Nature Structural & Molecular Biology: doi: /nsmb.1969

Size: px
Start display at page:

Download "Nature Structural & Molecular Biology: doi: /nsmb.1969"

Transcription

1

2

3

4

5

6

7

8

9 Supplementary Methods Structure determination All the diffraction data sets were collected on BL-41XU (using ADSC Quantum 315 HE CCD detector) at SPring8 (Harima, Japan) or on BL5A (using ADSC Quantum 315 CCD detector) or BL17A (using ADSC Quantum 270 CCD detector) at Photon Factory (Tsukuba, Japan), and were processed and scaled with the HKL2000 package 56. The 3.15 Å resolution structure was solved by molecular replacement with Phaser 57 using the previously reported structure of the MV-H (PDB ID: 2ZB6) as a search model. The Cα trace of the β-sheet structure of CD48 (PDB ID: 2DRU) was manually fitted into the residual electron density. Further model refinement procedures were carried out with Phenix 58 and Refmac 59 coupled with the model correction function of Lafire 60. Iterative manual model building and correction were done using COOT 61. The final structure was refined to the R free and R factors of 29.2% and 23.1%, respectively, with a root mean square deviation of Å in bond length and 1.5 in bond angles. This model was checked using the program Procheck 62. Of 2059 resides in the model, 72.8% are in the most favored regions and 23.3% are in additional allowed regions in the Ramachandran plot. The location of MV-H in the 4.5 Å resolution structure was solved by molecular replacement with Phaser. The MV-H structure from the 3.15 Å resolution structure was used as a search model. Both of 2Fo-Fc and Fo-Fc maps enabled us to place the maslam-v domain clearly, and it was confirmed that the MV-H-SLAM interaction is identical between the 3.15 Å and 4.5 Å resolution structures. To perform subsequent structure refinement for the 4.5 Å resolution structure, the protocol with Phenix was 1

10 limited to the rigid body refinement and TLS refinement of individual domains due to the low resolution limit. The final structure has R free and R of 33.8% and 32.6%, respectively. The 3.55 Å resolution structure was also determined by molecular replacement using the 3.15 Å resolution structure as a search model. The structure was further refined to R free and R of 28.3% and 25.0%, respectively, using CNS 63 and Phenix. Detailed data collection and crystallographic statistics are summarized in Table 1. Figures were produced using PyMOL (DeLano Scientific LLC, Palo Alto, CA, USA. Binding analysis using SPR. The MV-H head domain (residue ), the ectodomain of hslam and its mutants were expressed in HEK293 cells, purified and dissolved in HBS-P buffer. SPR experiments were performed with a BIAcore3000 (Biacore AB). Proteins were immobilized on the CM5 sensor chip, onto which streptavidin had been covalently attached by amine-coupling using an amine-coupling kit (Biacore AB). For coupling, the samples were injected at μg ml -1 for 1 10 min in HBS-P buffer. For MV-H-SLAM binding assay, MV-H was injected over the immobilized SLAM proteins. The binding response at each concentration (0.125, 0.25, 0.5, 1.0, 2.0, 4.0, and 6.0 μm) was calculated by subtracting the equilibrium response measured in the control flow cell from the response in each sample flow cell. Kinetic constants were derived by using the curve-fitting facility of the BIAevaluatin version 4.1 software (GE healthcare) and the simple 1:1 Langmuir binding model (A + B AB). For SLAM-SLAM homodimer binding assay, SLAM (4.6875, 9.375, 18.75, 37.5, 2

11 75, 150, and 300 μm) was injected over the immobilized SLAM mutant proteins. The data were analyzed using BIAevaluatin version 4.1 and ORIGIN version 7 (MicroCal Inc). K d values were determined by equilibrium analyses using nonlinear curve fitting of the Langmuir binding isotherm. MV entry. CHO cells were plated in 48-well plates and transfected with 500 ng of the plasmid DNA encoding wild-type or mutant SLAM proteins using a Lipofectamine 2000 reagent (Invitrogen Life Technologies). At 24 h after transfection, the cells were infected with 50 μl of serially diluted EGFP-expressing recombinant MV 64. A fusion block peptide (Peptide Institute) was added 2 h after infection to prevent the second round infection by progeny virions 65. Expressions of SLAM proteins on transfected cells were examined by a FACScan machine (Becton-Dicinson) using anti-ha tag monoclonal antibody 12CA5 (Roche Diagnostics), and comparable levels of cell surface expressions were confirmed. Infectious titers of MV were determined by counting the numbers of EGFP-expressing cells at 48 h after infection, and are expressed as relative values compared with that for the wild-type SLAM. MV infection. HEK293 cells were plated in 24-well plates and transfected with 1 μg of the plasmid DNA encoding wild-type or mutant SLAM proteins, using a Lipofectamine 2000 reagent. At 24 h after transfection, the cells were infected with 100 μl of serially diluted EGFP- or Renilla luciferase-expressing recombinant MV 18. EGFP autofluorescence in MV-infected cells were observed with a fluorescence microscope at 3

12 48 h after infection. Luciferase activities in MV-infected cells were quantified at 24 h post infection. Native PAGE and immunoblotting. HEK293T cells were plated in 12-well plates and transfected with 1 μg of the plasmid DNA encoding the full-length MV-H protein (the wild-type IC-B strain or the Edmonston vaccine strain) 66, using a polyethyleneimine reagent. At 48 h after transfection, the cells were washed with PBS and then the proteins were extracted with 0.7% (v/v) digitonin in PBS. MV-H proteins were separated by BN-PAGE using NativePAGE TM Novex Bis-Tris Gel System (3 12 % Bis-Tris gel, Invitrogen). After BN-PAGE, the proteins were detected by immunoblotting with a rabbit polyclonal antibody against MV-H (a gift from T. Kohama), followed by alkaline phosphatase-conjugated secondary antibody (Thermo scientific) using SigmaFAST TM BCIP /NBT (SIGMA). 51. Wang, J. H. et al. Structure of a heterophilic adhesion complex between the human CD2 and CD58 (LFA-3) counterreceptors. Cell 97, (1999). 52. Jones, E. Y., Davis, S. J., Williams, A. F., Harlos, K. & Stuart, D. I. Crystal structure at 2.8 A resolution of a soluble form of the cell adhesion molecule CD2. Nature 360, (1992). 53. Ikemizu, S. et al. Crystal structure of the CD2-binding domain of CD58 (lymphocyte function-associated antigen 3) at 1.8-A resolution. Proc. Natl. Acad. 4

13 Sci. U S A 96, (1999). 54. Yan, Q. et al. Structure of CD84 provides insight into SLAM family function. Proc. Natl. Acad. Sci. U S A 104, (2007). 55. Russell, R. J. et al. The structure of H5N1 avian influenza neuraminidase suggests new opportunities for drug design. Nature 443, (2006). 56. Otwinowski, Z. & Minor, W. Processing of X-ray Diffraction Data Collected in Oscillation Mode. Methods Enzymol. 276, (1997). 57. McCoy, A. J. et al. Phaser crystallographic software. J. Appl. Crystallogr. 40, (2007). 58. Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D Biol. Crystallogr. 66, (2010). 59. Murshudov, G. N., Vagin, A. A. & Dodson, E. J. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D Biol. Crystallogr. 53, (1997). 60. Yao, M., Zhou, Y. & Tanaka, I. LAFIRE: software for automating the refinement process of protein-structure analysis. Acta Crystallogr. D Biol. Crystallogr. 62, (2006). 61. Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, (2004). 62. Laskowski, R. A., MacArthur, M. W., Moss, D. S. & Thornton, J. M. PROCHECK: a program to check the stereochemical quality of protein 5

14 structures.. J. Appl. Crystallogr. 26, (1993). 63. Brunger, A. T. et al. Crystallography & NMR system: A new software suite for macromolecular structure determination. Acta Crystallogr. D Biol. Crystallogr. 54, (1998). 64. Hashimoto, K. et al. SLAM (CD150)-independent measles virus entry as revealed by recombinant virus expressing green fluorescent protein. J. Virol. 76, (2002). 65. Richardson, C. D., Scheid, A. & Choppin, P. W. Specific inhibition of paramyxovirus and myxovirus replication by oligopeptides with amino acid sequences similar to those at the N-termini of the F1 or HA2 viral polypeptides. Virology 105, (1980). 66. Tahara, M., Takeda, M., Seki, F., Hashiguchi, T. & Yanagi, Y. Multiple amino acid substitutions in hemagglutinin are necessary for wild-type measles virus to acquire the ability to use receptor CD46 efficiently. J. Virol. 81, (2007). 6

Supporting Online Material. Av1 and Av2 were isolated and purified under anaerobic conditions according to

Supporting Online Material. Av1 and Av2 were isolated and purified under anaerobic conditions according to Supporting Online Material Materials and Methods Av1 and Av2 were isolated and purified under anaerobic conditions according to published protocols (S1). Crystals of nf-, pcp- and adp-av2:av1 complexes

More information

Supplemental Information. The structural basis of R Spondin recognition by LGR5 and RNF43

Supplemental Information. The structural basis of R Spondin recognition by LGR5 and RNF43 Supplemental Information The structural basis of R Spondin recognition by LGR5 and RNF43 Po Han Chen 1, Xiaoyan Chen 1, Deyu Fang 2, Xiaolin He 1* 1 Department of Molecular Pharmacology and Biological

More information

Human IL10RB ELISA Pair Set ( CRFB4 )

Human IL10RB ELISA Pair Set ( CRFB4 ) Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the

More information

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc. The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration

More information

Microarray Industry Products

Microarray Industry Products Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase

More information

Mouse ICAM-1 / CD54 ELISA Pair Set

Mouse ICAM-1 / CD54 ELISA Pair Set Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General

More information

Label-free interaction analysis in realtime using surface plasmon resonance

Label-free interaction analysis in realtime using surface plasmon resonance GE Healthcare Technology Note 23 Biacore systems Label-free interaction analysis in realtime using surface plasmon resonance Providing quantitative data on: report point Specificity sensorgram To what

More information

GE Biacore T Check that the waste bottle is empty.

GE Biacore T Check that the waste bottle is empty. GE Biacore T200 General Care and Maintenance The instrument should be left ON at all times, and in Standby Mode. Report problems immediately in the booking system: https://ppms.us/hms-cmi. Refer to the

More information

SURFACE PLASMON RESONANCE-BASED SYSTEMS

SURFACE PLASMON RESONANCE-BASED SYSTEMS SURFACE PLASMON RESONANCE-BASED SYSTEMS ADVANCED METHODS IN BIOENGINEERING LABORATORY 3/1/2011 1 Schedule Week 1: Introduction Reagents preparation Ligand immobilization of Protocol 1 Week 2: Kinetics

More information

Application of Biacore Technology

Application of Biacore Technology Principles and typical results Application of Biacore Technology Common types of Biacore analyses Specificity analysis Is my molecule of interest specific for its target? Multiple binding analysis In which

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

Figure S2, related to Figure 1. Stereo images of the CarD/RNAP complex and. electrostatic potential surface representation of the CarD/RNAP interface

Figure S2, related to Figure 1. Stereo images of the CarD/RNAP complex and. electrostatic potential surface representation of the CarD/RNAP interface Structure, Volume 21 Supplemental Information Structure of the Mtb CarD/RNAP -Lobes Complex Reveals the Molecular Basis of Interaction and Presents a Distinct DNA-Binding Domain for Mtb CarD Gulcin Gulten

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information

RayBio Phospho- Akt (Ser473) ELISA Kit

RayBio Phospho- Akt (Ser473) ELISA Kit RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Assessment of quaternary structure of soluble RSV F proteins. Soluble variants of F proteins from A2 and B1 RSV strains were expressed in HEK293 cells. The cell culture supernatants

More information

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications PRODUCT FAMILY BULLETIN Tropix Chemiluminescent Kits and Reagents Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications Introduction to Chemiluminescence Chemiluminescence is the conversion

More information

Purification and crystallization of the bimagrumab Fab. The light- (residues 1 to 216, C216A

Purification and crystallization of the bimagrumab Fab. The light- (residues 1 to 216, C216A SI Methods Purification and crystallization of the bimagrumab Fab. The light- (residues 1 to 216, C216A variant) and heavy-chain (residues 1 to 219, R212K variant) of the Bimagrumab Fab were cloned on

More information

Rat IGF-1 ELISA Kit (rigf-1-elisa)

Rat IGF-1 ELISA Kit (rigf-1-elisa) Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar

More information

Data Sheet. PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions

Data Sheet. PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions Data Sheet PD-1[Biotinylated]:PD-L2 Inhibitor Screening Assay Kit Catalog # Size: 96 reactions DESCRIPTION: Cell signaling through the PD-1 receptor upon binding the PD-L2 ligand attenuates immune responses

More information

Adeno-X Rapid Titer Kit

Adeno-X Rapid Titer Kit User Manual Adeno-X Rapid Titer Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc. A Takara Bio

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Towards an optimized in-vitro SPR assay for antibody Fcg receptor binding kinetics

Towards an optimized in-vitro SPR assay for antibody Fcg receptor binding kinetics Towards an optimized in-vitro SPR assay for antibody Fcg receptor binding kinetics Åsa Frostell 1, Robert Karlsson 1, Jerrard Hayes 2, Matilda Lindgren 1, Pauline Rudd 2, and Cecilia Annerén 1 1 GE Healthcare

More information

Converting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents

Converting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents Application note DynaLight Substrate with RapidGlow Enhancer Converting your ELISA from horseradish peroxidase to alkaline phosphatase using NovaBright chemiluminescence detection reagents Introduction

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

Data Sheet. PD-1:PD-L1[Biotinylated] Inhibitor Screening Assay Kit Catalog # Size: 96 reactions

Data Sheet. PD-1:PD-L1[Biotinylated] Inhibitor Screening Assay Kit Catalog # Size: 96 reactions Data Sheet PD-1:PD-L1[Biotinylated] Inhibitor Screening Assay Kit Catalog # 72003 Size: 96 reactions DESCRIPTION: Cell signaling through the PD-1 receptor upon binding the PD-L1 ligand attenuates immune

More information

ab Ubiquitylation Assay Kit

ab Ubiquitylation Assay Kit ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.

More information

Global Headquarters 86 Cummings Park Woburn, MA Tel:

Global Headquarters 86 Cummings Park Woburn, MA Tel: Human beta-defensin 1 ELISA Kit Cat:RK00211 This ELISA kit used for quantitation of human Defensin Beta 1 (BD-1) concentration in cell culture supernate, serum and plasma. For research use only, and it

More information

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:

More information

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best

More information

QuickTiter Hepatitis B Core Antigen (HBVcAg) ELISA Kit

QuickTiter Hepatitis B Core Antigen (HBVcAg) ELISA Kit Product Manual QuickTiter Hepatitis B Core Antigen (HBVcAg) ELISA Kit Catalog Numbers VPK-150 VPK-150-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Hepatitis

More information

Universal Kinase Assay Kit (Fluorometric) For monitoring ADP formation, which is directly proportional to enzyme phosphotransferase activity

Universal Kinase Assay Kit (Fluorometric) For monitoring ADP formation, which is directly proportional to enzyme phosphotransferase activity ab138879 Universal Kinase Assay Kit (Fluorometric) Instructions for Use For monitoring ADP formation, which is directly proportional to enzyme phosphotransferase activity This product is for research use

More information

KPL LumiGLO Reserve Chemiluminescent Substrate

KPL LumiGLO Reserve Chemiluminescent Substrate DESCRIPTION KPL LumiGLO Reserve contains a luminol-based chemiluminescent substrate designed for use with peroxidase-labeled (HRP) reporter molecules. KPL LumiGLO Reserve offers improvements in the way

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

SAMPLE LITERATURE Please refer to included weblink for correct version.

SAMPLE LITERATURE Please refer to included weblink for correct version. REVISED & UPDATED Edvo-Kit #269 Introduction to ELISA Reactions Experiment Objective: This experiment introduces concepts and methodologies of enzyme-linked immunosorbent assays (ELISA). See page 3 for

More information

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

More information

Rat α-melanocyte stimulating hormone (α-msh) ELISA Kit

Rat α-melanocyte stimulating hormone (α-msh) ELISA Kit Rat α-melanocyte stimulating hormone (α-msh) ELISA Kit For the quantitative determination of rat α-melanocyte stimulating hormone (α-msh) concentrations in serum, plasma, tissue homogenates. This package

More information

Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences)

Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) ANTI-FLAG High Sensitivity, M2 coated 96-well plate P 2983 Automation

More information

The Biotechnology Education Company. Quantitative ELISA. Storage: See Page 3 for specific storage instructions EXPERIMENT OBJECTIVE:

The Biotechnology Education Company. Quantitative ELISA. Storage: See Page 3 for specific storage instructions EXPERIMENT OBJECTIVE: The Biotechnology Education Company Revised and Updated Quantitative ELISA Storage: See Page 3 for specific storage instructions EXPERIMENT OBJECTIVE: EDVO-Kit # 278 The objective of this experiment is

More information

QuickTiter Adenovirus Titer ELISA Kit

QuickTiter Adenovirus Titer ELISA Kit Product Manual QuickTiter Adenovirus Titer ELISA Kit Catalog Number VPK-110 2 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Recombinant adenoviruses have tremendous

More information

Generic DELFIA Reagents

Generic DELFIA Reagents AD0005P-12 (en) 1 Generic DELFIA Reagents For Research Use Only These instructions for use apply to the following reagents: AD0038 DELFIA Eu-N1 PY20 antibody 50 µg vial AD0039 DELFIA Eu-N1 PY20 antibody

More information

Product datasheet. Storage recommendations Store the kit at 2-8 C. The kit is stable for a period of up to 3 months from the date of receipt.

Product datasheet. Storage recommendations Store the kit at 2-8 C. The kit is stable for a period of up to 3 months from the date of receipt. Product datasheet Human VEGF-A ELISA Kit Product #: 0028 Storage recommendations Store the kit at 2-8 C. The kit is stable for a period of up to 3 months from the date of receipt. Description This human

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

special offers from your protein biology resource

special offers from your protein biology resource special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research

More information

Microbial Biotechnology agustin krisna wardani

Microbial Biotechnology agustin krisna wardani Microbial Biotechnology agustin krisna wardani 1. The Structure of Microbes Microbes (microorganisms) are tiny organisms that are too small to be seen individually by the naked eye and must be viewed with

More information

Global Headquarters 86 Cummings Park Woburn, MA Tel:

Global Headquarters 86 Cummings Park Woburn, MA Tel: Human beta-defensin 2 ELISA Kit Cat:RK00193 This ELISA kit used for quantitation of human Beta Defensin-2 (BD-2) concentration in cell culture supernate, serum and plasma. For research use only, and it

More information

Bovine prolactin/luteotropic hormone (PRL/LTH) ELISA Kit

Bovine prolactin/luteotropic hormone (PRL/LTH) ELISA Kit Bovine prolactin/luteotropic hormone (PRL/LTH) ELISA Kit Catalog Number. MBS703224 For the quantitative determination of bovine prolactin/luteotropic hormone (PRL/LTH) concentrations in serum, plasma.

More information

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression ab128573 GST 6XHis-tag ELISA Kit Instructions for Use For the quantitative measurement of 6XHis-tag protein expression This product is for research use only and is not intended for diagnostic use. 1 Table

More information

Label-Enhanced SPR Improves the Detectability of Label-Free Surface Plasmon Resonance Analysis 100x

Label-Enhanced SPR Improves the Detectability of Label-Free Surface Plasmon Resonance Analysis 100x episentec Label-Enhanced SPR Improves the Detectability of Label-Free Surface Plasmon Resonance Analysis 1x Anders Hanning, Episentec Drug Discovery 15, Telford, 2-3 September 215 Episentec - Better Biosensors

More information

Mouse Factor XII Total ELISA Kit

Mouse Factor XII Total ELISA Kit Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII

More information

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic

More information

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

Tyrosine Kinase Assay Kit, Red*

Tyrosine Kinase Assay Kit, Red* Rh Tyrosine Kinase Assay Kit, Red* 1.0 INTRODUCTION Part # P2882, P2883 Lit. # L0531 Rev. 11/02 Page 1 of 6 The phosphorylation of proteins by protein tyrosine kinases (PTKs) is critical to the normal

More information

Product: Arrest-In TM Transfection Reagent for RNAi

Product: Arrest-In TM Transfection Reagent for RNAi Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and

More information

Human IgG Antigen ELISA Kit

Human IgG Antigen ELISA Kit Human IgG Antigen ELISA Kit Catalog No: IHUIGGKT Lot No: SAMPLE INTENDED USE This human immunoglobulin G antigen assay is intended for the quantitative determination of total human IgG antigen in serum,

More information

NAG-1 (GDF-15, MIC-1) Prostate Cancer ELISA kit

NAG-1 (GDF-15, MIC-1) Prostate Cancer ELISA kit NAG-1 (GDF-15, MIC-1) Prostate Cancer ELISA kit Catalog Number: NG1 Store at -0 C. FOR RESEARCH USE ONLY v. 1081 Introduction This sandwich ELISA kit is for determination of NAG-1 (GDF-15, MIC-1) levels

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine.

For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine. m andw da a For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity Range (calibration

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

HPV16 E7 Oncoprotein ELISA Kit

HPV16 E7 Oncoprotein ELISA Kit Product Manual HPV16 E7 Oncoprotein ELISA Kit Catalog Numbers VPK- 5045 VPK- 5045-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Human papillomavirus

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

protein interaction analysis tech note 5367

protein interaction analysis tech note 5367 protein interaction analysis tech note 5367 Rapid Optimization of Immobilization and Binding Conditions for Kinetic Analysis of Protein-Protein Interactions Using the ProteOn XPR36 Protein Interaction

More information

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3

More information

FectoPRO DNA transfection kit for Bioproduction PROTOCOL

FectoPRO DNA transfection kit for Bioproduction PROTOCOL DNA transfection kit for Bioproduction PROTOCOL DESCRIPTION transfection kit is specifically designed for enhanced Transient Gene Expression using low DNA amounts, in suspension CHO and HEK-293 cells as

More information

GE Healthcare Life Sciences. Biacore Assay Handbook

GE Healthcare Life Sciences. Biacore Assay Handbook GE Healthcare Life Sciences Biacore Assay Handbook 1 Introduction 1.1 What Biacore systems measure... 5 1.2 Where Biacore systems are used... 5 1.3 Scope of this book... 6 1.4 Biacore system range...

More information

Improving biosensor analysis

Improving biosensor analysis JOURNAL OF MOLECULAR RECOGNITION J. Mol. Recognit. 1999;12:279 284 Improving biosensor analysis David G. Myszka* Huntsman Cancer Institute, University of Utah, Salt Lake City, UT 84132, USA The quality

More information

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only

More information

Bovine Prostaglandin E2 (PG-E2) ELISA Kit

Bovine Prostaglandin E2 (PG-E2) ELISA Kit Bovine Prostaglandin E2 (PG-E2) ELISA Kit Catalog Number. CSB-E14237B For the quantitative determination of endogenic bovine prostaglandin E2 (PG-E2) concentrations in serum, plasma, tissue homogenates.

More information

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody

More information

ab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression

ab GFP ELISA Kit Instructions for Use  For the quantitative measurement of GFP protein expression ab117992 GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression This product is for research use only and is not for diagnostic use. intended www.abcam.com Table

More information

LabChip GXII: Antibody Analysis

LabChip GXII: Antibody Analysis WHITE PAPER LabChip GXII: Antibody Analysis Antibody Analysis using microfluidic technology in high throughput Quality by Design Experiments Abstract Current initiatives in Process Analytical Technology

More information

Characterization of Aptamer Binding using SensíQ SPR Platforms

Characterization of Aptamer Binding using SensíQ SPR Platforms Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

Mouse Luteinizing Hormone (LH) ELISA

Mouse Luteinizing Hormone (LH) ELISA Mouse Luteinizing Hormone (LH) ELISA For the quantitative determination of mouse LH in serum, plasma and tissue homogenates Cat. No. KU-222 For Research Use Only. Not for use in diagnostic procedures.

More information

Flow Cytometry - The Essentials

Flow Cytometry - The Essentials Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

PureSpeed Tips. Superior Protein Purity and Concentration Protein Purification in a Pipette Tip

PureSpeed Tips. Superior Protein Purity and Concentration Protein Purification in a Pipette Tip PureSpeed Tips PureSpeed Protein Tips Highest purity and concentration Fast as little as 15 minutes Process many samples at once Superior Protein Purity and Concentration Protein Purification in a Pipette

More information

Tech support: Luciferase Assay System. Protocol. LightSwitch Transfec tion Optimization Kit. Genome In. Function Out.

Tech support: Luciferase Assay System. Protocol. LightSwitch Transfec tion Optimization Kit. Genome In. Function Out. Luciferase Assay System Protocol LightSwitch Transfec tion Optimization Kit LightSwitch Transfection Optimization Kit Instructions for use in 96-well format, 4 day protocol OVERVIEW The LightSwitch Transfection

More information

Calcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included

Calcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included BD Technical Data Sheet Calcium Assay Kit Product Information Catalog Number: 640176 Size Reagents for 10 plates Components: Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml 1X Calcium

More information

Human TGF-beta1 ELISA

Human TGF-beta1 ELISA K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic

More information

Human connective tissue growth factor (CTGF) ELISA Kit. MyBioSource.com. This package insert must be read in its entirety before using this product.

Human connective tissue growth factor (CTGF) ELISA Kit. MyBioSource.com. This package insert must be read in its entirety before using this product. Human connective tissue growth factor (CTGF) ELISA Kit Catalog Number. For the quantitative determination of human connective tissue growth factor (CTGF) concentrations in serum, plasma, tissue homogenates.

More information

CBI Toolbox Tour 2015

CBI Toolbox Tour 2015 CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated

More information

Application Note Influence of coating buffer and incubation conditions on ELISA performance

Application Note Influence of coating buffer and incubation conditions on ELISA performance Application Note Influence of coating buffer and incubation conditions on ELISA performance 1. Introduction ELISA (Enzyme-Linked Immunosorbent Assay) is one of the most widely used techniques in both basic

More information

MSD 96-Well MULTI-ARRAY and MULTI-SPOT Human Cytokine Assays: Base Kit

MSD 96-Well MULTI-ARRAY and MULTI-SPOT Human Cytokine Assays: Base Kit MSD 96-Well MULTI-ARRAY and MULTI-SPOT Human Cytokine Assays: Base Kit Summary MSD Cytokine Assays measure one to ten cytokines in a 96-well MULTI-ARRAY or MULTI-SPOT plate. The assays employ a sandwich

More information

FLAG Western Detection Kit

FLAG Western Detection Kit FLAG Western Detection Kit INSTRUCTION MANUAL Catalog #200470 Revision A For In Vitro Use Only 200470-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other

More information

Convoy TM Transfection Reagent

Convoy TM Transfection Reagent Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections

More information

Plaque Size Phenotype as a Selectable Marker To Generate Vaccinia Virus Recombinants

Plaque Size Phenotype as a Selectable Marker To Generate Vaccinia Virus Recombinants JOURNAL OF VIROLOGY, Feb. 1989, p. 997-1001 0022-538X/89/020997-05$02.00/0 opyright 0 1989, American Society for Microbiology Vol. 63, No. 2 Plaque Size Phenotype as a Selectable Marker To Generate Vaccinia

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

B-cell Epitope Prediction and Cloning monoclonal ADAs

B-cell Epitope Prediction and Cloning monoclonal ADAs B-cell Epitope Prediction and Cloning monoclonal ADAs Stefan Ryser, CEO, Trellis Bioscience 3 rd International Symposium on Higher Order Structure of Protein Therapeutics Arlington, Virginia, February

More information

Characterization of a human recombinant antibody fragment to be used in a diagnostic test

Characterization of a human recombinant antibody fragment to be used in a diagnostic test LABORATORY EXERCISE 1 Characterization of a human recombinant antibody fragment to be used in a diagnostic test Evaluation by SDS-PAGE, NanoDrop, ELISA, Biacore and Antibody microarray. Supervisors: Elin

More information

Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization of higgs and FcγR1A

Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization of higgs and FcγR1A APPLICATION NOTE AlphaLISA Technology Authors: Daniel Cardillo Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization

More information

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay -PLEX Immunogenicity Assay Application Note 1 Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay The use of biotherapeutics, biosimilars, and combination biotherapies

More information

Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient

Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,

More information

NEW Streptavidin-PE Conjugates Streptavidin-HRP Conjugates Streptavidin-AP Conjugates 7 + 8

NEW Streptavidin-PE Conjugates Streptavidin-HRP Conjugates Streptavidin-AP Conjugates 7 + 8 High Quality Stable Liquid Substrates, Conjugates and Stabilizing Diluents for Immunoassays, Flow Cytometry and Multiplexing Platforms such as Luminex Substrates Page Chemiluminescent HRP for ELISA and

More information

Human Amyloid Beta Peptide 1-42 (Aβ1-42) ELISA Kit

Human Amyloid Beta Peptide 1-42 (Aβ1-42) ELISA Kit Human Amyloid Beta Peptide 1-42 (Aβ1-42) ELISA Kit Catalog Number. For the quantitative determination of human amyloid beta peptide 1-42 (Aβ1-42) concentrations in serum, plasma, tissue homogenates, cerebrospinal

More information