DNA Begins the Process

Transcription

1 Biology I

2 D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells

3 DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytosol of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER

4 Starting with DNA DNA s code must be copied and taken to the cytosol In the cytosol, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESIS

5 RNA~ Ribonucleic acid " RNA like DNA consists of nitrogen bases, sugar-phosphate polymers, but there are also some differences. " There are 4 main differences b/t RNA & DNA: ü The sugar in RNA is ribose, DNA has deoxyribose ü RNA is single stranded, DNA is double stranded ü RNA contains the base uracil, DNA has thymine

6 Comparison of Structures DNA & RNA

7 Structure of RNA

8 õ Since the base Thymine is being replaced by the base Uracil let s answer the following:! For the following DNA sequence add the complementary RNA nucleotides: T T A G G C T G G A T G C T A A C! The complementary RNA sequence would be: A A U C C G A C C U A C G A U U G

9 Question:! What would be the complementary RNA strand for the following DNA sequence? DNA 5 -GCGTATG-3

10 Answer: DNA 5 - GCGTATG-3 RNA 3 - CGCAUAC-5

11 ! Another difference between DNA & RNA is in the function. DNA has only one function~ STORING GENETIC INFORMATION in it s bases. But there are 3 main types of ribonucleic acid; each has a specific job to do 1. Ribosomal RNA (rrna) ~ exists outside the nucleus in the cytoplasm of cells in structures called ribosomes. Ribosomes are small, granular structures where protein synthesis takes place. 2. Messenger RNA (mrna) ~ records" information from DNA in the cells nucleus and carry it to the ribosomes. They serve as messengers to the cell. 3. Transfer RNA (trna)~ the function of transfer RNA is to deliver amino acids one by one to protein chains growing at ribosomes.

12 Transfer RNA Messenger RNA Ribosomal RNA

13 The following diagram is an example for gene expression how the information in DNA is translated into organism s traits RNA molecules are copied by copying part of the nucleotide sequence of DNA into a complementary sequence in RNA This process by which DNA is copied to RNA is called Transcription, it requires the enzyme RNA polymerase & occurs in the nucleus of cells

14 Step 1~ Transcription begins when RNA polymerase binds to the promoter site (a specific sequence of DNA that acts as a START signal) Step 2~ RNA polymerase unwinds & separates the two strands of DNA Step 3~ RNA polymerase adds & links complementary RNA nucleotides Transcription continues until RNA polymerase reaches the STOP signal on DNA

15 Diagrams of RNA Transcription

16 mrna Transcript mrna leaves the nucleus through its pores and goes to the ribosomes

17

18 Proteins are made by the joining of amino acids into long polypeptide chains, which contain any combination of the 20 AA. The language of mrna is called the genetic code. A sequence of 3 nucleotides in mrna codes for each AA, are called codons. Codons consists of 3 bases that specify an AA, therefore the genetic code is read 3 letters at a time.

19

20 Example of Using Genetic Code Below is an example of an RNA sequence: CGGUAAGAGUCG It would be read 3 bases at a time: CGG UAA GAG UCG Each codon is represented by a different AA: CGG UAA GAG UCG Arginine ~ Stop ~ Glutamine ~ Serine

21 Let s practice below: Using the following DNA sequence: ATCGTAACCGTTCTG Transcribe the DNA sequence into an mrna sequence: UAGCAUUGGCAAGAC Now break the mrna sequence down where it can be read: UAG CAU UGG CAA GAC Now identify the Amino Acids: Stop Hist Tryp Glut Asp

22 2 Use the code by reading from the center to the outside 2 Example: AUG codes for Methionine

23 GGG? UCA? CAU? GCA? AAA?

24

25 Messenger RNA (mrna) mrna start codon A U G G G C U C C A U C G G C G C A U A A codon 1 codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 protein methionine glycine serine isoleucine glycine alanine stop codon Primary structure of a protein aa1 aa2 aa3 aa4 aa5 aa6 peptide bonds

26 Transcription

27 Proteins are made by joining amino acids into long chains called polypeptides. The production of these proteins is called protein synthesis. Each polypeptide contains any of Amino Acids The language of mrna instructions is called the Codons contain nucleotides that specify a single AA Some AA are represented by more than one codon EX: codons specify AA Leucine, what are they? One codon AUG can represent Methionine or START codon for protein synthesis. I Stop codons are like periods at the end of sentence!! Name the codons for the following AA: Tyrosine Alanine Glutamine Name the AA for the following codons: AAA CUG UAG

28 THE MAKING OF PROTEINS

29 TRANSLATION The decoding of an mrna message into a polypeptide chain (protein) is called translation, which takes place on ribosomes Amino Acids are transported by ribosomes & trna molecules, which have specific regions that bond to AA The loop attachment has a sequence of 3 nucleotides called anticodons. The trna anticodon is complementary & pairs with the mrna codons. During translation or protein synthesis the cells use info from mrna to produce the proteins

30 ? EX: The trna anticodon UAC would bind with the mrna codon A U G mrna is transcribed from the DNA in the nucleus Translation begins when mrna attaches to a ribosome at the start codon The pairing of codons & anticodons causes AA to attach to the growing polypeptide chain Each AA is added to the chain until it reaches a stop codon I ending translation

31

32 Another Example of Translation

33 Protein synthesis Protein Synthesis Pt. 2

34 Translation

35

36

37 M u t a t I o n s

38 What is a Mutation? & A mutation is a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can alter the amino acid sequence of the protein encoded by the gene. P There are two main types of mutations: Gene & Chromosomal Gene mutations results from changes in a single gene there are two types: Point & Frameshift Mutations

39 $ Point mutations~ these affect one nucleotide, because they occur at a single point in the DNA sequence & substitutes one nucleotide for another.. Example DNA: TAC GCA TGG AAT mrna: AUG CGU ACC UUA AA: Met Arg Thr Leu ò Substitution DNA: TAC GTA TGG AAT mrna: AUG CAU ACC UUA AA: Met Hist Thr Leu

40 $ Frame shift mutations~ these include inserting a extra nucleotide or deleting a nucleotide, which shifts the reading frame of the genetic message DNA: TAC GCA TGG AAT mrna: AUG CGU ACC UUA AA: Met Arg Thr Leu ò Insertion DNA: TAT CGC ATG GAA T mrna: AUA GCG UAC CUU A AA: Ile Ala Tyr Leu

41

42 Normal hemoglobin (eight out of the 146 amino acid units of normal hemoglobin) Val His Leu Thr Pro Glu Glu Lys Sickle-cell hemoglobin (the same section as above as found in Sickle-cell hemoglobin) Val His Leu Thr Pro Val Glu Lys Good red blood cells Sickle cell blood cells pictures from: ccc/ ccnews/ nov99/ The function of normal human red blood cells, which are disk-shaped, is to transport oxygen from the lungs to the other organs of the body. Each red blood cell contains millions of molecules of hemoglobin that carries the oxygen. A slight change in the order of the amino acids in the hemoglobin molecule (valine substituted for glutamine), which has only 146 amino acids, causes sickle-cell disease. Abnormal hemoglobin molecules stick together and crystallize deforming the red blood cells. The deformed blood cells then clog tiny blood vessels impeding the flow of blood. Sickle-cell anemia kills about 100,000 people per year in the US

43 The molecular basis of sicklecell disease

44 ! Environmental factors including radiation, chemicals, and viruses, can cause chromosomes to break; if the broken ends do not rejoin in the same pattern, this causes a change in chromosomal structure.

45 Types of Chromosomal Mutations " Inversion: a segment that has become separated from the chromosome is reinserted at the same place but in reverse; the position and sequence of genes are altered. " Translocation: a chromosomal segment is removed from one chromosome and inserted on another chromosome " Deletion is a type of mutation in which an end of a chromosome breaks off or when two simultaneous breaks lead to the loss of a segment. a. Even if only one member of pair of chromosomes is affected, a deletion can cause abnormalities. b. Cri du chat syndrome is deletion in which an individual has a small head, is mentally retarded, has facial abnormalities, and abnormal glottis and larynx resulting in a cry resembling that of a cat. " Duplication is a doubling of a chromosomal segment. a. A broken segment from one chromosome can simply attach to its homologue. b. Unequal crossing-over may occur.

46 Examples of Mutations DELETION DUPLICATION INVERSION TRANSLOCATION

47

48 Examples Here s the DNA Sequence TACGCATGCTGCGAAACGTTGACT Now transcribe into mrna: Now transfer mrna into where it can be read: Identify the AA DNA: TAC GCA TGC TGC GAA ACG TTG ACT mrna: AUG CGU ACG ACG CUU UGC AAC UGA AA: Met- Arg- Thr- Thr- Leu- Cys -Aspar- Stop

49 Identify the Mutations Below Original: THEBIGREDFOXATETHEBAT How would it be read by mrna? THE BIG RED FOX ATE THE BAT What happened? THE BIG EDF OXA TET HEB AT DNA: TAC GCA TGC TGC GAA ACG TGG ACT mrna: AUG CGU ACG ACG CUU UGC ACC UGA AA: Met- Arg- Thr- Thr- Leu- Cys -Thr- Stop DNA: TAC GCA TGC TGC GAA ACG TGG AC mrna: AUG CGU ACG ACG CUU UGC AAC UG AA: Met- Arg- Thr- Thr- Leu- Thr -Aspar-