be inserted into the multiple cloning site (polylinker) of plasmid vector. Adapted from Lodish et al., Molec. Cell Biol. WH Freeman.
12 DNA CLONING in bacteria Ligation of DNA insert into the plasmid vector Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
13 Ligation of sticky ends Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
14 DNA CLONING in bacteria Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
15 DNA CLONING in bacteria Transformation of plasmids into bacteria Adapted from Lodish et al., Molec. Cell Biol. WH Freeman Animation clip: Plasmid Cloning
16 Polymerase Chain Reaction (PCR) Amplification of a DNA region Animation clip PCR Exe Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
17 Designing oligonucleotide primers 5 3 Region to amplify across CACAGACTCAGAGAGAACCCACC Forward primer 5 AGACTCAGAGAGAACCC3 3 GTGTCTGAGTCTCTCTTGGGTGG TACCCCCGTGGTCTTTGAATAAA 3 3 GGGGCACCAGAAACTTA5 Reverse primer ATGGGGGCACCAGAAACTTATTT 5
18 Designing oligonucleotide primers How long should primers be? Too short might hybridize to non-target sites Too long increases time needed for hybridization If total human DNA and 8-mer primers are used for a PCR experiment, a number of different fragments will be amplified. Occurrence of primer recognition sequence: once every 4 8 = bp ~46,000 possible sites in 3x10 9 bp of nucleotide sequence. A good length for primers should not be less than 17 nucleotides (in practice: 18-25). Occurrence of primer recognition sequence: once every 4 17 = 1.7 x bp
19 Designing oligonucleotide primers Another consideration Melting temperature (T m ) Denaturation temperature Annealing/hybridization temp Extension temperature = 94 o C = depends on T m of primers = 74 o C (optimum for Taq polymerase) Annealing temperature is very important. Affects specificity of rxn. If temp too low mismatched hybrids If temp too high no hybridization takes place Ideal annealing temp must be low enough to allow hybridization and high enough to prevent mismatched hybrids.
20 Designing oligonucleotide primers Calculating T m The Wallace Rule: Empirical and convenient. For perfect-matched duplexes, nucleotides in length T m ( o C) = 2(A+T) + 4(G+C) where (A+T) is the sum of A & T residues, (G+C) the sum of G & C residues in the oligonucleotide Bolton and McCarthy: For lengths <100 nucleotides, [Cation] < 0.5M GC content (30-70%) T m ( o C) = 81.5 o C (log 10 [Na + ]) (%[G+C]) 675/n 1.0m where n = no. of bases in oligonucleotide, m = %base-pair mismatches
21 Exercise: How would you design oligonucleotide primers (about 20-mer) that would enable you to: (a) amplify the underlined region, (b) and then clone this into an EcoRI (GAATTC) site in a plasmid? 5 cacagtaacctcaactcctgccacaatgtacaggatgcaactcctgtcttgcattgcactaagt cttgcacttgtcacaaacagtgcacctacttcaagttctacaaagaaaacacagctacaactggagc atttactgcgctaccgttcgatggtctagactggctac
22 Constructing DNA Libraries What is a DNA library? A DNA library is a collection of DNA clones in a vector. Genomic DNA library cdna library A genomic library can be screened for clones containing a sequence of interest. Cloning entire genomic DNA of higher organisms into plasmid vectors is not practical: relatively low transformation efficiency of E. coli the small number of transformed colonies that can be grown on a typical culture plate. Bacteriophage/Cosmid vectors are better, as they do not suffer from such limitations. Plasmids (insert size: ~4 kb); Bacteriophage (insert: 20 kb); Cosmids (insert: 45 kb)
23 Constructing cdna (complementary DNA) Libraries Generating cdna from mrna (using reverse transcriptase) From mrna i.e. no introns
24 Constructing DNA Libraries in bacteriophage λ vector Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
25 Constructing DNA Libraries in cosmid vector Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
26 Screening DNA Library to identifying a specific clone screen library by hybridization with radioactively labeled DNA or RNA probes Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
27 Screening DNA Library with oligo. probe For e.g., we can screen DNA library to identify clone carrying sequences that encode a protein of interest. Design oligonucleotide probe based on partial protein sequence All 48 (2x3x2x1x2x2) of the 20-mer probes must be synthesized Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
28 DNA Sequencing Sanger s Dideoxy-Chain termination Animation clip: Cycle Sequencing Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
29 Southern blotting (Named after Ed Southern, Oxford University) A specific DNA sequence (e.g. isolated by cloning), can be used as a probe, Animation clip Southern Blotting to detect complementary nucleic acids in complex mixtures including total cellular DNA (and RNA, in which case, is known as Northern Blotting) Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
30 Northern blotting To detect specific mrnas To study expression or activity of a specific gene Adapted from Lodish et al., Molec. Cell Biol. WH Freeman
31 DNA Microarrays To study expression or activities of a large number of genes in a high throughput manner E.g. Comparative analyses of gene expression in response to an external stimulus, in development or in cancer progression. Likened to Reverse Northern Blot RNA cdna
32 Growth of yeast cells deplete Glucose in growth media Adapted from DeRisi, et al., 1997, Science 278:680 and Lodish et al., Molec. Cell Biol. WH Freeman
33 Exploring the metabolic and genetic control of gene expression on a genomic scale in yeast using microarrays. Adapted from DeRisi, et al., 1997, Science 278:680
34 Changes in yeast gene expression as glucose level falls Adapted from DeRisi, et al., 1997, Science 278:680 and Lodish et al., Molec. Cell Biol. WH Freeman
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationMolecular Genetics II - Genetic Engineering Course (Supplementary notes)
1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationAmplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationBasic lab techniques
Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationBasics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More informationFun with DNA polymerase
Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationComputational Biology 2. Pawan Dhar BII
Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationChapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears
Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationAGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14)
AGRO/ANSC/BIOL/GENE/HORT 305 Fall, 2017 Recombinant DNA Technology (Chpt 20, Genetics by Brooker) Lecture outline: (#14) - RECOMBINANT DNA TECHNOLOGY is the use of in vitro molecular techniques to isolate
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationBIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
More informationPlayers. Processes. Molecular Biology Recombinant DNA technology (So... you want to be a genetic engineer)
lay Davis, 8/11/12 Molecular Biology Recombinant DN technology (So... you want to be a genetic engineer) Introduction, or, games to play with DN You have learned something of the structure of DN, its replication,
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationMolecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
More informationSTANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host).
STANDARD CLONING PROCEDURES Shotgun cloning (using a plasmid vector and E coli as a host). 1) Digest donor DNA and plasmid DNA with the same restriction endonuclease 2) Mix the fragments together and treat
More informationMolecular Biology (2)
Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More information4. Analysing genes II Isolate mutants*
.. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationCONSTRUCTION OF GENOMIC LIBRARY
MODULE 4-LECTURE 4 CONSTRUCTION OF GENOMIC LIBRARY 4-4.1. Introduction A genomic library is an organism specific collection of DNA covering the entire genome of an organism. It contains all DNA sequences
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationChapter 5. Objectives: Exploration of gene Recombinant DNA technology Genome sequencing Manipulation of Eukaryotic genes
Chapter 5 Objectives: Exploration of gene Recombinant DNA technology Genome sequencing Manipulation of Eukaryotic genes Restriction enzymes - cleave DNA et specific sequence - found in prokaryotes, cleave
More informationNB536: Bioinformatics
NB536: Bioinformatics Instructor Prof. Jong Kyoung Kim Department of New Biology Office: E4-613 E-mail: jkkim@dgist.ac.kr Homepage: https://scg.dgist.ac.kr Course website https://scg.dgist.ac.kr/index.php/courses
More informationTest Bank for Molecular Cell Biology 7th Edition by Lodish
Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 1 The BIG Questions! How can we use our knowledge of DNA to: " diagnose disease or defect? " cure disease or defect? " change/improve organisms?!
More informationBIOTECHNOLOGY : PRINCIPLES AND PROCESSES
CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into
More informationLecture 22: Molecular techniques DNA cloning and DNA libraries
Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationRestriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner.
Enzymes Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Generally recognize an inverted repeat sequence 4, 6, or 8 base pairs
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationBiology Teach Yourself Series Topic 12: Molecular Biology (Unit 4)
TSSM 2017 Page 1 of 7 Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4) A: Level 14, 474 Flinders Street Melbourne VIC 3000 T: 1300 134 518 W: tssm.com.au E: info@tssm.com.au TSSM 2017
More information3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves
Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21
More informationSELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS
SELECTED TECHNIQUES APPLICATIONS IN MOLECULAR GENETICS Restriction Enzymes 15.1.1 The Discovery of Restriction Endonucleases p. 420 2 2, 3, 4, 6, 7, 8 Assigned Reading in Snustad 6th ed. 14.1.1 The Discovery
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationKey components of DNA-based Biotechnology
Lecture 12 DNA Recombinant Technology DNA enzymology: restriction enzymes, methylases, ligases, polynucleotide kinase, reverse transcriptases Hybridization: complementarity of DNA and RNA The DNA Carriers:
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationBiotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems.
MITE 2 S Biology Biotechnology Summer 2004 Austin Che Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. Recombinant DNA consists of DNA assembled
More information_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it.
* GEL ELECTROPHORESIS : its a technique aim to separate DNA in agel based on size, in this technique we add a sample of DNA in a wells in the gel, then we turn on the electricity, the DNA will travel in
More informationChapter 4. Recombinant DNA Technology
Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon
More informationBacterial DNA replication
Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems
More informationAP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More informationMethods for Working with DNA and RNA
Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are
More informationResearchers use genetic engineering to manipulate DNA.
Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic
More information}Nucleosides NUCLEIC ACIDS. Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose
DNA STRUCTURE NUCLEIC ACIDS Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose Phosphates +nucleoside=nucleotide }Nucleosides The Sugars The
More informationChapter 4. The Genomic Biologist s Toolkit
Chapter 4. The Genomic Biologist s Toolkit Contents 4. Genomic Biologists tool kit 4.1. Restriction Endonucleases making sticky ends 4.2. Cloning Vectors 4.2.1. Simple Cloning Vectors 4.2.2. Expression
More informationBiotechnology (Chapter 20) Objectives
Biotechnology (Chapter 20) Objectives Understand the background science behind the technology applications Understand the tools and details of the technology Develop familiarity with performing the select
More informationChapter 3. Enzyme manipulation of DNA and RNA
Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA
More informationRequirements for the Genetic Material
Requirements for the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell-generation to generation. 2. Information Storage Biologically useful information in a stable
More informationMethods commonly used in Molecular Genetics
Methods commonly used in Molecular Genetics outline Nucleic acid extraction Gel electrophoresis Nucleic acid hybridization Polymerase chain reaction DNA recombination technology Extraction of nucleic acid
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationVOLUME 2. Molecular Clonin g A LABORATORY MANUA L THIRD EDITIO N. Joseph Sambrook. David W. Russell
VOLUME 2 Molecular Clonin g A LABORATORY MANUA L THIRD EDITIO N Joseph Sambrook David W. Russell Chapter 8 In Vitro Amplification of DNA by the Polymerase 8. 1 Chain Reaction 1 The Basic Polymerase Chain
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationBSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06
Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationRediprime II DNA Labelling System
Rediprime II DNA Labelling System Amersham Biosciences premium radioactive labelling system consists of individually dispensed reaction mixes which are dried in the presence of a stabilizer and a dye to
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationCombining Techniques to Answer Molecular Questions
Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is
More informationLecture 1 Sunday, 4 March :24 pm
Lecture 1 Sunday, 4 March 2018 10:24 pm Amino acid side chains can be Hydrophobic, hydrophilic Positive, negatively charged Movement of information OH removed from 2' carbon to make the end more stable
More informationExperimental genetics - I
Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationEuropean Journal of Biomedical AND Pharmaceutical sciences
ejbps, 2016, Volume 3, Issue 7, 243-249. Review Article SJIF Impact Factor 3.881 Gupta. European Journal of Biomedical AND Pharmaceutical sciences ISSN 2349-8870 Volume: 3 Issue: 7 243-249 Year: 2016 http://www.ejbps.com
More informationRestriction Enzymes (endonucleases)
In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate
More information