GENETICS and the DNA code NOTES

Size: px
Start display at page:

Download "GENETICS and the DNA code NOTES"

Transcription

1 GENETICS and the DNA code NOTES BACKGROUND DNA is the hereditary material of most organisms. It is an organic compound made of two strands, twisted around one another to form a double helix. Each strand is composed of repeating units of nucleotides, which themselves are composed of deoxyribose sugar, a phosphate group, and a nitrogen base. There are four nitrogen bases in DNA adenine (A), thymine (T), cytosine (C), and guanine (G). The sequence of these nitrogen bases is the genetic code. Every three bases, or letters, codes for an amino acid, the building block of proteins. Like DNA, RNA is a nucleic acid made of repeated nucleotides. An RNA nucleotide consists of ribose sugar, a phosphate group, and a nitrogen base. RNA is very similar to DNA, but differs in a few important structural details: in the cell, RNA is usually single stranded, while DNA is usually double stranded; RNA nucleotides contain ribose, while DNA contains deoxyribose (a type of ribose that lacks one oxygen atom); and RNA has the nucleotide uracil, rather than thymine, which is present in DNA. Through the processes of transcription and translation, the cell makes proteins using the code from DNA. Transcription takes place in the nucleus and involves transferring the information in DNA through messenger RNA (mrna). The mrna is a single strand that is the complement of the template DNA, except that it uses uracil (U) instead of thymine (T). Once the mrna is formed, it leaves the nucleus and goes into the cytoplasm. Translation takes place in the cytoplasm and is the process of creating a polypeptide from the information carried on the mrna. The mrna binds with a ribosome, which is the site where protein synthesis takes place. The mrna moves through the ribosome three nitrogen bases at a time; these three nitrogen base segments are called a codon, and each codon codes for a particular amino acid. The transfer RNA (trna) has an anticodon that is the complement of the codon and carries the appropriate amino acid for that codon. This process of adding amino acids continues until there is a stop codon, signaling the end of the polypeptide. This polypeptide is then folding to make a protein. Some proteins are made of a single polypeptide, while others are made up of multiple polypeptides bonded together. Mutations are changes in a gene in the DNA, which may cause the protein to not form correctly. These changes can be passed on from a parent, or they can occur during an individual s lifetime. The impact of the mutation depends on where and when the change occurs. Some changes occur in non-coding regions or involve a change that still codes for the same amino acid sequence, since multiple nitrogen base combinations can code for the same amino acid. These are called silent mutations and are considered to be neutral. Other mutations can change the protein structure, which will change the traits of an organism. These changes can be either positive or negative for the organism. RNA DNA # strands Nitogen bases Sugar Location Primary function In nucleus and cytoplasm Trasnfers genetic information to aid cell in protein synthesis Long-term storage of genetic information; codes fro proteins

2 Replication: in nucleus 1. Unzip DNA helix by breaking hydrogen bonds 2. Add DNA nucleotides to exposed strands Transcription: in nucleus 1. Unzip section of DNA to copy 2. And RNA nucleotides to one side of DNA exposed 3. Modify mrna by cutting out introns (noncoding mrna) leaving only exons (coding mrna) 4. Mature mrna leaves nucleus Translation: in cytoplasm 1. Ribosome reads mrna code at START codon 2. trna with anitcodon that complements mrna brings correct amino acid 3. Ribosome attaches amino acids together 4. Ribosome release mrna and complete amino acid chain when hits STOP codon

3 Use the information above to help complete the activity. Turn the DNA sequence into an amino acid chain. Also include the trna anitcodon. 1. Complimentary DNA Original DNA mrna codons Amino acid sequence 3 T A C T C G G G G C G C A T C C A A G A G 5 trna anticodon 2. Complimentary DNA Original DNA mrna codons 3 T A C G A T C G A T A G C T A G C T A G C 5 Amino acid sequence trna anticodon 3. Complimentary DNA Original DNA mrna codons 3 T A C A C G T A T C T T G G C T A G C T A 5 Amino acid sequence trna anticodon

4 Mutations NOTES Identify each type of DNA mutation: point, frameshit (insertion), frameshift (deletion) Which type of mutation (point or frameshift, causes more damage? Why? Identify each type of chromosomal mutation: insertion, deletion, substitution, inversion, translocation How are the chromsomal mutations above different from the effects of nondisjunction? Identify the mutations as: silent muation, missense mutation, nonsense mutation, stop codon mutation 1. : results in same amino acid; same function 2. : results in code for different amino acid; affects range (ex. Sickle cell anemia 3. : results in early stop codon; harmful affects (ex. Cystic fibrosis) 4. : results in stop codon turned into another amino acid (chain gets too big); harmful affects (ex. Familial British dementia)

5 Name Period date DNA Replication and Central Dogma Identify each figure below: replication, transciption, translation Where does replication occur? 3. Where does transciption occur? 4. Where does tranlation occur? 5. Which process results in amino acid chains? 6. Which process results in mrna? 7. Which process results in more DNA for cellular division? Making complimentary DNA (cdna) strands: 8. 3 A A T T C G C C G G T A T T A G A C G T T T A T C C C G G A G A G G T C C A A T G C A T C G G G G A A T T A C C C G T T A A 5

6 11. What is a codon? 12. What codon means start? 13. What 3 codons act as termination signals? 14. List ALL of the codons for leucine. 15. Name one amino acid that has more than one codon. 16. Name an amino acid that has only one codon If the DNA sequence is --- AAA TAT CCG TAG CAA ATG, write the mrna sequence, trna anticodon sequence, and the six amino acids for this. DNA: AAA TAT CCG TAG CAA ATG 17. mrna: 18. Amino acids: 19. trna: 20. Given the following three mrna sequences, 2 code for the same protein. Which two? Circle the correct sequences a) AGU UUA GCA ACG AGA UCA b) UCG CUA GCG ACC AGU UCA c) AGC CUC GCC ACU CGU AGU 21. A geneticist found that a particular mutation had no effect on the protein coded by a gene. What do you think is the most likely type of mutation in this gene? Why?

7 22. Look at the following sequence: THE FAT CAT ATE THE RAT. Delete the first H and regroup the letters in groups of three- write out the new groups of three. Does the sentence still make sense? What type of mutation is this an example of? Below is the base sequence for the normal protein for normal hemoglobin and the base sequence for the sickle cell hemoglobin. Normal GGG CTT CTT TTT Sickle GGG CAT CTT TTT 23. Transcribed and translate the normal and sickle cell DNA. Normal Sickle Cell 24. Is sickle cell caused by a point or frameshift mutation. Explain. 25. If the base sequence read GGG CTT CTT AAA instead, would this result in sickle cell hemoglobin? Explain why or why not.

8 Fill in the Chart cdna ORIGINAL mrna codon trna anticodon Amino Acid strand DNA triplet 20. AAG 21. GGC 22. CAG 23. UUA 24. AAA 25. GTA 26. CUC 27. ACA 28. TAT 29. AGC 30. AUU 31. CCA 32. GGC mrna CODON CHART for Amino Acids

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code

More information

Comparing RNA and DNA

Comparing RNA and DNA RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases. DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types

More information

UNIT 4. DNA, RNA, and Gene Expression

UNIT 4. DNA, RNA, and Gene Expression UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

PROTEIN SYNTHESIS Study Guide

PROTEIN SYNTHESIS Study Guide PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the

More information

DNA- THE MOLECULE OF LIFE

DNA- THE MOLECULE OF LIFE DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,

More information

Chapter 17 Nucleic Acids and Protein Synthesis

Chapter 17 Nucleic Acids and Protein Synthesis Chapter 17 Nucleic Acids and Protein Synthesis Nucleic Acids Nucleic acids are the components that make up the genetic material DNA (deoxyribonucleic acid). DNA is a macromolecule which contains all the

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Just one nucleotide! Exploring the effects of random single nucleotide mutations

Just one nucleotide! Exploring the effects of random single nucleotide mutations Dr. Beatriz Gonzalez In-Class Worksheet Name: Learning Objectives: Just one nucleotide! Exploring the effects of random single nucleotide mutations Given a coding DNA sequence, determine the mrna Based

More information

Worksheet: Mutations Practice

Worksheet: Mutations Practice Worksheet: Mutations Practice There are three ways that DNA can be altered when a mutation (change in DNA sequence) occurs. 1. Substitution one base-pairs is replaced by another: Example: G to C or A to

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

DNA- THE MOLECULE OF LIFE. Link

DNA- THE MOLECULE OF LIFE. Link DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,

More information

UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR

UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR RNA, as previously mentioned, is an acronym for ribonucleic acid. There are many forms

More information

DNA: The Molecule of Heredity

DNA: The Molecule of Heredity 1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

DNA Structure and Protein synthesis

DNA Structure and Protein synthesis DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

DNA, Replication and RNA

DNA, Replication and RNA DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

Central Dogma. 1. Human genetic material is represented in the diagram below.

Central Dogma. 1. Human genetic material is represented in the diagram below. Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)

More information

Biomolecules: lecture 6

Biomolecules: lecture 6 Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized

More information

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS

UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS Nucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RNA (ribonucleic

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Frederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria

Frederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S

More information

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

DNA Replication and Protein Synthesis

DNA Replication and Protein Synthesis DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls

More information

DNA & Protein Synthesis #21

DNA & Protein Synthesis #21 Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important

More information

Protein Synthesis. Application Based Questions

Protein Synthesis. Application Based Questions Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html

More information

Flow of Genetic Information

Flow of Genetic Information Flow of Genetic Information Transcription and Translation Links to the Next Generation Standards Scientific and Engineering Practices: Asking Questions (for science) and Defining Problems (for engineering)

More information

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino

More information

Molecular Biology of the Gene

Molecular Biology of the Gene Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides

More information

DNA REPLICATION REVIEW

DNA REPLICATION REVIEW Biology Ms. Ye DNA REPLICATION REVIEW 1. Number the steps of DNA replication the correct order (1, 2, 3): Name Date Block Daughter strands are formed using complementary base pairing DNA unwinds The DNA

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). 1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

Activity A: Build a DNA molecule

Activity A: Build a DNA molecule Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions

More information

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

DNA/RNA. Transcription and Translation

DNA/RNA. Transcription and Translation DNA/RNA Transcription and Translation Review DNA is responsible for controlling the production of proteins in the cell, which is essential to life DNA RNA Proteins Chromosomes contain several thousand

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

Name: Date: Pd: Nucleic acids

Name: Date: Pd: Nucleic acids Name: Date: Pd: DNA - The Double Helix Nucleic acids Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of

More information

DNA - The Double Helix

DNA - The Double Helix DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,

More information

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information

CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith

CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:

More information

Chapter 15 DNA and RNA

Chapter 15 DNA and RNA Chapter 15 DNA and RNA www.mrcbiology.com 1 Variation Variation means that individuals in a species have different characteristics to one another. Acquired Variation are not inherited. e.g learnt during

More information

DNA - The Double Helix

DNA - The Double Helix DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

DNA: The Molecule of Heredity

DNA: The Molecule of Heredity DNA: The Molecule of Heredity STRUCTURE AND FUNCTION - a nucleic acid o C, H, O, N, P o Made of nucleotides = smaller subunits o Components of nucleotides: Deoxyribose (simple sugar) Phosphate group Nitrogen

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

DNA - The Double Helix

DNA - The Double Helix Name Date Period DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including

More information

GAUTENG DEPARTMENT OF EDUCATION SENIOR SECONDARY INTERVENTION PROGRAMME. LIFE SCIENCE Grade 12 Session 9: Nucleic Acids DNA and RNA (LEARNER NOTES)

GAUTENG DEPARTMENT OF EDUCATION SENIOR SECONDARY INTERVENTION PROGRAMME. LIFE SCIENCE Grade 12 Session 9: Nucleic Acids DNA and RNA (LEARNER NOTES) Learner Note: Please ensure that you understand that the nucleus is an organelle located in a cell. Go through the structure of DNA and RNA very carefully. You MUST understand the structure and combination

More information

3. INHERITED MUTATIONS

3. INHERITED MUTATIONS THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,

More information

DNA - The Double Helix

DNA - The Double Helix DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Basic Biology. Gina Cannarozzi. 28th October Basic Biology. Gina. Introduction DNA. Proteins. Central Dogma.

Basic Biology. Gina Cannarozzi. 28th October Basic Biology. Gina. Introduction DNA. Proteins. Central Dogma. Cannarozzi 28th October 2005 Class Overview RNA Protein Genomics Transcriptomics Proteomics Genome wide Genome Comparison Microarrays Orthology: Families comparison and Sequencing of Transcription factor

More information

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen

More information

Protein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives

Protein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives Lab Exercise Protein Synthesis Contents Objectives 1 Introduction 1 Activity.1 Overview of Process 2 Activity.2 Transcription 2 Activity.3 Translation 3 Resutls Section 4 Introduction Having information

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Unit VII DNA to RNA to protein The Central Dogma

Unit VII DNA to RNA to protein The Central Dogma Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase

More information

Microbiology: The Blueprint of Life, from DNA to protein

Microbiology: The Blueprint of Life, from DNA to protein Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing

More information

Protein Synthesis. OpenStax College

Protein Synthesis. OpenStax College OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different

More information

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule. From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

From Gene to Protein via Transcription and Translation i

From Gene to Protein via Transcription and Translation i How do genes influence our characteristics? From Gene to Protein via Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

AP2013-DNAPacket-II. Use the list of choices below for the following questions:

AP2013-DNAPacket-II. Use the list of choices below for the following questions: Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.

More information

STUDY GUIDE SECTION 10-1 Discovery of DNA

STUDY GUIDE SECTION 10-1 Discovery of DNA STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has

More information

DNA & DNA Replication

DNA & DNA Replication DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?

More information

DNA & Protein Synthesis UNIT D & E

DNA & Protein Synthesis UNIT D & E DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information

More information