PCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis

Size: px
Start display at page:

Download "PCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis"

Transcription

1 PCR Arrays An Advanced Real-time PCR Technology to Empower Your Pathway Analysis 1

2 Table of Contents 1. Introduction to the PCR Arrays 2. How PCR Arrays Work 3. Performance Data from PCR Arrays 4. Research Applications for PCR Arrays 2

3 PCR Array System- A Complete Solution Complete System for qrt-pcr based Profiling: 1. PCR Arrays in 96 or 384 well format compatible with most qpcr instruments 2. Optimized 1 st strand synthesis kit including builtin controls 3. Optimized SYBR Green Master Mix 4. Free web or Excel based data analysis software We are very happy with our PCR arrays. We love how easy it is to upload the data to the website and analyze it Nicole Schaeublin Lab Manager Henry Jackson Foundation 3

4 How PCR Arrays Work cdna Synthesis (C-03 kit) 45 minutes Load Plates (Preferably with 8- Channel Pipettors) 2 minutes Run 40 cycle qpcr Program 2 hours Upload and Analyze Data 15 minutes 4

5 Anatomy of a PCR Array 84 Pathway-Specific Genes of Interest 5 House Keeping Genes Genomic DNA Contamination Control Triplicate Reverse Transcription Controls Triplicate Positive PCR Controls 5

6 How Genes on PCR Arrays Are Selected Biologically relevant gene content Not simply biochemical pathways or kinase cascades Published association with the biological or disease pathway Specific gene information is gathered from a large number of different overlapping sources including: Multiple Publicly Accessible Databases Text Mining Relevant Literature Technically relevant gene content Use genes that are regulated at the mrna level Specific feedback from thought leaders Genes in Signaling Pathways Genes with High Relevance 6

7 PCR Arrays for All Biomedical Research (with live links) Cancer and Apoptosis Cytokines & Inflammation Development & Stem Cells Apoptosis Inflammatory Cytokines Stem Cells Cell Cycle Th17 for Inflammation (NEW!) Wnt Signaling Human mirna Array (NEW!) Common Cytokines Notch Signaling Breast Cancer & Estrogen Receptor Chemokines TGF / BMP Signaling Tumor Metastasis NF- B Signaling Pathway Endothelial Cell Biology Cancer PathwayFinder Th1-Th2-Th3 Osteogenesis Angiogenesis TNF Ligands Growth Factors Cancer Drug Resistance Toll-like Receptors ECM & Adhesion Signal Transduction Toxicology & Drug Metabolism Neuroscience Signal Transduction PathwayFinder Drug Metabolism Neuroscience Ion Channels NFkB Signaling Drug Phase I Enzymes Neurotransmitter Receptors Jak / Stat Signaling Drug Transporters Neurotrophins & Receptors DNA Damage Signaling Oxidative Stress Neurogenesis and Neural Stem Cell Insulin Signaling Stress & Toxicity MAP Kinase Signaling Other Diseases Custom PCR Arrays camp / Calcium Signaling Atherosclerosis 96-Well Custom Arrays p53 Signaling Diabetes 384-Well Custom Arrays Complete PCR Array List 7

8 Compatible Instrumentation: 96- & 384-Well Format Products compatible with most instruments available: Applied Biosystems (ABI) Standard 96-Well Blocks: 7000, 7300, 7500, 7700 FAST 96-Well Blocks: 7500, 7900HT FAST 384-Well Block: 7900HT StepOne Plus Bio-Rad icycler, MyiQ, iq5 MJ Research: Opticon, Opticon 2, Chromo 4 Stratagene Mx3000p, Mx3005p, Mx4000p Roche LightCycler 480 Eppendorf masterplex ep 8

9 Data Analysis Complete & easy data analysis Web-based software No installation needed From raw Ct value to fold change with multiple analysis formats Volcano plot Scatter plot Multi-group plot Clustergram Bookmark the site 9

10 Superb Sensitivity See More Genes with Less RNA Human Inflammatory Cytokines & Receptors PCR Array tested with Universal Reference RNA Human Inflammatory Cytokines & Receptors Array used to analyze uninduced represented at very low copy numbers ng total RNA used for per 96 well plate 99% of genes detectable with >500ng >80% of genes detectable with >25ng Very sensitive assay! CONCLUSION: See gene expression as rare as UN-induced cytokines. 10

11 High Specificity Assays on Human TGFb & BMP Signaling Pathway PCR Array used to analyze BMP genes in Universal Reference RNA High specificity on genes difficult to design specific primers for. Single peak dissociation curves Single gel bands of predicted size CONCLUSION: Each well on PCR Arrays detects a single gene-specific product. 11

12 High Reproducibility Reproducibility Among Different Users Reproducibility Among Different Instruments Human Drug Metabolism PCR Array in Universal Reference RNA CONCLUSION The PCR Arrays are SO reproducible that the same raw threshold cycle data can be obtained for the same samples even from different end users at different times or using different instruments.. 12

13 Uniform Amplication Efficiency Representative set of 500 out of > 4,000 assays used in PCR Arrays CONCLUSION: Accurate and reliable C t results are guaranteed. 13

14 Application Areas of PCR Arrays Biomarker Validation Drug Discovery Phenotypic Analysis (Transgenic Animals & Cells) PCR Array Gene Regulation Gene Expression Signal Transduction 14

15 Application Example 1: Cytokine Profiling Common Cytokine PCR Array Identified 23 Up-Regulated and 6 Down-Regulated Genes Following PMA and Ionomycin Treatment. (see details, click here) 15

16 Application Example 2: Toxicity Studies Stress & Toxicity PathwayFinder PCR Array Uncovered Distinct Gene Expression Profiles Associated with Liver Toxicity Caused by 3 PPARg Agonists (Actos, Avandia, and Rezulin) 16 (see details, click here)

17 Application Example 3: Tumor Analysis ECM & Cell Adhesion PCR Arrays Revealed Up- and Down- Regulated Genes in Breast Cancer. (see details, click here) 17

18 SUMMARY Complete System Four-component system: arrays, master mix, first strand kit, and free data analysis software Two-hour protocol from RNA to data Breadth of Pathway Content Profile the genes and pathways that you really care about More than 100 pathways for human, mouse, and rat Customizable by gene, set, or pathway Superb Real-Time PCR Performance Reliability, Reproducibility, Sensitivity, Specificity Broad Application Cancer, immunology, neuroscience, stem cells & much more 18

19 PCR Arrays for All Biomedical Research (with live links) Cancer and Apoptosis Cytokines & Inflammation Development & Stem Cells Apoptosis Inflammatory Cytokines Stem Cells Cell Cycle Th17 for Inflammation (NEW!) Wnt Signaling Human mirna Array (NEW!) Common Cytokines Notch Signaling Breast Cancer & Estrogen Receptor Chemokines TGF / BMP Signaling Tumor Metastasis NF- B Signaling Pathway Endothelial Cell Biology Cancer PathwayFinder Th1-Th2-Th3 Osteogenesis Angiogenesis TNF Ligands Growth Factors Cancer Drug Resistance Toll-like Receptors ECM & Adhesion Signal Transduction Toxicology & Drug Metabolism Neuroscience Signal Transduction PathwayFinder Drug Metabolism Neuroscience Ion Channels NFkB Signaling Drug Phase I Enzymes Neurotransmitter Receptors Jak / Stat Signaling Drug Transporters Neurotrophins & Receptors DNA Damage Signaling Oxidative Stress Neurogenesis and Neural Stem Cell Insulin Signaling Stress & Toxicity MAP Kinase Signaling Other Diseases Custom PCR Arrays camp / Calcium Signaling Atherosclerosis 96-Well Custom Arrays p53 Signaling Diabetes 384-Well Custom Arrays Complete PCR Array List 19

20 PCR Arrays Empower Your Pathway Analysis Experience the performance of PCR Arrays- Try them today! Promo Code: PT08PA7 20% Off on All PCR Arrays; Call to use the promo code. (Expires on 7/31/08, Valid only for the customers in the US and Canada ). Telephone: (M-F 9AM-6PM Eastern) Thousands of scientists have discovered the power of PCR Arrays. Join them on the road to success! 20

RT 2 Profiler PCR Array: Web-based data analysis tutorial

RT 2 Profiler PCR Array: Web-based data analysis tutorial RT 2 Profiler PCR Array: Web-based data analysis tutorial.questions? Comments? or Suggestions?.Ask now or contact Technical Support.M F, 9 AM 6 PM EST..Telephone: 888-503-3187;.Email: support@sabiosciences.com.international

More information

ExProfile TM Gene qpcr Arrays

ExProfile TM Gene qpcr Arrays ExProfile TM Gene s For high-throughput profiling of coding-gene expression User Manual GeneCopoeia, Inc. 9620 Medical Center Drive, #101 Rockville, MD 20850 USA 301-762-0888 866-360-9531 support@genecopoeia.com

More information

RT 2 Easy First Strand Handbook

RT 2 Easy First Strand Handbook March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,

More information

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible) NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents

More information

A systematic guideline for developing the best real-time PCR primers

A systematic guideline for developing the best real-time PCR primers Scientific article Lessons learned from designing assays for more than 14, genes George Quellhorst and Sam Rulli QIAGEN, 6951 Executive Way, Frederick, Maryland 213, USA Abstract: Primer design is the

More information

Pathway-focused gene expression profiling with qrt-pcr

Pathway-focused gene expression profiling with qrt-pcr Scientific article Emi Arikawa, George Quellhorst, Ying Han, Hongguang Pan, and Jingping Yang QIAGEN, 6951 Executive Way, Frederick, Maryland 2173, USA Abstract: This paper evaluates the performance of

More information

Precision MULTIPLEX qpcr Master Mix. Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR

Precision MULTIPLEX qpcr Master Mix. Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR Precision MULTIPLEX qpcr Master Mix Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents

More information

The StellARray qpcr Array System: Integrated Solution for Expression Profiling

The StellARray qpcr Array System: Integrated Solution for Expression Profiling The StellARray qpcr Array System: Integrated Solution for Expression Profiling Go to www.array.lonza.com/stellarrays Bioinformatics tool for gene selection Go to www.array.lonza.com/genesieve Collection

More information

RT 2 Profiler PCR Array System

RT 2 Profiler PCR Array System User Manual RT 2 Profiler PCR Array System Pathway-Focused Gene Expression Profiling Using Real-Time PCR See Purchaser Notification for limited use license and warranty information (page 3). Part #1022A

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Precision FAST qpcr Master Mix. Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR

Precision FAST qpcr Master Mix. Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR Precision FAST qpcr Master Mix Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents and Equipment

More information

D E. QPCR Optimization & Troubleshooting Guide

D E. QPCR Optimization & Troubleshooting Guide D C C QPCR Optimization & roubleshooting Guide Introduction Whether you are beginning to develop a QPCR assay, have a QPCR assay you want to optimize, or are getting questionable results and don t know

More information

SYBR Real-Time PCR Kit

SYBR Real-Time PCR Kit SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

PRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the

More information

Exceed the limit. SensiFAST Real-Time PCR Family. Superior Sensitive Quantification

Exceed the limit. SensiFAST Real-Time PCR Family. Superior Sensitive Quantification Exceed the limit SensiFAST Real-Time PCR Family Superior Sensitive Quantification SensiFAST Real-Time PCR Kits Fast - optimized for fast cycling conditions (under 30 minutes), ideal for high-throughput

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

qbiomarker PCR Array Handbook

qbiomarker PCR Array Handbook March 2011 qbiomarker PCR Array Handbook qbiomarker Screening PCR Array qbiomarker Validation PCR Array For induced pluripotent stem cell screening, validation, and differentiation Sample & Assay Technologies

More information

Precision PLUS OneStep qrt-pcr Master Mix. Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR

Precision PLUS OneStep qrt-pcr Master Mix. Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR Precision PLUS OneStep qrt-pcr Master Mix Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products

More information

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu

More information

QuantiTect Primer Assay Handbook

QuantiTect Primer Assay Handbook July 2011 QuantiTect Primer Assay Handbook For genomewide, ready-to-use real-time RT-PCR assays using SYBR Green detection Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the

More information

SYBR Advantage qpcr Premix. User Manual

SYBR Advantage qpcr Premix. User Manual User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company

More information

Same TaqMan Assay quality, new format

Same TaqMan Assay quality, new format Product Bulletin TaqMan Array Plates TaqMan Array Plates TaqMan Gene Expression Assays delivered in ready-to-use 96-well Custom Array Plates or predefined Gene Signature Plates Flexible choose from customizable

More information

AmoyDx JAK2 Mutation Detection Kit

AmoyDx JAK2 Mutation Detection Kit AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instruction for Use For Research Use Only Instruction Version: B2.6 Revision Date: October 2013 Store at -20±5 Xiamen,

More information

RT 2 Profiler PCR Array Handbook

RT 2 Profiler PCR Array Handbook December 2014 RT 2 Profiler PCR Array Handbook RT 2 Profiler PCR Array RT 2 First Strand Kit RT 2 SYBR Green qpcr Mastermix RT 2 SYBR Green Fluor qpcr Mastermix RT 2 SYBR Green ROX qpcr Mastermix RT 2

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

PCR Array FAQ s. PCR Arrays: Placing an order

PCR Array FAQ s. PCR Arrays: Placing an order PCR Array FAQ s PCR Arrays: Placing an order What PCR Array services does the facility provide? The DNA Analysis Facility provides support for gene expression studies using PCR Array technology from a

More information

KAPA PROBE FAST qpcr Master Mix (2X) Kit

KAPA PROBE FAST qpcr Master Mix (2X) Kit KR0397_S v1.17 Product Description s are designed for fast-cycling, real-time PCR (qpcr) using sequence-specific fluorogenic probes. These kits are compatible with all fluorogenic probe-based technologies,

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Quant-X One-Step qrt-pcr TB Green Kit User Manual

Quant-X One-Step qrt-pcr TB Green Kit User Manual Takara Bio USA Quant-X One-Step qrt-pcr TB Green Kit User Manual Cat. No. 638317 PT5058-1 (022818) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United

More information

Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples

Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples APPLICATION NOTE SuperScript IV Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples Introduction Most commercially available reverse transcription products do not perform well with difficult

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

Gene Expression on the Fluidigm BioMark HD

Gene Expression on the Fluidigm BioMark HD Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental

More information

BioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR

BioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR BioBank cdna kit Instructions for the use of BioBank control cdna in real-time PCR Contents Introduction 3 Kit contents 4 Reagents and equipment to be supplied by user 4 Kit storage and stability 4 Primerdesign

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Introduction to Real-Time PCR: Basic Principles and Chemistries

Introduction to Real-Time PCR: Basic Principles and Chemistries Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the

More information

TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5

TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5 www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

SOP: SYBR Green-based real-time RT-PCR

SOP: SYBR Green-based real-time RT-PCR SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong

More information

Sus scrofa Pig Speciation Kit

Sus scrofa Pig Speciation Kit Techne qpcr test Sus scrofa Speciation Kit 100 tests For general laboratory and research use only 1 2 Kit Contents specific primer/probe mix (BROWN) FAM labelled positive control template (RED) Internal

More information

ExProfile TM Gene qpcr Arrays

ExProfile TM Gene qpcr Arrays ExProfile TM s For high-throughput profiling of coding-gene expression User Manual GeneCopoeia, Inc. 9620 Medical Center Drive, #101 Rockville, MD 20850 USA 301-762-0888 866-360-9531 support@genecopoeia.com

More information

Perfect Real Time PCR Products Guide

Perfect Real Time PCR Products Guide Perfect Real Time PCR Products Guide Choose the best Real Time PCR solution for your application! DNA & RNA template preparation One Step and Two Step Real Time RT-PCR Real Time PCR Premixes PrimerArray

More information

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)

More information

Primerdesign Ltd. High risk Human Papillomavirus. Multiplex screening kit. genesig kit. 100 tests. For general laboratory and research use only

Primerdesign Ltd. High risk Human Papillomavirus. Multiplex screening kit. genesig kit. 100 tests. For general laboratory and research use only Primerdesign Ltd High risk Human Papillomavirus Multiplex screening kit genesig kit 100 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus Papillomaviruses are a

More information

Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application

Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_173959.4 CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1

More information

Assay Design Considerations, Optimization and Validation

Assay Design Considerations, Optimization and Validation Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

More information

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa

More information

Stratagene QPCR Human Reference Total RNA

Stratagene QPCR Human Reference Total RNA Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

RT 2 RNA QC PCR Array Handbook

RT 2 RNA QC PCR Array Handbook December 2012 RT 2 RNA QC PCR Array Handbook For quality control analysis prior to gene expression profiling using real-time RT-PCR Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

M. tuberculosis_mpb64/is611. genesig Advanced Kit. 150 tests. Primerdesign Ltd. For general laboratory and research use only

M. tuberculosis_mpb64/is611. genesig Advanced Kit. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd M. tuberculosis_mpb64/is611 0 genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to M.tuberculosis_MPB64/IS6110 2 Specificity MAX MIN The Primerdesign

More information

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping

More information

Viral Hemorrhagic Septicemia Virus

Viral Hemorrhagic Septicemia Virus Techne qpcr test Viral Hemorrhagic Septicemia Virus Non-coding region 150 tests For general laboratory and research use only 1 Introduction to Viral Hemorrhagic Septicemia Virus Viral Hemorrhagic Septicaemia

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

Brilliant II SYBR Green QPCR Master Mix

Brilliant II SYBR Green QPCR Master Mix Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Sus scrofa Pig genesig Advanced Speciation Kit

Sus scrofa Pig genesig Advanced Speciation Kit TM Primerdesign Ltd Pig genesig Advanced Speciation Kit 100 tests For general laboratory and research use only 1 Principles of the test Real-time PCR This kit provides a method for detecting mitochondrial

More information

The Pathways to Understanding Diseases

The Pathways to Understanding Diseases FOR PHARMA & LIFE SCIENCES White paper The Pathways to Understanding Diseases Deciphering complex biological processes Executive Summary Understanding complex biological processes is critical whether doing

More information

Human Papillomavirus 16

Human Papillomavirus 16 TM Primerdesign Ltd Human Papillomavirus 16 E6 gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus 16 Papillomaviruses are a diverse

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

AmoyDx JAK2 Mutation Detection Kit

AmoyDx JAK2 Mutation Detection Kit AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use For Research Use Only and For Reference Only Instructions Version: B1.2 Date of Revision: June 2016

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

LightCycler EvoScript RNA Masters Datasheet

LightCycler EvoScript RNA Masters Datasheet LightCycler EvoScript RNA Masters Datasheet Witness the evolution of one-step RT-qPCR Extracting reliable answers from RNA can be a challenge. When samples are poor and copy numbers are low, rely on the

More information

Sus scrofa Pig genesig Speciation Kit

Sus scrofa Pig genesig Speciation Kit TM Primerdesign Ltd Sus scrofa genesig Speciation Kit 100 tests For general laboratory and research use only 1 Principles of the test Real-time PCR This kit provides a method for detecting Sus scrofa mitochondrial

More information

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

SYBR Advantage qpcr Premix User Manual

SYBR Advantage qpcr Premix User Manual SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General

More information

AmoyDx TM JAK2 V617F Mutation Detection Kit

AmoyDx TM JAK2 V617F Mutation Detection Kit AmoyDx TM JAK2 V617F Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use Instructions Version: B1.0 Date of Revision: July 2012 Store at -20±2 o C -1/5- Background

More information

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing

More information

User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR

User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

SYBR Green Realtime PCR Master Mix

SYBR Green Realtime PCR Master Mix Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection

More information

Hepatitis A Virus. genesig Standard Kit 5 NCR. 150 tests. Primerdesign Ltd. For general laboratory and research use only

Hepatitis A Virus. genesig Standard Kit 5 NCR. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Hepatitis A Virus 5 NCR genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Hepatitis A Virus Hepatitis virus (HAV) is a non-enveloped ssrna

More information

Anas platyrhynchos Duck. Advanced Speciation Kit. 100 tests. For general laboratory and research use only

Anas platyrhynchos Duck. Advanced Speciation Kit. 100 tests. For general laboratory and research use only Anas platyrhynchos Duck Advanced Speciation Kit 100 tests For general laboratory and research use only Carry over contamination between PCR reactions can be prevented by including uracil-nglycosylase

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Dengue Virus subtypes 1, 2, 3 and 4 (Multiplex kit)

Dengue Virus subtypes 1, 2, 3 and 4 (Multiplex kit) Primerdesign TM Ltd Dengue Virus subtypes 1, 2, 3 and 4 (Multiplex kit) genesig advanced kit 100 tests For general laboratory and research use only 1 Contents Introduction to Dengue Virus 3 Specificity

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

Epstein Barr Virus (Human Herpes virus 4)

Epstein Barr Virus (Human Herpes virus 4) TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to

More information

Human Papillomavirus 52 and 52b

Human Papillomavirus 52 and 52b Techne qpcr test Human Papillomavirus 52 and 52b E6 gene 150 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus 52 and 52b Papillomaviruses are a diverse group of

More information

QuantiTect Multiplex PCR Handbook

QuantiTect Multiplex PCR Handbook Second Edition December May 2005 2011 QuantiTect Multiplex PCR Handbook QuantiTect Multiplex PCR Kit with master mix containing ROX passive reference dye QuantiTect Multiplex PCR NoROX Kit with master

More information

PrimePCR Assays, Panels, and Controls for Real-Time PCR. Instruction Manual

PrimePCR Assays, Panels, and Controls for Real-Time PCR. Instruction Manual PrimePCR Assays, Panels, and Controls for Real-Time PCR Instruction Manual Bio-Rad Technical Support For help and technical advice, please contact the Bio-Rad Technical Support department. In the United

More information

FastFire qpcr PreMix (Probe)

FastFire qpcr PreMix (Probe) FastFire qpcr PreMix (Probe) For fast, quantitative, specific real-time PCR using sequence-specific probe www.tiangen.com/en FP130820 Kit Contents FastFire qpcr PreMix (Probe) Contents 2 FastFire qpcr

More information

Human T-lymphotropic Virus 1

Human T-lymphotropic Virus 1 TM Primerdesign Ltd Human T-lymphotropic Virus 1 Polymerase gene (POL) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human T-lymphotropic Virus 1 Human T-lymphotropic

More information

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,

More information

Brilliant SYBR Green QPCR Master Mix

Brilliant SYBR Green QPCR Master Mix Brilliant SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600548 (single kit) #929548 (10-pack kit) Revision B.01 For In Vitro Use Only 600548-12 LIMITED PRODUCT WARRANTY This warranty limits our

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light

More information

All-in-One TM mirna qrt-pcr Detection Kit

All-in-One TM mirna qrt-pcr Detection Kit mirna qrt-pcr Detection Kit For quantitative detection of mature mirna Cat. No. QP015 (20 RT and 200 qpcr reactions) Cat. No. QP016 (60 RT and 600 qpcr reactions) Used in combination with the All-in-One

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign

More information

Protein/Cytokine Array Services

Protein/Cytokine Array Services Protein/Cytokine Array Services at the Analytical Instrumentation Core Boston University, AIC, DOM, BMC, BUMC 2015 Analytical Instrumentation Core Mission: The AIC supports investigators through both cutting-edge

More information

Mycobacterium Tuberculosis

Mycobacterium Tuberculosis TM Primerdesign Ltd Mycobacterium Tuberculosis rep13e12 genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis

More information

Dengue Virus subtypes 1,2 3 and 4

Dengue Virus subtypes 1,2 3 and 4 TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Dengue Virus subtypes 1,2

More information

Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene. genesig Advanced Kit. 150 tests.

Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene. genesig Advanced Kit. 150 tests. TM Primerdesign Ltd Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Antibiotic

More information

Human Herpes Virus 1 (Herpes simplex type 1)

Human Herpes Virus 1 (Herpes simplex type 1) TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human

More information

Foot & Mouth Disease Virus

Foot & Mouth Disease Virus TM Primerdesign Ltd Foot & Mouth Disease Virus 5' untranslated region (5'UTR) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Foot & Mouth Disease Virus Foot-and-mouth

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information