Introduction to Bioinformatics and Gene Expression Technologies
|
|
- Cathleen Richards
- 6 years ago
- Views:
Transcription
1 Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1
2 Vocabulary Gene: hereditary DNA sequence at a specific location on chromosome (that does something ) Genetics: Genome: study of heredity & variation in organisms an organism s total genetic content (full DNA sequence) Genomics: study of organisms in terms of their genome 2
3 Vocabulary Protein: sequence of amino acids that does something Proteomics: Phylogeny: Phylogenetics: study of all of the proteins that can come from an organisms genome the evolutionary or historical development of an organism (or its DNA sequence) the study of an organism s phylogeny Phenotype: the physical characteristic of interest in each individual for example, plant height, disease status, or embryo type 3
4 Vocabulary Bioinformatics: the collection, organization, & analysis of largescale, complex biological data Statistical Bioinformatics: the application of statistical approaches to bioinformatics, especially in identifying significant changes (in sequences, expression patterns, etc.) that are biologically relevant (especially in affecting the phenotype) 4
5 Central Dogma of Molecular Biology 5
6 A road map to bioinformatics Central Dogma Technology Gene Genome Sequencing Genomic Hypothesis Genotype QTL Type of Study or Analysis mrna transcript Transcript Profiling Transcriptome Microarrays or Next-Gen Sequencing (Epigenetics / methylation) Protein Protein quantification and function Proteome Protein Microarrays or Proteomics Phenotype (From introductory lecture by RW Doerge at 2013 Joint Statistical Meetings) 6
7 Alphabets DNA sequences defined by nucleotides (4) DNA sequence mrna sequence Protein sequence Protein sequences defined by amino acids (20) 7
8 General assumption of gene expression technology Use mrna transcript abundance level as a measure of the level of expression for the corresponding gene Proportional to degree of gene expression Side note: a methylated gene is silenced (no expression) 8
9 How to measure mrna abundance? Several different approaches with similar themes: Affymetrix GeneChip Nimblegen array Two-color cdna array More modern: next-generation sequencing (NGS) Representation of genes on slide Small portion of gene ( oligo ) Larger sequence of gene Blank slate (NGS) oligonucleotide arrays 9
10 General DNA sequencing Sanger 1970 s today most reliable, but expensive Next-generation [high-throughput] (NGS): Genome Sequencer FLC (GS FLX, by 454 Sequencing) Illumina s Solexa Genome Analyzer Applied Biosystems SOLiD platform others Key aspect: sequence (and identify) all sequences present 10
11 Common features of NGS technologies (1) fragment prepared genomic material biological system s RNA molecules RNA-Seq DNA or RNA interaction regions ChIP-Seq, HITS-CLIP others sequence these fragments (at least partially) produces HUGE data files (~10 million fragments sequenced) 11
12 Common features of NGS technologies (2) align sequenced fragments with reference sequence usually, a known target genome (gigo ) alignment tools: ELAND, MAQ, SOAP, Bowtie, others often done with command-line tools still a major computational challenge count number of fragments mapping to certain regions usually, genes these read counts linearly approximate target transcript abundance 12
13 Here, RNA-Seq: recall central dogma: DNA mrna protein action quantify [mrna] transcript abundance Isolate RNA from cells, fragment at random positions, and copy into cdna Attach adapters to ends of cdna fragments, and bind to flow cell (Illumina has glass slide with 8 such lanes so can process 8 samples on one slide) Amplify cdna fragments in certain size range (e.g., bases) using PCR clusters of same fragment Sequence base-by-base for all clusters in parallel 13
14 (originally illumina.com download) 14
15 (originally illumina.com download) 15
16 (orginally illumina.com download) 16
17 (orginally illumina.com download) 17
18 Then align and map For sequence at each cluster, compare to [align with] reference genome; file format: millions of clusters per lane approx. 1 GB file size per lane For regions of interest in reference genome (genes, here), count number of clusters mapping there requires well-studied and well-documented genome 18
19 RNA-Seq Example: 8 patients, 56,621 genes 8 heart tissue samples 4 control (no heart disease) 4 cardiomyopathy (heart disease) 2 restrictive (contracts okay, relaxes abnormally) 2 dilated (enlarged left ventricle) These Naples data made public Nov 2015 by Institute of Genetics and Biophysics (Naples, Italy) Ctrl_3 RCM_3 Ctrl_4 DCM_4 Ctrl_5 RCM_5 Ctrl_6 DCM_6 ENSG ENSG ENSG ENSG ENSG ENSG
20 Common statistical research objectives Test each gene (row) for differential expression between conditions Ctrl vs. non-ctrl Dilated vs. Restrictive Restrictive vs. Ctrl etc. Test specific groups of genes (with a known common function) for overall expression differences between conditions Which functions are differentially active between Ctrl and non-ctrl, for example? 20
21 A short word on bioinformatic technologies Never marry a technology, because it will always leave you. Scott Tingey, Director of Genetic Discovery at DuPont (shared in RW Doerge 2013 introductory overview lecture at 2013 JSM) In this class, we will discuss only a couple of technologies, emphasizing their recurring statistical issues These are perpetual (and compounding) 21
22 A Rough Timeline of Technologies (1995+) Microarrays require probes fixed in advance only set up to detect those (2005+) Next-Generation Sequencing (NGS) typically involves amplification of genomic material (PCR) (2010+) Third-Generation Sequencing next-next-generation Pac Bio, Ion Torrent no amplification needed can sequence single molecule longer reads possible; still (2013 ; 2016) showing high errors (2012+) Nanopore-Based Sequencing [very promising] Oxford Nanopore, Genia, others bases identified as whole molecule slips through nanoscale hole (like threading a needle); coupled with disposable cartridges; still (2013 ; 2016) under development (?+) more Differ in how sequencing done; subsequent postalignment statistical analysis basically same (see 2016 Goodwin et al. paper on Canvas course page, in Files) 22
23 Affymetrix Technology GeneChip Each gene is represented by a unique set of probe pairs (usually probe pairs per probe set) Each spot on array represents a single probe (with millions of copies) These probes are fixed to the array (Image courtesy Affymetrix, 23
24 Affymetrix Technology Expression A tissue sample is prepared so that its mrna has fluorescent tags; wait for hybridization; scan to light tag (Images courtesy Affymetrix, 24
25 Affymetrix GeneChip Image courtesy Affymetrix, 25
26 Cartoon Representations (originally from Affymetrix outreach) Animation 1: GeneChip structure (1 min.) Animation 2: Measuring gene expression (2.5 min) 26
27 Images; Affymetrix data is probe intensity Full Array Image Close-up of Array Image Images courtesy Affymetrix, 27
28 How to analyze data meaningfully? Consider (for any technology): Data quality Data distribution Data format & organization Appropriateness of measurement methods (& variance) Sources of variability (and their types) Appropriate models to account for sources of variability and address question of interest Meaning of P-values and appropriate tests of significance Statistical significance vs. biological relevance Appropriate and useful representation of results Many useful tools available from Bioconductor 28
29 The Bioconductor Project Bioconductor is an open source and open development software project for the analysis and comprehension of genomic data Not just for RNA-Seq or microarray data Like a living family of software packages, changing with needs Core team mainly at Fred Hutchinson Cancer Research, plus many other U.S. and international institutions Source: 29
30 Main Features of the Bioconductor Project Use of R Documentation and reproducible research Statistical and graphical methods Annotation Short courses Open source Open development Source: 30
31 What will we do in this class? Learn basics of a few major Bioconductor tools Focus on statistical issues Discuss recent developments Learn to discuss all of this 31
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationOutline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture
The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationNext Generation Sequencing: An Overview
Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationWhat we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationDo engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationGenome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationAnalysing genomes and transcriptomes using Illumina sequencing
Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationMeasuring transcriptomes with RNA-Seq
Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2017 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC
More informationPhilippe Hupé 1,2. The R User Conference 2009 Rennes
A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech
More informationCSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index
Page 1 of 6 Document Viewer TurnitinUK Originality Report Processed on: 05-Dec-20 10:49 AM GMT ID: 13 Word Count: 1587 Submitted: 1 CSC8313-201 - Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx
More informationSequencing techniques and applications
I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation
More informationless sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
More informationAn introduction to RNA-Seq. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
An introduction to RNA-Seq Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Doerge, R.W. 2002. Nature Reviews Genetics 3: 43-53. An introduction to RNA-Seq Tissue collection RNA
More informationClass Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1
This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationNext Generation Sequencing (NGS) Market Size, Growth and Trends ( )
Next Generation Sequencing (NGS) Market Size, Growth and Trends (2014-2020) July, 2017 4 th edition Information contained in this market report is believed to be reliable at the time of publication. DeciBio
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationFeature Selection of Gene Expression Data for Cancer Classification: A Review
Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression
More informationTypical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides
Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane
More informationFunctional Genomics in Plants
Functional Genomics in Plants Jeffrey L Bennetzen, Purdue University, West Lafayette, Indiana, USA Functional genomics refers to a suite of genetic technologies that will contribute to a comprehensive
More informationNext Generation Sequencing Technologies. Some slides are modified from Robi Mitra s lecture notes
Next Generation Sequencing Technologies Some slides are modified from Robi Mitra s lecture notes What will you do to understand a disease? What will you do to understand a disease? Genotype Phenotype Hypothesis
More informationHumboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationData Sheet. GeneChip Human Genome U133 Arrays
GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array
More informationIntroduction to Molecular Biology
Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationBioinformatics of Transcriptional Regulation
Bioinformatics of Transcriptional Regulation Carl Herrmann IPMB & DKFZ c.herrmann@dkfz.de Wechselwirkung von Maßnahmen und Auswirkungen Einflussmöglichkeiten in einem Dialog From genes to active compounds
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationUltrasequencing: Methods and Applications of the New Generation Sequencing Platforms
Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationMICROARRAYS+SEQUENCING
MICROARRAYS+SEQUENCING The most efficient way to advance genomics research Down to a Science. www.affymetrix.com/downtoascience Affymetrix GeneChip Expression Technology Complementing your Next-Generation
More informationAdvances in analytical biochemistry and systems biology: Proteomics
Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More informationProgram overview. SciLifeLab - a short introduction. Advanced Light Microscopy. Affinity Proteomics. Bioinformatics.
Open House Program SciLifeLab Open House in Stockholm November 4, 2015 09:00-16:00 Contact: events@scilifelab.se Program overview 09:00-09:30-10:00-10:30-11:00-11:30-12:00-12:30-13:00-13:30-14:00-14:30-15:00-15:30-09:30
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationSerial Analysis of Gene Expression
Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE
More informationAGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1
AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationBioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview
Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationHigh Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science
More informationGene expression bioinformatics: Part 1. High-throughput quantitative genomics
Gene expression bioinformatics: Part 1. High-throughput quantitative genomics September 25, 2017 Alvin T. Kho Boston Children's Hospital alvin_kho@hms.harvard.edu Created with Outline (Biology is the science
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationPéter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS
Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS The Bioinformatics book covers new topics in the rapidly
More informationMulti-omics in biology: integration of omics techniques
31/07/17 Летняя школа по биоинформатике 2017 Multi-omics in biology: integration of omics techniques Konstantin Okonechnikov Division of Pediatric Neurooncology German Cancer Research Center (DKFZ) 2 Short
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationO C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationCMPS 3110 : Bioinformatics. High-Throughput Sequencing and Applications
CMPS 3110 : Bioinformatics High-Throughput Sequencing and Applications Sanger (1982) introduced chaintermination sequencing. Main idea: Obtain fragments of all possible lengths, ending in A, C, T, G. Using
More informationMolecular Markers CRITFC Genetics Workshop December 9, 2014
Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating
More informationMeasuring transcriptomes with RNA-Seq. BMI/CS 776 Spring 2016 Anthony Gitter
Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Overview RNA-Seq technology The RNA-Seq quantification problem Generative
More informationIdentifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering
More informationLong and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
More informationIntroduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
More informationNext Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationMolecular Biology Primer. CptS 580, Computational Genomics, Spring 09
Molecular Biology Primer pts 580, omputational enomics, Spring 09 Starting 19 th century What do we know of cellular biology? ell as a fundamental building block 1850s+: ``DNA was discovered by Friedrich
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More information