TOOLS sirna and mirna. User guide
|
|
- Kelley Toby Hicks
- 6 years ago
- Views:
Transcription
1 TOOLS sirna and mirna User guide
2 Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas) are short, double-stranded RNA molecules that bind specific messenger RNA (mrna) molecules and decrease their activities by preventing an mrna from producing a protein. TOOLS sirna oligos undergo vigorous process monitoring and strict quality control, produce under ISO9000 quality standard system. Chemical Modified sirna exhibits greater longevity in cell culture and stability in cell culture and in serum, enhancing the ability for this to be used for in vivo applications and has much more extensional effective time than Standard sirna. TOOLS in vitro/vivo mirna mimics inhibitors are chemically-modified and optimized nucleic acids designed to specifically target the microrna (mirna) molecules in animals. Endogenous micrornas are small, regulatory RNAs that are expressed in animals and plants that affect the translation of target mrnas. The mature nucleotide, single-stranded mirnas specifically target a protein complex to regulate translation at the level of mrna. Specifications Products (1 OD) sirna mirna mimics mirna inhibitor nmol Molecular weight ~13300 ~13300 ~6500 weight 33 ug 33 ug 33 ug Concentration 20 um (20 pmol/ul) 20 um (20 pmol/ul) 20 um (20 pmol/ul) (when adding 125 ul H 2O) (when adding 125 ul H 2O) (when adding 250 ul H 2O) 1
3 Ordering information sirna In vitro sirna or chemically-modified sirna In vivo sirna or chemically-modified sirna Negative Control sirna FAM Negative Control sirna Positive Control sirna sirna set (Guaranteed >70% knock-down in mrna level) 3 x 1OD target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna Chemically-modified sirna set(guaranteed >70% knock-down in mrna level) 3 x 1OD Chemically-modified target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna 2OD/4OD/8OD request 1OD 1OD 1OD mirna mimics & inhibitors In vitro mirna mimics In vitro mirna mimics negative control In vitro chemically-modified mirna inhibitor In vitro chemically-modified mirna inhibitor negative control In vivo chemically-modified mirna mimics In vivo chemically-modified mirna inhibitor In vivo mirna mimics & inhibitor negative control 2OD/4OD 2OD 2OD/4OD 2OD request request request 2
4 sirna transfection guide: Cell Culture Before Transfection It is advised that before starting your transfection experiment, put your cells on your cell plate, then add proper culture medium, lastly incubate cells for 24 hrs to be 70%-90% by confluence. Transfection reagent: TOOLSoothFect transfection reagent (Cat.No. NFT-KA00) Culture vessel Surface Area (mm 2 /well) Cell Density Volume of plating Medium(ul/well) 96-well x x ul 48-well x x ul 24-well x x ul 12-well x x ml 6-well x x ml 35 mm x x ml 60 mm x x ml Culture vessel sirna Volume of plating Transfection reagent mediun (ul/well) 96-well 5 pmol 100ul 0.25 ul 24-well 20 pmol 500ul 1 ul 12-well 40 pmol 1ml 2 ul 6-well 100 pmol 2ml 5 ul 35 mm 100 pmol 2ml 5 ul 60 mm 600 pmol 5ml 10 ul mirna mimics or inhibitor transfection guide: mirna Culture Dish Transfection reagent (mimics or inhibitor) Cell density (cells/well) Final volume (per well) 96-well ul 3 pmol ml 24-well ul 15 pmol ml 12-well 1-3 ul 30 pmol ml 6-well 2-5 ul 75 pmol ml 3
5 In vivo sirna delivery guide: Delivery route (dissolve in vivo sirna in PBS or RNase free water or OptiMEM) Intravenous Intraperitoneal Intracranial Systemic delivery dosage: nmol/g body weight Mice (body weight 15-20g): 3-4 nmol (40-50ug) Rat (body weight g): nmol ( ug) A sirna dose of 5mg/kg/day is recommended as a starting point for experiments. In vivo mirna (mimics or inhibitor) delivery guide: Delivery route (dissolve in vivo mirna in PBS or normal saline:) Intravenous Intraperitoneal Intracranial 5-80ug/g body weight or 200nmol(3 times) Local delivery: 1-10nmol(0.5-4OD), volume: 30ul~100ul; TOOLS mirna modification example: hsa-mir-137 agomirs sense : 5' UUAUUGCUUAAGAAUACGCGUAG 3' antisense: 5' AsCsGCGUAUUCUUAAGCAAUAsAsUsUs-Chol- 3' Storage Store TOOLS sirna or mirna at 20 C 4
6 sirna or mirna FAQs : What is the best method of delivering sirnas into the cell? There are several methods that are used for delivering sirnas into cells including lipid-based transfection, electroporation, calcium phosphate co-precipitation, microinjection and vector delivery techniques. The choice between these methods is often a result of several factors including the ability of the cells to tolerate the delivery method, susceptibility to viral infection, and the growth properties of the cells. Although lipid-based transfection is one of the more commonly used methods for adherent cells, suspension cells are often more difficult to transfect and generally have higher rates of delivery with electroporation techniques. Is there a quick method for monitoring transfection efficiency? TOOLS has developed several options including a family of fluorescent-labeled sirnas and a novel RNA-based reagent known as sirna transfection Control. The uptake of sirnas can be visualized with the appropriate filters on a confocal microscope or by flow cytometry. Alternatively, fluorescent-labeled sirna is cytotoxic when successfully delivered into cells. Cells that have efficiently taken up this transfection control typically undergo apoptosis within 24 to 48 hours. This phenotypic outcome can easily be monitored using standard cell viability methods (e.g., alamarblue, MTT cytotoxicity, Trypan Blue dye exclusion, JC1 dye, or other appropriate assays). What is the best time-frame for monitoring sirna-dependent decreases in target mrna expression levels? In target protein levels? Generally, target mrna levels are decreased after 24 hours post-transfection following transfection of a gene-specific sirna duplex. However, maximal silencing may be reached at a later time point, so it is advisable to assay target mrna in a time-course study. In most cases, silencing will be maximal at 24 to 48 hours following transfection. Cellular target protein levels should be examined starting at 24 hours and assayed until a minimum level is noted, often 48 to 96 hours or greater. As always, it is important to verify transfection efficiency using an appropriate positive control. If there is no decrease in protein levels within this time frame, it may be necessary to perform a second sirna transfection, use a stabilized sirna, or develop a vector-based silencing cassette that can continuously produce the sirna for extended periods of time. 5
7 TOOLS shrna Vector Pre-cloned and ready-made shrna expression plasmids for long-term gene silencing
8 Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas) are short, double-stranded RNA molecules that bind specific messenger RNA (mrna) molecules and decrease their activity, for example by preventing an mrna from producing a protein. A small hairpin RNA or short hairpin RNA (shrna) is a sequence of RNA that makes a tight hairpin turn that can be used to silence target gene expression via RNAi. TOOLS provides the most advanced and convenient shrna expression plasmid that express functional sirna when transfected into mammalian cells. TOOLS shrna vector is a highly efficient ready-to-use vector that achieve lasting inhibition of target gene expression. Users only need to provide gene name or ID and select one of our 10 vectors. We produce ready-to-use TOOLS shrna Vector with desired sirna insert for our customer. Ordering information Ready-to-use TOOLS shrna Vector (desired sirna insert has been cloned) Product Promoter Selection marker Size pgpu6 U6 50µg pgph1 H1 50µg pgpu6/neo U6 Neo 50µg pgph1/neo H1 Neo 50µg pgpu6/hygro U6 Hygro 50µg pgph1/hygro H1 Hygro 50µg pgpu6/gfp/neo U6 Neo 50µg pgph1/gfp/neo H1 Neo 50µg pgpu6/rfp/neo U6 Neo 50µg pgph1/rfp/neo H1 Neo 50µg Neo: Neomycin resistance gene. Hygro: Hygromycin B resistance gene. TOOLS shrna Vector set Each packset contains 4 shrna vectors designed for a target gene Guarantee: one of shrna vectors shows 70% inhibition efficiency in mrna level Set composition Number shrna vector for a target gene 4 positive control shrna vector 1 negative control shrna vector 1 Each plasmid contains 50µg Storage Store TOOLS shrna vector at 20 C 1
9 Transfecting TOOLS shrna vector into Mammalian Cells We recommend using TOOLSoothFect transfection reagent (Cat.No. NFT-KA00) to deliver TOOLS shrna vectors into mammalian cells with high efficiency and minimal toxicity. It is suitable for the transfection of a wide variety of cell types. Follow the instructions for using TOOLSmartFect Transfection Reagent provided with the product or refer to the protocol below: 1. For each well, add 0.5 ml of normal growth medium (antibiotic does not influence the result) freshly 2 hours before transfection. 2. For each well, dilute 0.5 μg of DNA in 50 μl of DMEM without serum in a tube, and mix gently. 3. Add 1 μl of TOOLSoothFect into another tube with 50 μl of DMEM without serum, and mix gently. 4. Add TOOLSoothFect /DMEM into DNA/DMEM solution. Mix by vortexing for 5-10 seconds. 5. Incubate for ~15 minutes at room temperature to allow for TOOLSoothFect /DNA complexes self-assembly. 6. Add the 100 μl TOOLSoothFect /DNA mix drop-wise to the cells in each well and homogenize by gently swirling the plate. 7. Return the plates to the cell culture incubator. 8. Check transfection efficiency 24 to 48 hours post transfection. Culture Dish Surface Area (cm 2 ) Cell Number Medium Volume (ml) Plasmid (μg) TOOLSoothFect (μl) Diluent Volume (μl) 96-well x well x well x well 4 1-2x Well/35 mm x mm/t x mm/t x mm/t x
10 Using the Positive and Negative Controls The Negative Control plasmid supplied with the set is a circular plasmid encoding a hairpin sirna whose sequence is not found in the mouse, human, or rat genome databases. It is ready-to-transfect and can be used to control for the effects of introducing the TOOLS shrna vector into cells. Cells transfected with the TOOLS shrna vector expressing your target-specific sirna should be compared to cells transfected with the corresponding Negative Control. For any RNAi experiment, it is important to include a culture that is transfected with a negative control plasmid as a basis for analysis of gene knockdown. The optimal negative control insert for expression analysis in a gene silencing experiment is the scrambled sequence of your gene specific sirna. The product of the positive control vector contains a sirna template targeting GAPDH. This construct can be used to optimize the transfection procedure. Use GAPDH and the Negative Control to transfect cells, and monitor cell viability and gene silencing of GAPDH to identify optimal transfection conditions. When successfully transfected and expressed, the GAPDH sirna reduces both the mrna and protein levels of GAPDH in human cell lines. This slows the growth rate of the cells and reduces the rate of cell proliferation of most cell types. To assess whether sirna-mediated gene silencing is occurring, levels of GAPDH RNA, levels of GAPDH protein, and/or cell proliferation can be monitored. Any of the following assays for assessing sirna-mediated reduction in GAPDH gene expression can be used: a. Quantitate mrna levels by Northern analysis or real-time PCR. GAPDH mrna levels are typically reduced 50 90% 48 hr after transfection. b. Analyze protein levels by Western blot, immunohistochemistry, or immunofluorescence. GAPDH protein levels are typically reduced 50 90% 48 hr after transfection. c. Look for a reduction in cell proliferation caused by GAPDH knock down. Although it is less direct than looking at GAPDH mrna or protein levels, a reduction in GAPDH activity can be assessed by measuring cell proliferation. Depending on cell type, there should be a >40% reduction in cell number hours after transfection. 3
11 TOOLS shrna vector Maps 4
12 5
13 TOOLSilent shrna Vector Product Name: TOOLSilent shrna 50 ug Cat. Number: TOOLSILSHRNA Key features: Dual-function of TOOLSilent shrna vector (Effective transfection of shrna vector and transduction of lentiviral vector) Packaged lentiviral shrna vector exerts higher ability to integrate into the genome of primary cells, stem cells and non-dividing cells. Customized lentiviral packaging service (in vivo and in vitro) Insert size: ~4kb Low cytotoxicity
14 TOOLSilent Lentiviral Expression System TOOLSilent Lentiviral Expression System consists of: (1) Lentiviral expression vector (TOOLSilent shrna Vector) (2) Lentiviral packaging plasmids (3) Pseudoviral particle producer cell The expression vector comprises required lentiviral packaging, transfection, stable integration of the genetic information. Lentivirus packaging plasmid provides all necessary proteins for transcription and encases an RNA copy of the expression construct into recombinant pseudoviral particles. The pseudoviral particles are secreted by producer cells in culture media and can be directly transduced into target cells.
15 TOOLSilent lentivirus packaging service (in vivo) For in vivo experiments, TOOLS provides high-quality ready to use lentivirus. Optional A set of four shrnas (three target shrna plus one negative control shrna) lentiviruses are designed based on customer s needs (gene name or ID) using high efficient software. The recommended concentration of TOOLSilent lentivirus is TU/ml ( ul mouse tail vein injection) We synthesize DNA double strand sequences and linear process the vectors, link the shrna sequence with the vector, and screen the target recombined target, sequence the vector, and provide the recombined lentivirus shrna vectors to our customers.
16 TOOLSilent Lentivirus Packaging Service (in vitro) TOOLSilent Lentivirus can efficiently introduce and stably express lentiviral constructs in primary cells, stem cells, non-dividing cells and cells are difficult to transduce. A set of four shrnas (three target shrna plus one negative control shrna) lentiviruses Based on the gene information (sequence or Gene ID) provided by the users, we designed the shrna sequences and package with highly efficient, transduction-ready lentiviruses. Optional A set of four shrnas (three target shrna plus one negative control shrna) lentiviruses Procedures (1) Target sequences screening and shrna oligonucleotides designing (2) insert designed oligonucleotides into lentiviral vectors (3) using packaging cells to produce shrna lentivirus (4) transducing target cells with shrna lentivirus Users can select one of the following vectors: PGLV1/U6/GFP PGLV2/U6/Puro
17 PGLV3/H1/GFP+Puro PGLV9/U6/RFP PGLV10/U6/RFP/Puro
Convoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationTransIT -LT1 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2300 INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationjetprime in vitro DNA & sirna transfection reagent PROTOCOL
jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful transfection reagent based on a polymer formulation manufactured at Polyplus-transfection. jetprime
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationTHE DELIVERY EXPERTS PROTOCOL
THE DELIVERY EXPERTS jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful molecule based on a polymer formulation manufactured at Polyplustransfection. jetprime
More informationTransIT Transfection Reagent
INTRODUCTION TransIT -2020 is a broad spectrum transfection reagent that provides superior transfection of plasmid DNA into mammalian cells. TransIT-2020 is suitable for both transient and stable transfection
More informationTransIT -mrna Transfection Kit
INTRODUCTION TransIT -mrna Transfection Kit is designed to transfect RNA into a broad range of cell types with minimal cellular toxicity. RNA delivery avoids transcriptional regulation effects by directly
More informationTransIT -293 Transfection Reagent
TransIT -293 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2700 INTRODUCTION TransIT -293 Transfection Reagent is specifically optimized to provide
More informationTransIT -LT1 Transfection Reagent
INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid DNA delivery in many mammalian cell types including primary cells. TransIT-LT1 is a low
More informationTransIT Transfection Reagent
INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent that provides exceptional transfection of plasmid DNA into mammalian cells. TransIT-2020
More informationProduct: Arrest-In TM Transfection Reagent for RNAi
Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationsirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
More informationUser s Guide MegaTran 1.0 Transfection Reagent
User s Guide MegaTran 1.0 Transfection Reagent Package Contents and Storage Conditions... 2 Related products... 2 Introduction... 2 Production and Quality Assurance:... 3 Experimental Procedures... 3 Transfection
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationAvalanche -Omni Transfection Reagent
The Transfection & Gene Expression Experts Avalanche -Omni Transfection Reagent Cat. No. EZT-OMNI-1 Description Size: 0.75 ml 1.5 ml Store at 4 C Avalanche -Omni Transfection Reagent is a proprietary lipid-polymer
More informationTransIT -293 Transfection Reagent
INTRODUCTION TransIT -293 Transfection Reagent is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in HEK 293 and cell types of associated lineage. TransIT-293 provides
More informationTransIT -Keratinocyte Transfection Reagent
TransIT -Keratinocyte Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2800 INTRODUCTION TransIT -Keratinocyte Transfection Reagent is specifically
More informationTransIT -BrCa Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5500 INTRODUCTION TransIT -BrCa Transfection Reagent is specifically optimized to provide exceptional transfection efficiency
More informationTransfection Reagent INTRODUCTION SPECIFICATIONS MATERIALS. For Research Use Only. Materials Supplied. Materials required, but not supplied
TransIT-Neural Transfection Reagent INTRODUCTION TransIT-Neural Transfection Reagent is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in various neural cell types.
More informationTHE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL
THE DELIVERY EXPERTS INTERFERin in vitro sirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna transfection reagent that ensures efficient gene silencing and reproducible transfection
More informationTransIT -CHO Transfection Kit
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2170 INTRODUCTION TransIT -CHO Transfection Kit is specifically optimized to provide exceptional transfection efficiency
More informationINTERFERin in vitro sirna/mirna transfection reagent PROTOCOL
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in
More informationjetpei -Macrophage in vitro DNA transfection reagent PROTOCOL
jetpei - in vitro DNA transfection reagent PROTOCOL DESCRIPTION jetpei - allows DNA transfection of macrophages and macrophage-like cells. It contains a mannose-conjugated linear polyethylenimine that
More informationSilencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna
Catalog #: Various Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna General Product Details and User Information Refer to page
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationTransfection Kit Protocol for MIR 2900, 2904, 2905, 2906
TransIT-HeLaMONSTER Transfection Kit INTRODUCTION TransIT-HeLaMONSTER Transfection Kit is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in HeLa cells and cell types
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationTransIT -Prostate Transfection Kit
INTRODUCTION TransIT -Prostate Transfection Kit is specifically optimized to provide exceptional transfection efficiency of plasmid DNA in Prostate cell types. Generally, prostate cell types have been
More informationTransIT -LT1 Transfection Reagent
Protocol for Product Nos. MIR 2300, 2304, 2305, 2306 i n t r o d u c t i o n The easy to use TransIT-LT1 (Low Toxicity) Transfection Reagent provides superior transfection efficiency, cell viability, and
More informationMISSION shrna Library: Next Generation RNA Interference
Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology
More informationDharmacon TM solutions for studying gene function
GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative
More informationTransIT-PRO Transfection Reagent Protocol for MIR 5740 and 5750
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/5740 INTRODUCTION TransIT-PRO Transfection Reagent was developed by empirically testing proprietary lipid and polymer
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationLenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus
G e n e C o p o eia TM Expressway to Discovery Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus Cat. No. HPK-LvTR-20 (20 transfections) Cat. No. HPK-LvTR-40 (40
More informationINTERFERin sirna transfection reagent
INTERFERin in vitro sirna Transfection Protocol Company Information... 2 Product Information... 3 1. Standard sirna transfection of adherent cells... 4 (forward transfection)... 4 1.1 Cell seeding... 5
More informationCignal Reporter Assay Handbook
January 2011 Cignal Reporter Assay Handbook For cell-based pathway activity assays Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and
More informationGeneCellin TM Transfection Reagent Protocol
GeneCellin TM Transfection Reagent Protocol Table of content Description......3 Content......3 Storage......3 Certificate of quality......4 Parameters influencing transfection efficiency......4 Nucleic
More informationjetpei -FluoF in vitro DNA Transfection Protocol
jetpei -FluoF in vitro DNA Transfection Protocol Company Information... 2 Product Information... 3 Contact our Technical Assistance and Scientific Advice Service... 4 1.Transfection protocol... 5 1. 1.
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationLabBOOK VIROMER BLUE VIROMER GREEN. sirna /mirna transfection
LabBOOK VIROMER BLUE VIROMER GREEN sirna /mirna transfection Contact General information Bettina Weber (Biologist) +49 345 55 59 625 bettina.weber@lipocalyx.de Dr. Sandra Lagauzère (Biologist) +49 345
More informationin vivo-jetpei DNA & sirna delivery reagent
in vivo-jetpei DNA & sirna Delivery Protocol Company Information... 2 Product Information... 3 In vivo Delivery Protocol... 5 1. Reagents required... 5 2. Recommended amount of nucleic acid and injection
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationLentiviral shrna expression Cloning Kit User Manual for generating shrna expression lentivectors
Lentiviral shrna expression Cloning Kit User Manual for generating s Cat# Product Name Amount Application LTSH-H1-GB peco-lenti-h1-shrna(gfp-bsd) cloning kit with GFP-Blasticidin selection LTSH-H1-GP peco-lenti-h1-shrna(gfp-puro)
More informationCHOgro Expression System
SDS and Certificate of Analysis available at mirusbio.com/6260 INTRODUCTION The CHOgro Expression System is an optimized platform for transient, high titer protein production in suspension CHO derived
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationGaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationCalcium Phosphate Transfection Kit INSTRUCTION MANUAL.
Calcium Phosphate Transfection Kit INSTRUCTION MANUAL www.ozbiosciences.com OZ Biosciences / Protocol Calcium Phosphate Transfection Kit / www.ozbiosciences.com - 1 - Calcium Phosphate Transfection Kit
More informationjetpei In vitro Transfection Protocol
jetpei Cationic polymer transfection reagent In vitro Transfection Protocol 101-05 0.5 ml (250 transfections in 24-well plates) 101-05N 0.5 ml 50ml of 150 mm NaCl (250 transfections in 24-well plates)
More informationAlt-R CRISPR-Cas9 system:
Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research
More informationFectoPRO DNA transfection kit for Bioproduction PROTOCOL
DNA transfection kit for Bioproduction PROTOCOL DESCRIPTION transfection kit is specifically designed for enhanced Transient Gene Expression using low DNA amounts, in suspension CHO and HEK-293 cells as
More informationSMARTvector Lentiviral shrna
A Horizon Discovery Group Company SMARTvector Lentiviral shrna Contents 1 Introduction to SMARTvector Lentiviral shrnas... 3 SMARTvector Lentiviral shrna vector... 3 Recommended experimental controls...
More informationSureSilencing shrna Plasmid Handbook
March 2011 SureSilencing shrna Plasmid Handbook For genomewide, plasmid-based RNA interference Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative
More informationsherwood UltramiR shrna Lentiviral Target Gene Set in pzip
sherwood UltramiR shrna Lentiviral Target Gene Set in pzip TLHSU1400 (human), TLMSU1400 (mouse), TLRSU1400 (rat) Format: Bacterial glycerol stock sherwood-ultramir shrna sherwood-ultramir short hairpin
More informationColor-Switch CRE recombinase stable cell line
Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationTransIT -VirusGEN Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6700 INTRODUCTION Adeno-associated virus (AAV) is a nonenveloped, single stranded DNA virus from the Paroviridae family
More informationNucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103
The nucleic acids delivery specialists design our transfection reagents. Our formulations provide superior transfection efficiency and cell viability. This complete range includes TransIT reagents, based
More informationAntibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies
G0656 pfiv3.2rsvmcs Coordinates Plasmid Features 1-682 CMV/5 LTR hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1695-2075 RSV Promoter 2104-2222 Multiple Cloning Sites 2244-2839 WPRE 2868-3009
More informationTransfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent
APPLICATION NOTE Page 1 Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent Authors: Amelia L. Cianci 1, Xun Cheng 1 and Kerry P. Mahon 1,2 1 Stemgent Inc.,
More informationVersatility and performance of Lipofectamine Stem Transfection Reagent
PPLICTION NOTE Stem Transfection Reagent Versatility and performance of Stem Transfection Reagent Introduction The ability of stem cells to self-renew and differentiate into various specialized cell types
More informationPlasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only
Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple
More informationARN interférence Technologies : sirna, shrna, mirna
ARN interférence Technologies : sirna, shrna, mirna LabCluster Tour 2014 - Delphine Ayache sigma-aldrich.com Methods for Modulating Gene Expression DNA RNA Protein Transcription Translation Genome Editing:
More informationXfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationRNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.) April 8, 2008 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by
More informationBLOCK-iT Transfection Optimization Kit
BLOCK-iT Transfection Optimization Kit Catalog no. 13750-047 Version B 27 June 2007 25-0718 User Manual ii Table of Contents Table of Contents...iii Kit Contents and Storage... v Accessory Products...vi
More informationTRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec.
TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec. 15, 2013 Outline Overview of transfection TransfeX Primary/hTERT
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationThermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol
Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationFuGENE HD Transfection Reagent
For life science research only. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. FuGENE HD Transfection Reagent For the transient and stable transfection of animal and insect cells Cat. No.
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationThe RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: Lentivirus production of shrna, CRISPR, or ORF-pLX clones in 10 cm dishes or 6- well plates Current Revision Date: 6/3/2015 RNAi Platform,, trc_info@broadinstitute.org
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationTransfection. How do you study and control gene expression? How do you detect mycoplasma contamination?
PROTEIN FUNCTION & ANALYSIS Transfection How do you study and control gene expression? How do you detect mycoplasma contamination? How do you ensure the success of your RNA or protein transfection? TRANSFECTION
More informationFosmidMAX DNA Purification Kit
Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationLaboratory #7 PCR PCR
1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis
More informationThe following manual contains information about and Instructions for the following psuper.retro vectors: VEC-PRT-0002 (circular)
psuper.retro.puro : Manual A Vector System for Expression of Short Interfering RNA The following manual contains information about and Instructions for the following psuper.retro vectors: Vector Name psuper.retro.puro
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationTransfection Reagents That Really Work
Transfection Reagents That Really Work non-toxic, biodegradable, highly efficient, serum-compatible Available for DNA,, protein, stem cells www.clontech.com/xf P L A S M I D T R A N S F E C T I O N R E
More informationThermo Scientific Open Biosystems LentiORF plex-mcs Vector
Technical Manual Thermo Scientific Open Biosystems LentiORF plex-mcs Vector Catalog #: OHS4735 Product Description The plex-mcs Empty Vector is the lentiviral plex vector containing a multiple cloning
More informationTransfection of eukaryotic cells. Bryon Anderson
Transfection of eukaryotic cells Bryon Anderson Presentation Overview What is Transfection? Transfection vs. Transformation Purpose of Transfection How it Works Experimental method/process Strengths and
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationWST-1 Cell Proliferation Assay Kit
WST-1 Cell Proliferation Assay Kit Item No. 10008883 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationExpression Arrest TM GIPZ lentiviral shrnamir
Expression Arrest TM GIPZ lentiviral shrnamir Technical support: 1-888-412-2225 Page 1 Expression Arrest TM GIPZ lentiviral shrnamir Catalog # RHS4430, RHS4531, RHS4477, RMM4431, RMM4532, RMM4501 CONTENTS
More information