What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
|
|
|
- Phebe Cook
- 6 years ago
- Views:
Transcription
1 What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
2 Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as instructed by DNA. What are proteins made of? Amino Acids linked together. How does our body know how to link them together? It reads the DNA blueprint.
3 Does DNA make proteins all by itself? NO!!!!!!!!!!!!!!!!!!!! The instructions are transferred from a gene (segment of DNA) to an RNA molecule. This process is called transcription. WAIT!!!! What is RNA???
4 RNA (Ribonucleic acid) Type of nucleic acid (made of nucleotides). Single stranded. Has a sugar called ribose (hence the name). Contains Nitrogen bases cytosine, guanine, adenine, and uracil. ***This means that A pairs with U, but T still pairs with A. 3 types or RNA: mrna, trna, rrna. Does not stay in the nucleus, carries the code to ribosomes in the cytoplasm.
5 Has Ribose Has Deoxyribose Has adenine Has guanine Has uracil Has thymine Has cytosine Double strand Single strand Stays in nucleus Leaves nucleus DNA RNA
6 Has Ribose Has Deoxyribose DNA RNA Has adenine X X Has guanine X X Has uracil Has thymine Has cytosine X X Double strand Single strand Stays in nucleus Leaves nucleus X X X X X X X X
7 Transcription and Translation Transcription: The process by which genetic information is copied from DNA to RNA. Translation: information from mrna is used to make proteins. Long story short: DNA -> goes through replication -> transcription -> translation -> proteins are made (gene expression / protein synthesis.
8 Steps of Transcription RNA polymerase: the primary transcription enzyme RNA Polymerase binds to promoters causing the DNA to unwind and separate. Then it attaches to the first DNA nucleotide of the template DNA chain. Begins adding complementary RNA (mrna) nucleotides to the newly formed RNA molecule. At the termination signal, RNA polymerase releases DNA and RNA. From this we get 3 different RNA molecules that are all involved in protein synthesis.
9 Three Types of RNA Messenger RNA (mrna): copies the DNA of a gene in a process called transcription. Ribosomal RNA (rrna): takes the mrna code and translates it into a protein in a process called translation. Transfer RNA (trna): brings one specific amino acid to the rrna.
10 Codons and Anticodons Codon: the basic unit of the genetic code: a sequence of 3 adjacent nucleotides in DNA or mrna that encodes an amino acid Anticodon: 3 nucleotide sequence in a trna molecule that is complementary to, and base pairs with a specific codon in mrna
11 The Genetic Code Genetic code: a sequence of bases in DNA or RNA that translates into the sequence of amino acids in a protein How many amino acids are there? 20 How many bases are needed to express one amino acid? Three
12 The Genetic Code Start at the letter on the left, then move to the top, and then the letter on the right to determine the correct amino acid.
13 Start at the big letter in the center and then work your way to the outside to determine the correct amino acid.
14 3 Stages of Translation Initiation Ribosome attaches at a specific site on the mrna (the start codon, AUG) Elongation Peptide bonds join each amino acid Termination When a stop codon is reached, the protein is released ***Then it starts on the next one!!!
15
16 Hints Starting at DNA and working all the way through DNA to complementary DNA A and T pair, C and G pair. DNA to mrna: C and G pair A in DNA pairs with a U T in DNA pairs with A. mrna to trna: A and U pair, C and G pair. mrna to amino acids: 3 letters at a time, use codon chart.
17 Let s go through the whole process now! On the bottom of your page, on the left hand side write the following words: DNA Complementary DNA mrna trna Amino acid
18 Let s fill each section in: DNA: TACAACGGTCTCAGCACGATT What is the complementary DNA? ATGTTGCCGAGAGTCGTGCTAA What is the mrna? (remember, you want to look off of your original strand, not the complementary/daughter strand, and this time A goes to U) AUGUUGCCAGAGUCGUGCUAA What is the trna? UACAACGGUCUCAGCACGAUU
19 Continued What are the amino acids? (Use Page 209 in the book, and remember to start listing them at the start codon. You are deciphering the code by looking at the mrna.) Methionine, leucine, proline, glutamic acid, serine, cysteine, STOP
RNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
RNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
TRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
Transcription and Translation
Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism
Activity A: Build a DNA molecule
Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
Protein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
Click here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
Gene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
Protein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
Adv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
Protein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
Gene Expression REVIEW Packet
Name Pd. # Gene Expression REVIEW Packet 1. Fill-in-the-blank General Summary Transcription & the Big picture Like, ribonucleic acid (RNA) is a acid a molecule made of nucleotides linked together. RNA
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
Chapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
From Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
The common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016
Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red
DNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
DNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
DNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
Chapter 17 Nucleic Acids and Protein Synthesis
Chapter 17 Nucleic Acids and Protein Synthesis Nucleic Acids Nucleic acids are the components that make up the genetic material DNA (deoxyribonucleic acid). DNA is a macromolecule which contains all the
DNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
DNA/RNA. Transcription and Translation
DNA/RNA Transcription and Translation Review DNA is responsible for controlling the production of proteins in the cell, which is essential to life DNA RNA Proteins Chromosomes contain several thousand
DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
DNA Structure and Protein synthesis
DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
STUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
Central Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
Prokaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
From Gene to Protein Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
Nucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
Bundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
Ch. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
From Gene to Protein via Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein via Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
Comparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function.
HASPI Medical Biology Lab 0 Purpose Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. Background http://mssdbio.weebly.com/uploads/1//7/6/17618/970_orig.jpg
2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.
From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how
Unit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
Chapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
Microbiology: The Blueprint of Life, from DNA to protein
Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
Protein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
UNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
DNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
GENETICS and the DNA code NOTES
GENETICS and the DNA code NOTES BACKGROUND DNA is the hereditary material of most organisms. It is an organic compound made of two strands, twisted around one another to form a double helix. Each strand
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
DNA Begins the Process
Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process
Pre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
DNA REPLICATION REVIEW
Biology Ms. Ye DNA REPLICATION REVIEW 1. Number the steps of DNA replication the correct order (1, 2, 3): Name Date Block Daughter strands are formed using complementary base pairing DNA unwinds The DNA
DNA & DNA Replication
DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?
1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).
1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil
RNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
Protein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
Molecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
Frederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines
DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic
GAUTENG DEPARTMENT OF EDUCATION SENIOR SECONDARY INTERVENTION PROGRAMME. LIFE SCIENCE Grade 12 Session 9: Nucleic Acids DNA and RNA (LEARNER NOTES)
Learner Note: Please ensure that you understand that the nucleus is an organelle located in a cell. Go through the structure of DNA and RNA very carefully. You MUST understand the structure and combination
DNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
Chapter 15 DNA and RNA
Chapter 15 DNA and RNA www.mrcbiology.com 1 Variation Variation means that individuals in a species have different characteristics to one another. Acquired Variation are not inherited. e.g learnt during
Read and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
DNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
Introduction. Everyone knew the winner would get a dynamite prize. Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Introduction In the mid 1900 s, some classic experiments showed that it was the DNA in chromosomes that actually carried the information, and the race was on to figure out how DNA worked. Everyone knew
DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR
UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR RNA, as previously mentioned, is an acronym for ribonucleic acid. There are many forms
DNA Structure, Nucleic Acids, and Proteins
DNA Structure, Nucleic Acids, and Proteins Strands Topic Primary SOL Related SOL Life at the Molecular and Cellular Level; Scientific Investigation Investigating DNA structure, nucleic acids, and protein
Name Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
BEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in