The Effect of cdna on Tumor Cells Growth on Nude Mice
|
|
- Noel Beasley
- 6 years ago
- Views:
Transcription
1 The Effect of cdna on Tumor Cells Growth on Nude Mice Yiming Ding Department of Electric and Computer Engineering Portland State University, OR This project is assigned in the class Learning from Data, offered in Winter
2 Abstract: CSK homologous kinase (CHK) is a negative growth regulator of human breast cancer. This study shows that the recombinant DNA of CHK affects breast cancer growth and DNA of CHK and DNA of CSK affect ovarian cancer growth on nude mice. The data are processed statistically and demonstrate the cdnas posses inhibitory effect on tumor growth. cdna is strong, cloned copies of otherwise fragile mrna - the essential messenger element of the genes in the DNA which help in the coding of proteins. Recombinant DNA refers to DNA, which has been altered by joining genetic material from two different sources. It usually involves putting a gene from one organism into the genome of a different organism, generally of a different species. Keywords: CHK, nude mice and cancer. Introduction CSK homologous kinase (CHK) is a novel negative growth regulator of human breast cancer. In previous studies, it is well known that the CHK(DNA) possess inhibitory effect on breast cancer cells growth in vivo as well as in vitro studies. Also it is known that recombination DNA CHK shows the same effect in vitro studies. Figure 1 shows the in vivo study of CHK effect on the breast cancer MCF-7 cells. Four subtype MCF-7 cells were injected into nude mice with same amount. Type one: wild-type MCF-7 cells. Type two: MCF-7 cells transfected with pcdna-iii(vector). Type three: MCF-7 cells transfected with mutant CHK gene. Type four: MCF-7 cells transfected with CHK gene We could see that the tumors with CHK gene disappeared after 45 days and it was confirmed by dissection. The tumors with mutant CHK gene were much smaller than tumors of wild type MCF-7 and tumors with vector alone. 2
3 MCF-7 Cells Growth Curve on Nude Mice 250 Volume (cubit mm) day 10 day15 day 23 day 31 day 37 day 45 day 52 Day wild type vector CHK mt CHK Fig. 1 CHK effects on MCF-7 cells growth in vivo. Two experiments were performed in Dr. Hava Avraham s Lab, Department of Experimental Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston. The purpose was to observe the tumor growth on nude mice in the conditions of cdna, Chitosan(a compound protecting DNA from digestion of DNAse in the blood), or combinations injected into mice. We try to answer the question: Do the cdnas have an inhibitory effect on tumor growth in vivo? in our research. Methodology Animal model: 3 week-5 week old female nude mice were injected with pre-cultured breast cancer cells, under the skin of lower abdomen, cells per each mouse. The cells were resuspended in 300 µ l Phosphate Buffer Saline and Matrigel with ratio of 1:1. In the 3
4 first experiment breast cancer MDA-MB-231 cells were injected to the mice while the second experiment ovarian cancer SK-OV-3 cells were injected. Grouping: Randomly group the mice into 4 to 6 groups, 4 to 5 mice for each group (basically the number of mice in each group is equal in each experiment). Measurement: After 7-10 days injection of tumor cells, the injection sites became solid, we measured the sizes of the masses in three dimensions (length, width and depth), and followed up to the end of the experiment (at least three weeks). Measurements were taken twice a week. DNA and Chitosan preparation: 500 µ g DNA were dissolved in 200 µ l 500mM Sulfate Sodium. Chitossan were dissolved in Sulfate Sodium with 0.2% concentration. Treatment: When the tumor becomes solid, we started injection of same dose (100 µ g ) cdnas, Chitosan or combinations twice a week, except the control group. In the first experiment, we injected Chitosan, Chitosan plus pcdnaiii(vector), Chitosan plus CHK or Chitosan plus mutant CHK. In the second experiment, we injected Chitosan, Chitosan plus CHK, Chitosan plus mutant CHK, Chitosan plus CSK or Chitosan plus mutant CSK. We also gave injection of phosphate buffer saline to the mice in the control group. Experiment results: In the first experiment, after half month of the treatment, the volume of tumors in the control group was much larger than that in other groups(fig. 2). In the second experiment, after three weeks of treatment there were some differences in volume of tumors between the groups(fig. 3). 4
5 Exp. 1: cdna Effects on MDA-MB-231 Tumor Growth on Nude Mice Volume(Cubic mm) Day 3 Day 6 Day 10 Day 13 Day 17 Day 20 Day 24 control Chitosan pcdna3+chitosan CHK+Chitosan CHK(mt)+Chitosan Fig. 2 Experiment 1:cDNA s Effects on MDA-NA-231 Cells growth Exp2 cdna Treatment Effects on SK-OC-3 Cells Growth on Nude Mice Volume(Cubic mm) DAY 23 DAY 29 DAY 37 DAY 44 PBS Chitosan CHK+Chitosan CHK(mt)+Chitosan CSK+Chitosan CSK(mt)+Chitosan Fig. 3 Experiment 2:cDNA s Effects on SK-OC-3 Cells growth Statistic Analysis and Discussion 5
6 Due to the purpose of the study, the interested parameter was Growth Rate of Tumor, Y2 Y1 defined as the increasing volume of mass in certain period ( Rate = ). X X Y1: Volume at the beginning Y2: Volume at the end X1: Starting time (day) X2: Ending time (day) The first step is to calculate the growth rate of tumors from raw data in each experiment. Table 1 and table 2 show the results. Animal ID Growth rate Control Chitosan Chitosan+Vector CHK+Chitosan CHK(mt)+Chitosan Table 1. Growth rates of tumors in experiment
7 Animal ID Growth rate Control Chitosan CHK+Chitosan CHK(mt)+Chitosan CSK+Chitosan CSK(mt)+Chitosan Table 2. Growth rates of tumors in experiment 2 The second step is to test the data with lilletest, the histograms show that the growth rates are not normal distributed (fig.4 and fig.5). The third step is to compare the growth rate between control group and other groups by pair using Rank-Sum Test (Non- parametric method). This method does not require large number of samples in each group. There were two hypothesis: H0: The growth rate of the tumor in control group(µ 1 ) is equal to the rate in cdna groups(µ 2 ) at 0.05 significant level. 7
8 Fig. 4 Growth rate distribution in experiment Fig. 5 Growth rate distribution in experiment 2
9 H1: The growth rate of the tumor in control group (µ 1 ) is greater than the rate in cdna groups(µ 2 ) at 0.05 significant level. Table 3 shows the way of Rank-Sum Test To Test H 0 Versus H 1 Compute µ 1 = µ 2 µ 1 < µ 2 µ 1 > µ 2 µ 1 µ 2 µ 1 µ 2 µ Table 3.Rank-Sum Test Decision criteria of Rank-Sum test: If the observed value µ, µ1, or µ2 is less than or equal to the table critical value, we reject H0. This report computed µ 2 and chose one tailed at 0.05 significant level. Table 4 and table 5 show the outcomes of the Rank-Sum test of the two experiments. µ 2 Critical Value Control/Chitosan Control/Chitosan+Vector 0 4 Control/CHK+Chitosan 0 4 Control/CHK(mt)+Chitosan 0 4 Table 4. Rank-Sum test outcome of experiment 1 µ 2 Critical Value Control/Chitosan 4 1 Control/CHK+Chitosan 2 1 Control/CHK(mt)+Chitosan 1 1 Control/CSK+Chitosan 1 1 Control/CSK(mt)+Chitosan 2 1 Table 5. Rank-Sum test outcome of experiment 2 In the first experiment, the result of Rank-Sum test rejects H 0 in all comparison pairs. In the second experiment, the result of Rank-Sum test rejects H 0 in comparison pairs of Control 9
10 versus mutant CHK plus Chitosan and Control versus CSK plus Chitosan; but fails to reject H 0 in other comparison pairs. Conclusion Based on the statistic analysis on the experiments, we can conclude: 1. Both CHK and mutant CHK can inhibit MDA-MB-231 cells growth on nude mice. 2. CHK and mutant CSK do not inhibit SK-OV-3 cells growth on nude mice, but CSK and mutant CHK do. Acknowledgement Thank Dr. Hava Avraham s support and Yigong Fu s contribution to this project. Thank Dr. James McName s for his guides to the statistics analysis 10
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationGaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationGreen Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography
Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered
More information7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDNA Technology. B. Using Bacteria to Clone Genes: Overview:
DNA Technology A. Basic Vocabulary: is DNA from 2 different sources that is combined. is the direct manipulation of genes for practical purposes. literally means or in a test tube or flask. is the manipulation
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationMICB688L/MOCB639 Advanced Cell Biology Exam II
MICB688L/MOCB639 Advanced Cell Biology Exam II May 10, 2001 Name: 1. Briefly describe the four major classes of cell surface receptors and their modes of action (immediate downstream only) (8) 2. Please
More informationHISTORY AND BACKGROUND
Integrated Technology Platform Protein Kinases for Drug Development in Oncology Christoph Sachsenmaier and Christoph Schäechtele ProQinase GmbH, Freiburg, Germany BioTechniques 33:S101-S106 (October 2002)
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More informationSupporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis
Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined Hyperthermia for Enhanced Cancer Cell Apoptosis Birju P. Shah a, Nicholas Pasquale a, Gejing De b, Tao Tan b, Jianjie
More informationTumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationThermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol
Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationSupplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationTopical sirna for management of androgenic alopecia and oily skin Quark Pharmaceuticals, Inc.
Topical sirna for management of androgenic alopecia and oily skin 1 2017 Quark Pharmaceuticals, Inc. About Quark Founded in 1993; privately held Late stage pharmaceutical company with 2 Phase 3 programs,
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationA Level. A Level Biology. DNA Technology Questions. AQA, OCR, Edexcel. Name: Total Marks: Page 1
AQA, OCR, Edexcel A Level A Level Biology DNA Technology Questions Name: Total Marks: Page 1 Q1.(a) (i) A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how.........(2)
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationmir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
More informationthebiotutor.com 5C Genetic Modification Time: 34 minutes Total marks available: 34 Total marks achieved: Andy Todd
thebiotutor.com 5C Genetic Modification Time: 34 minutes Total marks available: 34 Total marks achieved: Q1. The picture shows a sheep that has been genetically modified to contain a human gene for making
More informationConvoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationFunctional characterisation
Me Me Ac Ac Functional characterisation How can we know if measured changes in DNA methylation and function (phenotype) and linked, and in what way? DNMT Dianne Ford Professor of Molecular Nutritional
More informationLECTURE 5: LINKAGE AND GENETIC MAPPING
LECTURE 5: LINKAGE AND GENETIC MAPPING Reading: Ch. 5, p. 113-131 Problems: Ch. 5, solved problems I, II; 5-2, 5-4, 5-5, 5.7 5.9, 5-12, 5-16a; 5-17 5-19, 5-21; 5-22a-e; 5-23 The dihybrid crosses that we
More informationUse of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D.
Use of Gene Editing Technologies in Rodents Carlisle P. Landel, Ph.D. The Mouse as A Model Mammal Small, easy to maintain, fecund Well understood genetics Similarity to humans >90% Availability of inbred
More informationCOMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE
The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES
More informationData Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618
Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop
More informationThe Comet Assay How to recognise Good Data
The Comet Assay How to recognise Good Data William Barfield 4 th September 2015 ICAW Content Regulatory Genetic Toxicology JaCVAM trial overview and results Protocols Historical control data Statistics
More informationBiology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
More informationChapter 14: Genes in Action
Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate
More informationTransIT -BrCa Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5500 INTRODUCTION TransIT -BrCa Transfection Reagent is specifically optimized to provide exceptional transfection efficiency
More informationPV92 PCR Bio Informatics
Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationExam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
More informationBEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION
BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION The lab mouse is the most commonly used mammalian model system for genetic research. Scientists from a wide
More informationFriedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells
Friedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells Collected pus from local hospital bandages After further examination he discovered a substance that he called Nuclein
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationNanotechnology: A Brief History and Its Convergence with Medicine. Weston Daniel, PhD Director of Program Management
Nanotechnology: A Brief History and Its Convergence with Medicine Weston Daniel, PhD Director of Program Management Outline Introduction The Nanoscale Applications Realization of a Vision There s Plenty
More informationSECTION I CITIZENSHIP: CITIZENSHIP: SECTION II
APPLICATION FOR INSTITUTIONAL BIOSAFETY COMMITTEE REVIEW AND APPROVAL South Dakota School of Mines and Technology (Protocol Submission Form) This form must be submitted for ALL research or teaching activities
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationIntroduction to C. elegans and RNA interference
Introduction to C. elegans and RNA interference Why study model organisms? The problem: In order to understand biology, we need to learn about the function of the underlying genes How can we find out what
More informationChapter 8 Cell Diversity
Chapter 8 Cell Diversity Mr. C. Biology 1 Future? Chapter 8 Cell Diversity Cells, Tissues, Organs and Systems Cells have different shapes because they have different jobs to do. A nerve cell is very different
More informationIBC protocol Risk Assessment and Determination of NIH Guidelines
IBC protocol Risk Assessment and Determination of NIH Guidelines The following are points to consider when reviewing all protocols for risk, recommended containment conditions, and determine applicable
More informationAntibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAntibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationUpdates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines)
Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Jacqueline Corrigan-Curay, J.D. M.D. Acting Director Office of Biotechnology Activities National Institute
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationHow Do You Clone a Gene?
S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationINTELLIGENT ANTIBODY DISCOVERY FROM HUMANS AND OTHER ANIMALS. Guy Cavet
INTELLIGENT ANTIBODY DISCOVERY FROM HUMANS AND OTHER ANIMALS Guy Cavet g.cavet@atreca.com PRECISION THERAPIES FROM THE ACTIVE IMMUNE RESPONSE Patient/Animal with Immune Response Immune Repertoire Capture
More informationBIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.
BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationGenetic material must be able to:
Genetic material must be able to: Contain the information necessary to construct an entire organism Pass from parent to offspring and from cell to cell during cell division Be accurately copied Account
More informationBio 121 Practice Exam 3
The material covered on Exam 3 includes lecture since the last exam and text chapters 13-21. Be sure that you read chapter 19, which was not represented in the notes. 1. Which of the following is an enveloped
More informationHighPrep Blood & Tissue DNA Kit
MAGBIO ACCELERATING genomic research HighPrep Blood & Tissue DNA Kit Manual Revision v1.1 Catalog Nos. HPBTS-D16, HPBTS-D96, HPBTS-D96X4 Genomic DNA isolation from 20-250 μl of blood, lysate of tissues,
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationEmbryonic development, epigenics and somatic cell nuclear transfer - The science and its social implications -
Embryonic development, epigenics and somatic cell nuclear transfer - The science and its social implications - Moshe Yaniv Unité d Expression Génétique et Maladies, Institut Pasteur, Paris, France September
More informationIssues in production of viral gene transfer vectors. Stefan Kochanek Department of Gene Therapy Ulm University
Issues in production of viral gene transfer vectors Stefan Kochanek Department of Gene Therapy Ulm University Only few positive results in gene therapy so far - many early phase, few late phase clinical
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationHuman IL-10 ELISA MAX Set Deluxe
Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body
More informationTRANSGENIC TECHNOLOGIES: Gene-targeting
TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis
More informationWe are committed to translating ground-breaking science into genomic therapies that transform patients lives
We are committed to translating ground-breaking science into genomic therapies that transform patients lives Liver-based expression of the human alpha-galactosidase A gene (GLA) in a murine Fabry model
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationREGISTRATION DOCUMENT FOR RECOMBINANT DNA RESEARCH
EHRS Date Received: Reg. Doc. No.: REGISTRATION DOCUMENT FOR RECOMBINANT DNA RESEARCH Principal Investigator: Penn ID#: Position Title: School: Department: Mailing Address: Mail Code: Telephone: FAX: E-mail:
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationCustom Antibodies Services. GeneCust Europe. GeneCust Europe
GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 2 route de Remich L-5690 Ellange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com Custom
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationAdding CRISPR to Your Bio-ARROW Protocol
Adding CRISPR to Your Bio-ARROW Protocol Table of Contents Work Covered by this Guidance Document... 2 Background... 2 VI. Materials and Activities... 3 VI. Materials and Activities - Recombinant Materials...
More informationDEPArray Technology. Sorting and Recovery of Rare Cells
DEPArray Technology Sorting and Recovery of Rare Cells Delivering pure, single, viable cells The DEPArray system from Silicon Biosystems is the only automated instrument that can identify, quantify, and
More informationDeveloping an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
More informationCELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
More informationPre-lab Homework Lab 1: Issues in Genetics
Lab Section: Name: Pre-lab Homework Lab 1: Issues in Genetics 1. Briefly define/explain the following terms in your own words. You may use any resource you can find, textbook, website, instructor, etc.,
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationBio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery!
Bio-Reagent Services Custom Gene Services Gateway to Smooth Molecular Biology! Gene Synthesis Mutagenesis Mutant Libraries Plasmid Preparation sirna and mirna Services Large-scale DNA Sequencing GenPool
More information