Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD

Size: px
Start display at page:

Download "Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD"

Transcription

1 Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University

2 Example of critical checkpoints influencing biological activity and safety of biological products Vector construction Expression Purification Storage until usage Coding sequence Modification of proteins PTMs Cleavages/truncation Aggregation Host cell proteins/ DNA Residual growth factors Adventitious agents Virus Micoplasma Stability of cell lines Location of insert Copy number of insert Ability to concentrate target species/clear up contaminants Leachables from columns Re-usage of columns Stability Storage conditions Picture in cover slide taken from: /biologics-world-taiwan-2016/the-concept/

3 Various laboratory techniques are routinely used for the characterization of biological products Nucleic acid AGE Hybridization Sequencing PCR, qpcr Microarray Protein Amino acid analysis Edman degradation Peptide mapping: HPLC, MS, MS-MS SDS-PAGE & protein staining IEF 2D-gel Immunological assays Precipitation/ agglutination Western blot ELISA Picture taken from:

4 Molecular assays for biological products Our main focuses: Brief review of the principle of each assay Example of their usage in biological product registration Multiple levels: nucleic acids, protein, immunological assays Common types of assays: Qualitative: detect the presence of something Quantitative: determine the exact (?) amount of something Limit test (semi-quantitative): check if the level of something exceeds certain amount

5 Molecular analysis of nucleic acids DNA agarose gel electrophoresis Nucleic acid hybridization DNA sequencing PCR, qpcr Microarray

6 DNA agarose gel electrophoresis (AGE) Separate fragments of DNA based on size 6

7 Porous structure of molecular sieve used to resolve DNA/proteins Picture taken from: ocw.mit.edu/courses/biological-engineering/ laboratory-fundamentals-in-biological-engineering-spring-2010/labs/module-1-day-2-purify-aptamer-encoding-dna/

8 DNA in agarose gels can be visualized by various staining methods Ethidium bromide Ethidium bromide Fluorescent DNA dye

9 Picture taken from Picture taken from:

10 Hybridization of nucleic acids Southern blot & Northern blot Southern blot > DNA Northern blot > RNA AGE 2. Transfer to solid support (blotting) 3. Hybridization with probe specific for sequence of interest 4. Detection Picture taken from: 10

11 Applications of nucleic acid hybridization DNA gel electrophoresis Southern Blotting TaqI & SmaI Ladder Uncut TaqI SmaI Ladder Uncut TaqI SmaI TaqI & SmaI Example: roughly map the location of DNA insert (infer genetic stability of cell line) Picture taken from:

12 DNA sequencing: Sanger method 12

13 Sanger sequencing is also known as a chain-termination method 13

14 DNA sequencing: Sanger method Chain-termination method 5 main components: DNA template Primer dntps fluorescent labelled ddntps DNA polymerase Sequence 1 fragment (read bps) at a time Example: check DNA sequence of insert (DNA or mrna) 14

15 Polymerase chain reaction (PCR) Amplification of target DNA 15

16 Quantitative Polymerase Chain Reaction (qpcr) Picture taken from:

17 Quantitative Polymerase Chain Reaction (qpcr) A B Picture taken from:

18 Some examples of PCR/qPCR applications for the characterization of biological products PCR Amplify desired gene from suitable host for expression Detection of adventitious agents e.g. virus or micoplasma Detection of host cell DNA qpcr Determine the copy number of insert in master cell, working cell or cell at the end of production

19 DNA microarray By Squidonius Based on hybridization between probes & DNA of interest A Large number of probes are fixed on a solid support (CHIP) enabling the interrogation of multiple targets simultaneously

20 Picture taken from: DNA microarray

21 Molecular analysis of proteins Polyacrylamide gel electrophoresis Edman degradation: N-terminal sequencing Peptide mapping: analysis of proteolytic cleavage pattern Mass-spectrometry: MS or MS-MS

22 Polyacrylamide gel electrophoresis (PAGE) Separate proteins based on size Usually performed in a denaturing condition (SDS-PAGE) Can be adapted to resolve proteins in their native conformation (native gel) 22

23 Proteins in polyacrylamide gels can be visualized by various staining methods Coomassie brilliant blue Silver stain Fluorescent stain e.g. Sypro Ruby

24 Edman degradation Phenyl isothiocyanate Phenylthiohydantoin (PTH)- amino acid derivatives are identified through chromatography N-terminal sequencing, up to 30 amino acids Will not work if N-terminal amino group is modified or buried within protein

25 Peptide mapping 1. Fragmentation of protein e.g. proteolytic cleavage by enzymes which cleave specific bond 2. Resolve peptides with appropriate methods e.g. SDS-PAGE, HPLC, MS, etc.

26 Peptide mapping Lys-C = K / X Arg-C = R /X

27 Some examples of peptide mapping applications in the registration of biological products Peptide mapping/finger printing reflects the identity of the parent protein Usage: Identity of drug substance Purity: detect modified forms of drug substance e.g. some PTMs

28 Protein mass-spectrometry (MS) analysis

29 2 types of protein mass-spectrometry (MS) analysis: Top-down and Bottom-up

30 Applications of protein MS analysis Mass fingerprint: MS Protein quantitation: quantitative MS Protein sequencing: MS-MS Post-tranlational modification characterization: MS-MS Example of MS application for the registration of biological products: analysis of amino acid variants e.g. deamidation, oxidation, glycation or glycosylation profile of drug substance

31 Immunological assays Exploit antigen-antibody interaction Examples: Precipitation/agglutination reactions Western blot ELISA

32 Precipitation/Agglutination

33 Precipitation/Agglutination Antibody/antigen interaction Similarity: antibody crosslink antigen and form precipitate Difference: nature of antigen Precipitation = soluble antigen Agglutination = insoluble antigen e.g. RBC, bacteria, antigen fixed on beads (HCG, bacterial toxins, etc.) Picture taken from:

34 Example of precipitation/agglutination reaction Hemaglutination assay

35 Western blot Resolve proteins by SDS-PAGE 35

36 Western blot 1. Transfer proteins in gel onto other solid membrane Nitrocellulose PVDF (Polyvinylidene difluoride) 2. Stain with antibody specific to the protein of interest 3. Detect with appropriate methods Colorimetric Chemiluminescent Fluorescent, IR etc. 36

37 Diversity of amino acid

38 Isoelectric focusing

39 2D-SDS-PAGE

40 ELISA Enzyme-Linked ImmunoSorbent Assay Comparison of test samples with standard antigen with known concentration yield semi-quantitative/quantitative measurement of antigen in test sample

41 Example of ELISA application for the registration of biological products Host cell protein Leachable protein A Antibiotics Insulin Some small molecules: HEPES, resin components, etc.

42 Various laboratory techniques are routinely used for the characterization of biological products Nucleic acid AGE Hybridization Sequencing PCR, qpcr Microarray Protein Amino acid analysis Edman degradation Peptide mapping: HPLC, MS, MS-MS SDS-PAGE & protein staining IEF 2D-gel Immunological assays Precipitation/ agglutination Western blot ELISA Picture taken from:

43 Thank you!

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural

More information

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open! Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide Protein name and full primary structure, by providing a NCBI (or UniProt) accession

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Genetic Fingerprinting

Genetic Fingerprinting Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Chapter 10 Analytical Biotechnology and the Human Genome

Chapter 10 Analytical Biotechnology and the Human Genome Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of

More information

Molekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien

Molekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

Purification of Lactate Dehydrogenase

Purification of Lactate Dehydrogenase Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA

LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA I. Objectives The purpose of today s lab is to learn how to set up and run an agarose gel, separate DNA fragments on the gel, and

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

DETECTION OF GMOs (LMOs).

DETECTION OF GMOs (LMOs). ISO/9001:2000 Certified Organisation NABL Accredited (ISO 17025) ISO 14000 DETECTION OF GMOs (LMOs). LALITHA R. GOWDA DEPARTMENT OF PROTEIN CHEMISTRY AND TECHNOLOGY CENTRAL FOOD TECHNOLOGICAL RESEARCH

More information

Manipulation of Purified DNA

Manipulation of Purified DNA Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

BIBC 103 Learning Goals with Supporting Learning Outcomes

BIBC 103 Learning Goals with Supporting Learning Outcomes BIBC 103 Learning Goals with Supporting Learning Outcomes 1) Basic Lab Skills A. Conceptual understanding and moderate level of hands-on proficiency in making laboratory solutions, including understanding

More information

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC HIGH SCHOOL STUDENT SCIENCE WEEK St. Paul s Hospital Vancouver, BC Sponsors 2 AGENDA Location: UBC James Hogg Research Centre (JHRC), St. Paul s Hospital, Room 166 Burrard Building, 1081 Burrard Street,

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss

More information

Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...

Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle... Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

CHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc.

CHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc. CHAPTER 08: RECOMBINANT DNA TECHNOLOGY The Role of Recombinant DNA Technology in Biotechnology Biotechnology the use of microorganisms to make practical products Recombinant DNA technology Intentionally

More information

GeneTools the Essential Software For Accurate DNA/RNA Gel and Blot Analysis

GeneTools the Essential Software For Accurate DNA/RNA Gel and Blot Analysis Technical Note 27 GeneTools the Essential Software For Accurate DNA/RNA Gel and Blot Analysis Introduction Capturing an image of a DNA/RNA gel or blot with an image analysis system is only the start of

More information

Synthetic Biology for

Synthetic Biology for Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

GM (Genetically Modified) Plants. Background

GM (Genetically Modified) Plants. Background 1 GM (Genetically Modified) Plants Background Genetically modified crops (GM) have been used since 1996 in the U.S. GM crops contain foreign genetic material The DNA may be from another plant or from a

More information

Stability of Biological Products

Stability of Biological Products Stability of Biological Products Dr Jurgen Lindner Principal, BioPharma Consulting & Executive Secretary, APIMAA Biological Products Functional Proteins or Polypeptides (mab s, enzymes & inhibitors, growth

More information

Nucleic Acid Electrophoresis APPLICATION GUIDE

Nucleic Acid Electrophoresis APPLICATION GUIDE AGAROSE BUFFERS LADDERS EQUIPMENT Nucleic Acid Electrophoresis APPLICATION GUIDE Reagents: Agarose Thermo Scientific and Fisher Scientific products deliver an end-to-end solution that can meet your most

More information

Advances in analytical biochemistry and systems biology: Proteomics

Advances in analytical biochemistry and systems biology: Proteomics Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current

More information

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application

More information

INTRODUCTION TO SOME BASIC METHODS IN MOLECULAR BIOLOGY

INTRODUCTION TO SOME BASIC METHODS IN MOLECULAR BIOLOGY INTRODUCTION TO SOME BASIC METHODS IN MOLECULAR BIOLOGY Ho Huynh Thuy Duong University of Science April 2009 1 PROBLEM : Metamorphosis in amplibian is a process involving many radical molecular, morphological

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

Top down proteomics approaches: (a) to monitor protein purification; (b) to resolve PTM isoforms and protein complexes

Top down proteomics approaches: (a) to monitor protein purification; (b) to resolve PTM isoforms and protein complexes Top down proteomics approaches: (a) to monitor protein purification; (b) to resolve PTM isoforms and protein complexes Jan 11, 2013 BMG744 Helen Kim Department of Pharmacology and Toxicology Targeted Metabolomics

More information

Blot: a spot or stain, especially of ink on paper.

Blot: a spot or stain, especially of ink on paper. Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf

More information

Regents Biology REVIEW 5: GENETICS

Regents Biology REVIEW 5: GENETICS Period Date REVIEW 5: GENETICS 1. Chromosomes: a. Humans have chromosomes, or homologous pairs. Homologous: b. Chromosome pairs carry genes for the same traits. Most organisms have two copies of the gene

More information

Bacteria in Semen. Sponsored by Bedford Research Foundation

Bacteria in Semen. Sponsored by Bedford Research Foundation Bacteria in Semen Background: The concept of detecting and identifying bacteria by ribosomal RNA gene sequences is about 15 years old. Although limited, the application of this approach to clinical specimens

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS

More information

Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS

Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS Michal Godula Ph.D. Thermo Fisher Scientific The world leader in serving science

More information

Bio Rad PCR Song Lyrics

Bio Rad PCR Song Lyrics Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.

More information

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:

More information

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating

More information

Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho

Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying

More information

Lecture 8: Affinity Chromatography-III

Lecture 8: Affinity Chromatography-III Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The

More information

special offers from your protein biology resource

special offers from your protein biology resource special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?

More information

Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture Taxonomy (three

More information

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction

More information

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used

More information

MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING

MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING BME MOLECULAR BIOLOGY EXPERIMENT PCR & SEEDING SKKU BME 3 RD GRADE, 2 ND SEMESTER FOR FUN PCR & SEEDING PCR: polymerase chain reaction Electrophoresis Seeding These are for amplifying DNA and cell PCR

More information

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)

More information

Instant-Bands Protein Sample Loading Buffer for SDS-PAGE. User s Manual. View Protein Bands in an SDS Gel. Instantly. EZBiolab.

Instant-Bands Protein Sample Loading Buffer for SDS-PAGE. User s Manual. View Protein Bands in an SDS Gel. Instantly. EZBiolab. Instant-Bands Protein Sample Loading Buffer for SDS-PAGE User s Manual View Protein Bands in an SDS Gel Instantly www.ezbiolab.com 2 Instant-Bands User s Manual Table of Contents Introduction 3 Storage

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology Brought American Society of Cytopathology Core Curriculum in Molecular Biology Brought American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

Protein Expression, Electrophoresis, His tag Purification

Protein Expression, Electrophoresis, His tag Purification Protein Expression, Electrophoresis, His tag Purification 2013 edition H.E. Schellhorn Day 2 Lecture 2- Protein Expression Protein over-expression and purification are key techniques in Molecular Biology

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within

More information

The Role of Mass Spectrometry for Developing Biotherapeutics: Regulatory Perspectives

The Role of Mass Spectrometry for Developing Biotherapeutics: Regulatory Perspectives The Role of Mass Spectrometry for Developing Biotherapeutics: Regulatory Perspectives Jun Park, Ph.D. Division of Monoclonal Antibodies Office of Biotechnology Products CDER/FDA CASSS, Applications of

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

Players. Processes. Molecular Biology Recombinant DNA technology (So... you want to be a genetic engineer)

Players. Processes. Molecular Biology Recombinant DNA technology (So... you want to be a genetic engineer) lay Davis, 8/11/12 Molecular Biology Recombinant DN technology (So... you want to be a genetic engineer) Introduction, or, games to play with DN You have learned something of the structure of DN, its replication,

More information

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription

More information

Sample Question Paper Session Class XII Biotechnology (045) Marking Scheme

Sample Question Paper Session Class XII Biotechnology (045) Marking Scheme Sample Question Paper Session 2015-16 Class XII Biotechnology (045) Marking Scheme SECTION-A 1. Methylation Student will add a methyl group to one or two bases within the sequence recognized by enzyme.

More information