Coleman et al., Supplementary Figure 1

Size: px
Start display at page:

Download "Coleman et al., Supplementary Figure 1"

Transcription

1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential thymidine and nocodazole treatment and fixed at 2.5 h (G1), 4 h (early S), or 5.5 h (mid S) post nocodazole release. Cells were labeled with BrdU 3 minutes prior to fixation and staining with the indicated antibodies. Scale bar = 1 mm.

2 % Remaining Cell cycle length (h) Cell Number Coleman et al., Supplementary Figure 2 C) -CFP-HA UV (min): YFP-HA- -CFP-HA Anti -HA Anti- (light) Doxycycline (ng/ml): CFP-HA YFP-HA- Anti Anti -CFP-HA YFP-HA- Anti- (dark) Anti D) ng/ml 2 ng/ml ng/ml 2 ng/ml Time (min) YFP -CFP E) C 4C Doxycycline (ng/ml) 2 75 ng/ml ng/ml ng/ml dox dox dox Supplementary Figure 2. YFP- and -CFP fusion protein expression and validation. ( Asynchronously proliferating U2OS cells expressing -CFP-P2A-YFP- were treated with 2 J/m 2 UV and collected at the indicated times. The asterisk () marks the predicted position of the uncleaved fusion which is undetectable. ( Quantifications of immunoblots from A. (C) U2OS cells were treated with the indicated concentrations of doxycycline to induce expression of YFP- and -CFP fusion proteins; fusions were detected by immunoblotting. (D) Cells treated with the indicated doxycycline concentrations as in (C) were analyzed by flow cytometry for DNA content. (E ) Live cell movies of cells induced with the indicated doxycycline concentrations were analyzed for cell cycle length. Twenty cells ( ng/ml and 2 ng/ml) and 19 (75 ng/ml) cells were counted from one mitotic event to the next mitotic event. Error bars indicate standard deviations.

3 Cell Number HA- ln (% remaining) band intensity % remaining Coleman et al., Supplementary Figure 3 Fraction loaded (-UV) Time (min) post-uv i) 1. ii) (dark) (light) tubulin iii) fraction loaded Time (min) Time (min) post-uv y = -.41x t 1/2 () = 11 min +CHX UV (min): PR-Set7 HA CHX C) UV (J/m 2 ): HA- vector D) J/m 2 1 J/m 2 2 J/m 2 5 J/m 2 E) HeLa HCT116 UV (min): PR-Set F) K153A UV (min): HA- K153A C 4C WT-HA- (no UV) Supplementary Figure 3. protein degradation is independent of DNA damage-inducible expression. (. Example of semi-quantitative immunoblot analysis of substrate degradation kinetics. (Lanes 1-6, (i): Two-fold serial dilutions of HCT116 cell lysate were immunoblotted for endogenous and tubulin (light and dark exposures are shown). Lanes 7-12, (ii): HCT116 cells were irradiated with 2 J/m 2 UV, harvested at the indicated time points, and probed for endogenous and tubulin. Band intensities from multiple exposures were used to generate graphs of lysate loaded (i) and degradation (ii). (iii) Semi-log plot of % remaining values used for half-life determinations. ( HCT116 cells were subjected to 2 J/m 2 UV and treated with cycloheximide (1 µg/ml) immediately after irradiation (lanes 1-6) or left untreated (lanes 7-12). Cells were harvested at the indicated time points for immunoblot analysis. (C) Asynchronous HCT116 cells were treated with the indicated doses of UV and collected after 24 h for immunoblot analysis. (D) Cells treated as in (C) were analyzed by flow cytometry for DNA content. HCT116 cells stably expressing wild-type HA-tagged used in Figure 4A are included for comparison. (E) HeLa cells were subjected to a UV time-course and compared to HCT116 cells. (F) HCT116 cells expressing ectopic HA- deficient for TRIM39 binding (K153 were treated with 2 J/m 2 and harvested at the indicated time-points for immunoblot analysis of ectopic and endogenous levels.

4 % Remaining % Remaining Coleman et al., Supplementary Figure 4 PIP HA- UV (min): P21 PIPm tubulin 1 PIPm- endogenous Time (min) key a.a: () ---MEQRRVTDFFARRRPG PR-Set7 GKTQQNRKLTDFYPVRRSS GRKRRQTSMTDFYHSKRRL PIPm GRKRRQTSAAAAAHSKRRL C) Δ (15 546) -HA ΔPIP--HA (anti-h UV (min): tubulin 1 PIP endogenous Time (min) Supplementary Figure 4. Mutation of PIP degron sequences impairs CRL4 Cdt2 -mediated proteolysis. ( Cells expressing ectopic HA-tagged bearing alanine substitutions in amino acids were treated with 2 J/m 2 UV and harvested at the indicated time-points for immunoblot analysis. ( Alignment of the PIP degron sequences from human, PR-Set7, and. Basic residues are in magenta, hydrophobic residues in green, and the conserved T and D common to PIP degrons are in blue. (C) lacking the native PIP degron and tagged at the C-terminus was expressed from a doxycycline-inducible promoter in U2OS cells (2 ng/ml doxycycline), then analyzed as in A.

5 Cell Number Cell Number Coleman et al., Supplementary Figure 5 Doxycycline (ng/ml) : PIP --YFP YFP-WT- (-) YFP-WT PIP - -YFP Endo YFP-WT- PIP --YFP ng/ml ng/ml 1 ng/ml 1 ng/ml 3 ng/ml 3 ng/ml 2 ng/ml 2 ng/ml 2C 4C DNA Content 2C 4C DNA Content C) YFP-WT- PIP --YFP UV (min): PIP --YFP YFP-WT- Endo. 75 kda Anti- light Anti- dark Supplementary Figure 5. Validated YFP- and PIP--YFP fusion regulation and function. ( Asynchronous U2OS cells expressing either YFP (Venus)- or PIP--YFP fusions were induced with the indicated concentrations of doxycycline and then subjected to anti- immunoblot analysis. ( indicates a non-specific band that serves as a loading control.) ( Flow cytometry analysis of DNA content of cells expressing YFP fusion proteins shown in (. Doxycycline concentrations of each cell line used in the imaging analysis in Figure 5 are underlined. (C) Asynchronous U2OS cells expressing either YFP- or PIP--YFP proteins (induced with 2 ng/ml doxycycline) were treated with 2 J/m 2 UV and collected at the indicated times for immunoblot analysis.

6 Input GST GST-WT GST-PIPm Coleman et al., Supplementary Figure 6 PCNA GST- Ponceau S GST Supplementary Figure 6. PIPm (PIP degron mutant) fails to bind PCNA DNA. ( The indicated GST fusion proteins were purified from E.coli lysates with glutathione-sepharose beads and incubated with sonicated chromatin fractions from UV-irradiated 293T cells. Bound proteins were eluted in 2X SDS buffer and subjected to immunoblot analysis after normalizing for bound GST. ( Alignment of PIP degron sequences from human, PR-Set7, and PIPm. Positions previously shown to be important for CRL4 Cdt2 -mediated degradation are shown in red.

7 Coleman et al., Supplementary Figure 7 sirna: GL2 UV(min): PIP - PIP - Endo. GAPDH UBCH Anti- (dark) Anti- (light) sirna: GL2 UV(min): PIP - UBE2G1+G Endo. Endo. GAPDH Anti- (dark) Anti- (light) sirna: UBCH8 UBE2G1 UBE2G2 GAPDH Supplementary Figure 7. The PIP degron fused to is still a substrate for the -specific E2 (UBCH8). ( HCT116 stably expressing PIP - were depleted of UBCH8 or UBE2G1 +UBE2G2 as in Shibata et al Cells were treated with cycloheximide for 1 min before 2 J/m 2 UV irradiation, collected at the indicated times after UV treatment and then analyzed for ectopic and endogenous by immunoblotting; GAPDH serves as a loading control. ( Immunoblot analysis of sirna transfected cells to assess E2 depletion.

8 h post-hu Cell Number vector vector YFP-WT- PIP --YFP Coleman et al., Supplementary Figure 8 si: post-hu (h): PIP - Venus Venus-WT- tubulin Anti- light Anti- dark si-control si-control si-+ vector 12 h post-hu si-+ WT- si-+ PIP - 2C 4C DNA Content Supplementary Figure 8. HU-mediated replication-coupled destruction and recovery. ( Immunoblot and ( flow cytometry analysis of samples from HU arrest and release experiment in Figure 7D. Cells were treated with 1 nm sirna and 1 ng/ml doxycycline as indicated.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Immunofluorescence images of different core histones and different histone exchange assay.

Immunofluorescence images of different core histones and different histone exchange assay. Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,

More information

FBH1 Catalyzes Regression of Stalled Replication Forks

FBH1 Catalyzes Regression of Stalled Replication Forks Cell Reports Supplemental Information FBH1 Catalyzes Regression of Stalled Replication Forks Kasper Fugger, Martin Mistrik, Kai J. Neelsen, Qi Yao, Ralph Zellweger, Arne Nedergaard Kousholt, Peter Haahr,

More information

PCNA-dependent regulation of p21 ubiquitylation and degradation via the CRL4 Cdt2 ubiquitin ligase complex

PCNA-dependent regulation of p21 ubiquitylation and degradation via the CRL4 Cdt2 ubiquitin ligase complex PCNA-dependent regulation of p21 ubiquitylation and degradation via the CRL4 Cdt2 ubiquitin ligase complex Tarek Abbas, 1 Uma Sivaprasad, 1 Kenta Terai, 1 Virginia Amador, 2 Michele Pagano, 2 and Anindya

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

The Bub1 Plk1 kinase complex promotes spindle checkpoint signalling through Cdc20 phosphorylation

The Bub1 Plk1 kinase complex promotes spindle checkpoint signalling through Cdc20 phosphorylation Received 1 Jul 15 Accepted 25 Jan 16 Published 25 Feb 16 The kinase complex promotes spindle checkpoint signalling through phosphorylation Luying Jia 1, Bing Li 1 & Hongtao Yu 1 DOI: 1.138/ncomms1818 OPEN

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

SUMOstar Gene Fusion Technology

SUMOstar Gene Fusion Technology Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,

More information

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK

More information

Distinct Action of the Retinoblastoma

Distinct Action of the Retinoblastoma REFERENCES CONTENT ALERTS Distinct Action of the Retinoblastoma Pathway on the DNA Replication Machinery Defines Specific Roles for Cyclin-Dependent Kinase Complexes in Prereplication Complex Assembly

More information

Lecture 8: Affinity Chromatography-III

Lecture 8: Affinity Chromatography-III Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/3/6/ra27/dc Supplementary Materials for AAA+ Proteins and Coordinate PIKK Activity and Function in Nonsense-Mediated mrna Decay Natsuko Izumi, Akio Yamashita,*

More information

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions Deborah L. Burkhart 1,2, Stacey E. Wirt 1,2, Anne-Flore Zmoos 1, Michael S.

More information

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

More information

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) 1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

Supplemental Material for Xue et al. List. Supplemental Figure legends. Figure S1. Related to Figure 1. Figure S2. Related to Figure 3

Supplemental Material for Xue et al. List. Supplemental Figure legends. Figure S1. Related to Figure 1. Figure S2. Related to Figure 3 Supplemental Material for Xue et al List Supplemental Figure legends Figure S1. Related to Figure 1 Figure S. Related to Figure 3 Figure S3. Related to Figure 4 Figure S4. Related to Figure 4 Figure S5.

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX. Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

Structural evidence for consecutive Hel308-like modules in the spliceosomal ATPase Brr2

Structural evidence for consecutive Hel308-like modules in the spliceosomal ATPase Brr2 Structural evidence for consecutive -like modules in the spliceosomal ATPase Brr2 Lingdi Zhang, Tao Xu, Corina Maeder, Laura-Oana Bud, James Shanks, Jay Nix, Christine Guthrie, Jeffrey A. Pleiss, Rui Zhao

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension.

1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension. 1 AFFINITY GST PURIFICATION Procedure for Use Glutathione Agarose 4 Resin DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding

More information

Docking of a Specialized PIP Box onto Chromatin-Bound PCNA Creates a Degron for the Ubiquitin Ligase CRL4 Cdt2

Docking of a Specialized PIP Box onto Chromatin-Bound PCNA Creates a Degron for the Ubiquitin Ligase CRL4 Cdt2 rticle Docking of a Specialized PIP ox onto Chromatin-ound PCN Creates a Degron for the Ubiquitin Ligase CRL4 Cdt2 Courtney G. Havens 1 and Johannes C. Walter 1, * 1 Department of iological Chemistry and

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Nickel NTA Agarose Cartridges 5ml are used for purification of histidine-tagged proteins in native or denaturing conditions. This cartridge can be used with an automated chromatography system,

More information

The MAP Kinase Family

The MAP Kinase Family The MAP Kinase Family Extracellular stimuli Classical MAP kinases Atypical MAP kinases MAPKKK MLK1/2/3/7; LZK RAF-1/A/B TAK1; TPL2 c-mos MEKK1-4; DLK ASK1/2; MLTK TAO1/2 ASK1 TAK1 MEKK1-4 MEKK2/3 TPL2???

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Mammalian Orc1 Protein Is Selectively Released from Chromatin and Ubiquitinated during the S-to-M Transition in the Cell Division Cycle

Mammalian Orc1 Protein Is Selectively Released from Chromatin and Ubiquitinated during the S-to-M Transition in the Cell Division Cycle MOLECULAR AND CELLULAR BIOLOGY, Jan. 2002, p. 105 116 Vol. 22, No. 1 0270-7306/02/$04.00 0 DOI: 10.1128/MCB.22.1.105 116.2002 Mammalian Orc1 Protein Is Selectively Released from Chromatin and Ubiquitinated

More information

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

7.06 Problem Set #3, Spring 2005

7.06 Problem Set #3, Spring 2005 7.06 Problem Set #3, Spring 2005 1. The Drosophila compound eye is composed of about 800 units called ommatidia. Each ommatidium contains eight photoreceptor neurons (R1 through R8), which develop in a

More information

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,

More information

Supplementary Information

Supplementary Information Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative

More information

ab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression

ab GFP ELISA Kit Instructions for Use  For the quantitative measurement of GFP protein expression ab117992 GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression This product is for research use only and is not for diagnostic use. intended www.abcam.com Table

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression ab128573 GST 6XHis-tag ELISA Kit Instructions for Use For the quantitative measurement of 6XHis-tag protein expression This product is for research use only and is not intended for diagnostic use. 1 Table

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication

MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication MBoC ARTICLE MTBP, the partner of Treslin, contains a novel DNA-binding domain that is essential for proper initiation of DNA replication Akiko Kumagai and William G. Dunphy* Division of Biology and Biological

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Nature Structural and Molecular Biology: doi: /nsmb.2937

Nature Structural and Molecular Biology: doi: /nsmb.2937 Supplementary Figure 1 Multiple sequence alignment of the CtIP N-terminal domain, purified CtIP protein constructs and details of the 2F o F c electron density map of CtIP-NTD. (a) Multiple sequence alignment,

More information

Immunoassay Kit Catalog # KCA0021. Canine. C-Reactive Protein

Immunoassay Kit Catalog # KCA0021. Canine. C-Reactive Protein Immunoassay Kit Catalog # KCA0021 Canine C-Reactive Protein BioSource International, Inc. 542 Flynn Road Camarillo, California 93012 USA Tel: 805-987-0086 800-242-0607 FAX: 805-987-3385 email: tech.support@biosource.com

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

Nickel-NTA Agarose Suspension

Nickel-NTA Agarose Suspension Nickel-NTA Agarose Suspension Agarose beads for purification of His-tagged proteins Product No. A9735 Description Nickel-NTA Agarose Suspension is an agarose-based affinity chromatography resin allowing

More information

Denis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov

Denis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov NEW AFFINITY SORBENTS FOR PURIFICATION OF RECOMBINANT PROTEINS WITH THE USE OF CHITIN-BINDING DOMAIN AS AN AFFINITY TAG Denis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov Centre

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

Human Cdc14A regulates Wee1 stability by counteracting CDK-mediated phosphorylation

Human Cdc14A regulates Wee1 stability by counteracting CDK-mediated phosphorylation MBoC ARTICLE Human Cdc14A regulates Wee1 stability by counteracting CDK-mediated phosphorylation Sara Ovejero, Patricia Ayala, Avelino Bueno, and María P. Sacristán Instituto de Biología Molecular y Celular

More information

Technical Note. Housekeeping Protein Validation Protocol

Technical Note. Housekeeping Protein Validation Protocol Technical Note Housekeeping Protein Validation Protocol Published March 2017. The most recent version of this Technical Note is posted at licor.com/bio/support. Visit us on protocols.io! Explore an interactive

More information

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated

More information

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation 1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura

More information

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain

More information

mir-24-mediated down-regulation of H2AX suppresses DNA repair

mir-24-mediated down-regulation of H2AX suppresses DNA repair Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn

More information

Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and

Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and PHT1 Protein Amounts. (A) Shoot morphology of 19-day-old nla mutants under Pi-sufficient conditions. (B) [ 33 P]Pi uptake

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko

More information

Anaphase-Promoting Complex/Cyclosome Participates in the Acute Response to Protein-Damaging Stress

Anaphase-Promoting Complex/Cyclosome Participates in the Acute Response to Protein-Damaging Stress MOLECULAR AND CELLULAR BIOLOGY, Dec. 2010, p. 5608 5620 Vol. 30, No. 24 0270-7306/10/$12.00 doi:10.1128/mcb.01506-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Anaphase-Promoting

More information

Azure Biosystems Western Blotting Workflow

Azure Biosystems Western Blotting Workflow Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for

More information

Cyclin-dependent Kinases Are Inactivated by a Combination of p21 and Thr-14/Tyr-15 Phosphorylation after UV-induced DNA Damage*

Cyclin-dependent Kinases Are Inactivated by a Combination of p21 and Thr-14/Tyr-15 Phosphorylation after UV-induced DNA Damage* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 271, No. 22, Issue of May 31, pp. 13283 13291, 1996 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Cyclin-dependent

More information

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter

More information

A novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression

A novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression Xi et al. Genome Biology (2015) 16:231 DOI 10.1186/s13059-015-0791-1 RESEARCH A novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression

More information

7.06 Cell Biology EXAM #2 March 20, 2003

7.06 Cell Biology EXAM #2 March 20, 2003 7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write

More information

Maintenance of genomic information depends on faithful replication

Maintenance of genomic information depends on faithful replication Two Different Replication Factor C Proteins, Ctf18 and RFC1, Separately Control PCNA-CRL4 Cdt2 -Mediated Cdt1 Proteolysis during S Phase and following UV Irradiation Yasushi Shiomi, a Akiyo Hayashi, a

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward Landes Bioscience www.landesbioscience.com Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward The level of HER2 expression is a predictor of antibody- HER2 trafficking behavior

More information

Received 17 July 2003/Returned for modification 10 September 2003/Accepted 21 October 2003

Received 17 July 2003/Returned for modification 10 September 2003/Accepted 21 October 2003 MOLECULAR AND CELLULAR BIOLOGY, Jan. 2004, p. 774 786 Vol. 24, No. 2 0270-7306/04/$08.00 0 DOI: 10.1128/MCB.24.2.774 786.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. The

More information

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and

More information

Supplementary Figures and Legends

Supplementary Figures and Legends Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing

More information

INSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing.

INSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing. 1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE Nickel NTA Agarose Beads DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous

More information

RayBio Human bfgf ELISA Kit

RayBio Human bfgf ELISA Kit RayBio Human bfgf ELISA Kit User Manual (for Cell Lysate and Tissue Lysate) (Revised Mar 1, 2012) RayBio Human bfgf ELISA Kit Protocol (Cat#: ELH-bFGF-001C) RayBiotech, Inc. We Provide You With Excellent

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

HALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS

HALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS HALOLINK ESIN FO POTEIN PULL-DOWN AND ANALYSIS MAJETA UH, PH.D. 1, DAN SIMPSON, PH.D. 1, JACQUI SANKBEIL, M.S. 1, DANETTE HATZELL, PH.D. 1, NATASHA KAASSINA, M.S. 1, NADINE NASSIF, M.S. 1, JAMI ENGLISH,

More information

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Rotation Report Sample Version 2 Due Date: August 9, 1998 Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Anita H. Corbett Advisor: Amy Jones Rotation 1 Abstract:

More information

Identification of PSD-93 as a Substrate for the Src Family Tyrosine Kinase Fyn*

Identification of PSD-93 as a Substrate for the Src Family Tyrosine Kinase Fyn* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 48, Issue of November 28, pp. 47610 47621, 2003 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Identification

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

Aurora Kinase-A Inactivates DNA Damage-Induced

Aurora Kinase-A Inactivates DNA Damage-Induced Cancer Cell, Volume 21 Supplemental Information Aurora Kinase-A Inactivates DNA Damage-Induced Apoptosis and Spindle Assembly Checkpoint Response Functions of p73 Hiroshi Katayama, Jin Wang, Warapen Treekitkarnmongkol,

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Mutation of Cyclin/cdk Phosphorylation Sites in HsCdc6 Disrupts a Late Step in Initiation of DNA Replication in Human Cells

Mutation of Cyclin/cdk Phosphorylation Sites in HsCdc6 Disrupts a Late Step in Initiation of DNA Replication in Human Cells Molecular Biology of the Cell Vol. 11, 4117 4130, December 2000 Mutation of Cyclin/cdk Phosphorylation Sites in HsCdc6 Disrupts a Late Step in Initiation of DNA Replication in Human Cells Utz Herbig,*

More information

CRL1-FBXO11 Promotes Cdt2 Ubiquitylation and Degradation and Regulates Pr-Set7/Set8-Mediated Cellular Migration

CRL1-FBXO11 Promotes Cdt2 Ubiquitylation and Degradation and Regulates Pr-Set7/Set8-Mediated Cellular Migration Article CRL1-FBXO11 Promotes Cdt2 Ubiquitylation and Degradation and Regulates Pr-Set7/Set8-Mediated Cellular Migration Tarek Abbas, 1,2 Adam C. Mueller, 1 Etsuko Shibata, 1 Mignon Keaton, 1,4 Mario Rossi,

More information

Supplemental Information for:

Supplemental Information for: Supplemental Information for: Antibody-induced dimerization of FGFR1 promotes receptor endocytosis independently of its kinase activity Łukasz Opaliński*, Aleksandra Sokołowska-Wędzina, Martyna Szczepara,

More information

Dual Mechanisms for the Inhibition of E2F Binding to RB by Cyclin-Dependent Kinase-Mediated RB Phosphorylation

Dual Mechanisms for the Inhibition of E2F Binding to RB by Cyclin-Dependent Kinase-Mediated RB Phosphorylation MOLECULAR AND CELLULAR BIOLOGY, Oct. 1997, p. 5771 5783 Vol. 17, No. 10 0270-7306/97/$04.00 0 Copyright 1997, American Society for Microbiology Dual Mechanisms for the Inhibition of E2F Binding to RB by

More information