Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Size: px
Start display at page:

Download "Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)"

Transcription

1 Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the alphabet i. Letters strung together make words sentences stories b. DNA distinct series (triplets) of the four nucleotides encode the 20 amino acids i. Amino acids strung together make proteins (structural/ functional) cells organisms II. Overview (section 7.1) a. Central Dogma of Molecular Biology (fig. 7.1) i. DNA replication ii. Transcription iii. Translation b. Characteristics of DNA (p ; p ) i. Composed of deoxyribonucleotides (figure 2.22) 1. Basic structure - base, phosphate group, deoxyribose 2. Four different bases - adenine, guanine, cytosine, thymine (figure 2.23) ii. Deoxyribonucleotides are covalently bonded in chains (figure 7.3) 1. 5 end (phosphate) 2. 3 end (hydroxyl) 3. Double stranded 4. Strands are anti-parallel 5. Strands are complementary 6. Base-pairing rules: a. A-T b. G-C iii. Double helix iv. Sugar-phosphate backbone c. Characteristics of RNA (p. 34, 164) i. Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine ii. Sequence is "identical" to a stretch of one strand of DNA; complementary to other (figure 7.7) iii. Three functional types of RNA, all single stranded: 1. Messenger RNA (mrna) 2. Ribosomal RNA (rrna) 3. Transfer RNA (trna) III. DNA Replication (section 7.2) a. Bi-directional, semi-conservative (figure 7.4) b. DNA polymerase adds proper nucleotide to the 3 end of the new chain (figure 7.5) i. Synthesis is 5 3 c. DNA polymerases generally correct errors during replication ( proofreading ) i. Error rate = 1/billion nucleotides d. Second round of replication can start before first is complete e. DNA polymerases require a primer (they can only add nucleotides onto an existing chain) f. Bacterial DNA replication is initiated at a single distinct region (origin of replication = ori) i. A short stretch of RNA (complementary to DNA) is synthesized IV. The Replication Fork (figure 7.6) a. Leading strand (continuous synthesis) b. Lagging strand (discontinuous synthesis) 1

2 V. Replication vs. Transcription a. DNA polymerase vs. RNA polymerase b. deoxyribonucleotides vs. ribonucleotides c. thymine vs uracil Gene Expression Overview: transcription translation Coded by DNA: RNA transcripts protein molecules Protein A Protein B Protein C Protein D Protein E VI. Bacterial Gene Expression - Transcription (p ) a. Transcription is initiated at a promoter b. Transcription stops at a terminator c. Initiation - RNA polymerase binds to promoter (guided by sigma factor) d. Elongation - RNA polymerase synthesizes RNA 5 3 (no primer needed) e. Termination - f. Terms to note: i. Monocistronic ii. Polycistronic (prokaryotes only) iii. Upstream iv. Downstream v. Plus strand vi. Minus strand 2

3 g. Orientation of the promoter determines which strand serves as the template Figure 7.8 VII. Bacterial Gene Expression Translation (p ) a. Ribosomes read mrna; facilitate conversion of the encoded information into proteins b. The role of mrna - carries encoded instructions for synthesis of a polypeptide i. Genetic code correlates codon to amino acid (figure 7.10) ii. Genetic code is degenerate iii. Genetic code encodes "start" and "stop" signals iv. Three possible reading frames; only one is generally used (figure 7.11) c. The role of ribosomes i. "Workbench" of translation; "read" the mrna one codon at a time (proper reading frame is critical; see figure 7.11) ii. Ribosome moves along RNA in the 5' to 3' direction iii. Ribosome structure (figure 7.12) iv. Eukaryotes (monocistronic messages) translation starts at first AUG v. Prokaryotes (monocistronic and polycistronic messages) translation begins at first AUG after a ribosome-binding site d. The role of trna i. trnas are the keys that decipher the code ii. Each trna carries a specific amino acid (figure 7.13) iii. The anticodon, complementary to a codon, binds mrna e. Initiation of translation i. In prokaryotes, ribosome-binding site, first AUG after that (critical because of polycistronic messages) ii. In eukaryotes, first AUG (moncistronic messages) VIII. Process of Translation a. Initiation b. Elongation i. Translocation ii. Elongation factors c. Termination - stop codon 3

4 IX. Eukaryotic Gene Expression (section 7.4) X. Regulation of Bacterial Gene Expression (section 7.5) a. Constitutive enzymes b. Inducible enzymes c. Repressible enzymes XI. Sensing and Responding to Environmental Fluctuations (section 7.7) a. Signal transduction i. Two-component regulatory systems b. Quorum sensing c. Natural selection XII. Mechanisms of regulation (in prokaryotes) a. Alternative sigma factors b. DNA-binding proteins - lac operon as an example (part of figure 7.19) i. Negative control - repressors bind, blocking transcription ii. Positive control - activators bind, facilitating transcription iii. Activity of repressors/activators can be controlled (allosteric) 4

5 XIII. Review Question 1. What is the Central Dogma of Molecular Biology? 2. Distinguish between replication, transcription, and translation. 3. Describe the basic structure of a deoxynucleotide (i.e. name the three general parts). 4. Which 4 bases are found in DNA? 5. What are the "base pairing rules"? 6. Describe the basic structure of a DNA molecule. 7. How is RNA different from DNA? 8. What are the three functional types of RNA? 9. DNA replication is semi-conservative. What does this mean? 10. Where is DNA synthesis initiated on a bacterial chromosome, and how many of these sites are on a bacterial chromosome? 11. How does a cell that takes 40 minutes to replicate the chromosome divide every 20 minutes? 12. Nucleotides are added onto which end of a DNA (or RNA chain), and what chemical group is found at that end? 13. What is the name of an enzyme that synthesizes DNA? 14. What is a primer? 15. With respect to DNA synthesis, what is "proofreading"? 16. Describe the difference between leading and lagging strand synthesis, and why this difference is necessary. 17. What two general processes are involved in gene expression? 18. Where does transcription begin, and where does it end? 19. What is a sigma factor? 20. How is a polycistronic message different from a monocistronic one? 21. Is a promoter upstream, or downstream, of the terminator? 22. What is the significance of the 3'OH on a nucleotide? 23. What is a codon vs. an anticodon? 24. In prokaryotes where does translation begin and where does it end? 25. Describe the key differences between prokaryotic and eukaryotic gene expression. 26. Give an example of the function of the following types of enzymes: constitutive, inducible, and repressible. 27. Compare and contrast the roles of activators and repressors. 28. Describe the mechanism of two-component regulatory systems. 29. Describe the mechanism of quorum sensing. 30. Describe how some cells use natural selection as a means of responding to environmental fluctuations. 5

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Microbiology: The Blueprint of Life, from DNA to protein

Microbiology: The Blueprint of Life, from DNA to protein Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

DNA, Replication and RNA

DNA, Replication and RNA DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein? Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

PUC Vikasana Program- 2012

PUC Vikasana Program- 2012 Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the

More information

Unit VII DNA to RNA to protein The Central Dogma

Unit VII DNA to RNA to protein The Central Dogma Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase

More information

Central Dogma. 1. Human genetic material is represented in the diagram below.

Central Dogma. 1. Human genetic material is represented in the diagram below. Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith

CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:

More information

STUDY GUIDE SECTION 10-1 Discovery of DNA

STUDY GUIDE SECTION 10-1 Discovery of DNA STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

Protein Synthesis. OpenStax College

Protein Synthesis. OpenStax College OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

Chapter 17 Nucleic Acids and Protein Synthesis

Chapter 17 Nucleic Acids and Protein Synthesis Chapter 17 Nucleic Acids and Protein Synthesis Nucleic Acids Nucleic acids are the components that make up the genetic material DNA (deoxyribonucleic acid). DNA is a macromolecule which contains all the

More information

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases. DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Activity A: Build a DNA molecule

Activity A: Build a DNA molecule Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions

More information

DNA Replication and Protein Synthesis

DNA Replication and Protein Synthesis DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). 1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

TRANSCRIPTION AND TRANSLATION

TRANSCRIPTION AND TRANSLATION TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.

More information

Chapter 2 - DNA MC [37 marks]

Chapter 2 - DNA MC [37 marks] Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

UNIT 4. DNA, RNA, and Gene Expression

UNIT 4. DNA, RNA, and Gene Expression UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain

More information

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

2. From the first paragraph in this section, find three ways in which RNA differs from DNA. Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

DNA- THE MOLECULE OF LIFE. Link

DNA- THE MOLECULE OF LIFE. Link DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

DNA- THE MOLECULE OF LIFE

DNA- THE MOLECULE OF LIFE DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,

More information

Transcription and Translation

Transcription and Translation Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism

More information

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish

More information

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Pre-Lab: Molecular Biology

Pre-Lab: Molecular Biology Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double

More information

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and

More information

DNA: The Molecule of Heredity

DNA: The Molecule of Heredity 1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

DNA Replication AP Biology

DNA Replication AP Biology DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.

More information

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

More information

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar

More information

Comparing RNA and DNA

Comparing RNA and DNA RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd

More information

DNA Structure and Protein synthesis

DNA Structure and Protein synthesis DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making

More information

Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.

Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc. Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is

More information

DNA, RNA and Protein Synthesis

DNA, RNA and Protein Synthesis By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude

More information

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome. Bio160 General Biology DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

More information

3. INHERITED MUTATIONS

3. INHERITED MUTATIONS THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016 Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red

More information

DNA & Protein Synthesis UNIT D & E

DNA & Protein Synthesis UNIT D & E DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information

More information

Molecular Biology of the Gene

Molecular Biology of the Gene Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

O C. 5 th C. 3 rd C. the national health museum

O C. 5 th C. 3 rd C. the national health museum Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule. From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how

More information

GENETICS and the DNA code NOTES

GENETICS and the DNA code NOTES GENETICS and the DNA code NOTES BACKGROUND DNA is the hereditary material of most organisms. It is an organic compound made of two strands, twisted around one another to form a double helix. Each strand

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information