PCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis
|
|
- Martin Gallagher
- 6 years ago
- Views:
Transcription
1 PCR Arrays An Advanced Real-time PCR Technology to Empower Your Pathway Analysis 1
2 Table of Contents 1. Introduction to the PCR Arrays 2. How PCR Arrays Work 3. Performance Data from PCR Arrays 4. Research Applications for PCR Arrays 2
3 PCR Array System- A Complete Solution Complete System for qrt-pcr based Profiling: 1. PCR Arrays in 96 or 384 well format compatible with most qpcr instruments 2. Optimized 1 st strand synthesis kit including builtin controls 3. Optimized SYBR Green Master Mix 4. Free web or Excel based data analysis software We are very happy with our PCR arrays. We love how easy it is to upload the data to the website and analyze it Nicole Schaeublin Lab Manager Henry Jackson Foundation 3
4 How PCR Arrays Work cdna Synthesis (C-03 kit) 45 minutes Load Plates (Preferably with 8- Channel Pipettors) 2 minutes Run 40 cycle qpcr Program 2 hours Upload and Analyze Data 15 minutes 4
5 Anatomy of a PCR Array 84 Pathway-Specific Genes of Interest 5 House Keeping Genes Genomic DNA Contamination Control Triplicate Reverse Transcription Controls Triplicate Positive PCR Controls 5
6 How Genes on PCR Arrays Are Selected Biologically relevant gene content Not simply biochemical pathways or kinase cascades Published association with the biological or disease pathway Specific gene information is gathered from a large number of different overlapping sources including: Multiple Publicly Accessible Databases Text Mining Relevant Literature Technically relevant gene content Use genes that are regulated at the mrna level Specific feedback from thought leaders Genes in Signaling Pathways Genes with High Relevance 6
7 PCR Arrays for All Biomedical Research (with live links) Cancer and Apoptosis Cytokines & Inflammation Development & Stem Cells Apoptosis Inflammatory Cytokines Stem Cells Cell Cycle Th17 for Inflammation (NEW!) Wnt Signaling Human mirna Array (NEW!) Common Cytokines Notch Signaling Breast Cancer & Estrogen Receptor Chemokines TGF / BMP Signaling Tumor Metastasis NF- B Signaling Pathway Endothelial Cell Biology Cancer PathwayFinder Th1-Th2-Th3 Osteogenesis Angiogenesis TNF Ligands Growth Factors Cancer Drug Resistance Toll-like Receptors ECM & Adhesion Signal Transduction Toxicology & Drug Metabolism Neuroscience Signal Transduction PathwayFinder Drug Metabolism Neuroscience Ion Channels NFkB Signaling Drug Phase I Enzymes Neurotransmitter Receptors Jak / Stat Signaling Drug Transporters Neurotrophins & Receptors DNA Damage Signaling Oxidative Stress Neurogenesis and Neural Stem Cell Insulin Signaling Stress & Toxicity MAP Kinase Signaling Other Diseases Custom PCR Arrays camp / Calcium Signaling Atherosclerosis 96-Well Custom Arrays p53 Signaling Diabetes 384-Well Custom Arrays Complete PCR Array List 7
8 Compatible Instrumentation: 96- & 384-Well Format Products compatible with most instruments available: Applied Biosystems (ABI) Standard 96-Well Blocks: 7000, 7300, 7500, 7700 FAST 96-Well Blocks: 7500, 7900HT FAST 384-Well Block: 7900HT StepOne Plus Bio-Rad icycler, MyiQ, iq5 MJ Research: Opticon, Opticon 2, Chromo 4 Stratagene Mx3000p, Mx3005p, Mx4000p Roche LightCycler 480 Eppendorf masterplex ep 8
9 Data Analysis Complete & easy data analysis Web-based software No installation needed From raw Ct value to fold change with multiple analysis formats Volcano plot Scatter plot Multi-group plot Clustergram Bookmark the site 9
10 Superb Sensitivity See More Genes with Less RNA Human Inflammatory Cytokines & Receptors PCR Array tested with Universal Reference RNA Human Inflammatory Cytokines & Receptors Array used to analyze uninduced represented at very low copy numbers ng total RNA used for per 96 well plate 99% of genes detectable with >500ng >80% of genes detectable with >25ng Very sensitive assay! CONCLUSION: See gene expression as rare as UN-induced cytokines. 10
11 High Specificity Assays on Human TGFb & BMP Signaling Pathway PCR Array used to analyze BMP genes in Universal Reference RNA High specificity on genes difficult to design specific primers for. Single peak dissociation curves Single gel bands of predicted size CONCLUSION: Each well on PCR Arrays detects a single gene-specific product. 11
12 High Reproducibility Reproducibility Among Different Users Reproducibility Among Different Instruments Human Drug Metabolism PCR Array in Universal Reference RNA CONCLUSION The PCR Arrays are SO reproducible that the same raw threshold cycle data can be obtained for the same samples even from different end users at different times or using different instruments.. 12
13 Uniform Amplication Efficiency Representative set of 500 out of > 4,000 assays used in PCR Arrays CONCLUSION: Accurate and reliable C t results are guaranteed. 13
14 Application Areas of PCR Arrays Biomarker Validation Drug Discovery Phenotypic Analysis (Transgenic Animals & Cells) PCR Array Gene Regulation Gene Expression Signal Transduction 14
15 Application Example 1: Cytokine Profiling Common Cytokine PCR Array Identified 23 Up-Regulated and 6 Down-Regulated Genes Following PMA and Ionomycin Treatment. (see details, click here) 15
16 Application Example 2: Toxicity Studies Stress & Toxicity PathwayFinder PCR Array Uncovered Distinct Gene Expression Profiles Associated with Liver Toxicity Caused by 3 PPARg Agonists (Actos, Avandia, and Rezulin) 16 (see details, click here)
17 Application Example 3: Tumor Analysis ECM & Cell Adhesion PCR Arrays Revealed Up- and Down- Regulated Genes in Breast Cancer. (see details, click here) 17
18 SUMMARY Complete System Four-component system: arrays, master mix, first strand kit, and free data analysis software Two-hour protocol from RNA to data Breadth of Pathway Content Profile the genes and pathways that you really care about More than 100 pathways for human, mouse, and rat Customizable by gene, set, or pathway Superb Real-Time PCR Performance Reliability, Reproducibility, Sensitivity, Specificity Broad Application Cancer, immunology, neuroscience, stem cells & much more 18
19 PCR Arrays for All Biomedical Research (with live links) Cancer and Apoptosis Cytokines & Inflammation Development & Stem Cells Apoptosis Inflammatory Cytokines Stem Cells Cell Cycle Th17 for Inflammation (NEW!) Wnt Signaling Human mirna Array (NEW!) Common Cytokines Notch Signaling Breast Cancer & Estrogen Receptor Chemokines TGF / BMP Signaling Tumor Metastasis NF- B Signaling Pathway Endothelial Cell Biology Cancer PathwayFinder Th1-Th2-Th3 Osteogenesis Angiogenesis TNF Ligands Growth Factors Cancer Drug Resistance Toll-like Receptors ECM & Adhesion Signal Transduction Toxicology & Drug Metabolism Neuroscience Signal Transduction PathwayFinder Drug Metabolism Neuroscience Ion Channels NFkB Signaling Drug Phase I Enzymes Neurotransmitter Receptors Jak / Stat Signaling Drug Transporters Neurotrophins & Receptors DNA Damage Signaling Oxidative Stress Neurogenesis and Neural Stem Cell Insulin Signaling Stress & Toxicity MAP Kinase Signaling Other Diseases Custom PCR Arrays camp / Calcium Signaling Atherosclerosis 96-Well Custom Arrays p53 Signaling Diabetes 384-Well Custom Arrays Complete PCR Array List 19
20 PCR Arrays Empower Your Pathway Analysis Experience the performance of PCR Arrays- Try them today! Promo Code: PT08PA7 20% Off on All PCR Arrays; Call to use the promo code. (Expires on 7/31/08, Valid only for the customers in the US and Canada ). Telephone: (M-F 9AM-6PM Eastern) Thousands of scientists have discovered the power of PCR Arrays. Join them on the road to success! 20
RT 2 Profiler PCR Array: Web-based data analysis tutorial
RT 2 Profiler PCR Array: Web-based data analysis tutorial.questions? Comments? or Suggestions?.Ask now or contact Technical Support.M F, 9 AM 6 PM EST..Telephone: 888-503-3187;.Email: support@sabiosciences.com.international
More informationExProfile TM Gene qpcr Arrays
ExProfile TM Gene s For high-throughput profiling of coding-gene expression User Manual GeneCopoeia, Inc. 9620 Medical Center Drive, #101 Rockville, MD 20850 USA 301-762-0888 866-360-9531 support@genecopoeia.com
More informationRT 2 Easy First Strand Handbook
March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationA systematic guideline for developing the best real-time PCR primers
Scientific article Lessons learned from designing assays for more than 14, genes George Quellhorst and Sam Rulli QIAGEN, 6951 Executive Way, Frederick, Maryland 213, USA Abstract: Primer design is the
More informationPathway-focused gene expression profiling with qrt-pcr
Scientific article Emi Arikawa, George Quellhorst, Ying Han, Hongguang Pan, and Jingping Yang QIAGEN, 6951 Executive Way, Frederick, Maryland 2173, USA Abstract: This paper evaluates the performance of
More informationPrecision MULTIPLEX qpcr Master Mix. Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR
Precision MULTIPLEX qpcr Master Mix Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents
More informationThe StellARray qpcr Array System: Integrated Solution for Expression Profiling
The StellARray qpcr Array System: Integrated Solution for Expression Profiling Go to www.array.lonza.com/stellarrays Bioinformatics tool for gene selection Go to www.array.lonza.com/genesieve Collection
More informationRT 2 Profiler PCR Array System
User Manual RT 2 Profiler PCR Array System Pathway-Focused Gene Expression Profiling Using Real-Time PCR See Purchaser Notification for limited use license and warranty information (page 3). Part #1022A
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationPrecision FAST qpcr Master Mix. Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR
Precision FAST qpcr Master Mix Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents and Equipment
More informationD E. QPCR Optimization & Troubleshooting Guide
D C C QPCR Optimization & roubleshooting Guide Introduction Whether you are beginning to develop a QPCR assay, have a QPCR assay you want to optimize, or are getting questionable results and don t know
More informationSYBR Real-Time PCR Kit
SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationExceed the limit. SensiFAST Real-Time PCR Family. Superior Sensitive Quantification
Exceed the limit SensiFAST Real-Time PCR Family Superior Sensitive Quantification SensiFAST Real-Time PCR Kits Fast - optimized for fast cycling conditions (under 30 minutes), ideal for high-throughput
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationqbiomarker PCR Array Handbook
March 2011 qbiomarker PCR Array Handbook qbiomarker Screening PCR Array qbiomarker Validation PCR Array For induced pluripotent stem cell screening, validation, and differentiation Sample & Assay Technologies
More informationPrecision PLUS OneStep qrt-pcr Master Mix. Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR
Precision PLUS OneStep qrt-pcr Master Mix Instructions for use of Primerdesign Precision PLUS OneStep Master Mix for real-time RT-PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationQuantiTect Primer Assay Handbook
July 2011 QuantiTect Primer Assay Handbook For genomewide, ready-to-use real-time RT-PCR assays using SYBR Green detection Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
More informationSYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
More informationSame TaqMan Assay quality, new format
Product Bulletin TaqMan Array Plates TaqMan Array Plates TaqMan Gene Expression Assays delivered in ready-to-use 96-well Custom Array Plates or predefined Gene Signature Plates Flexible choose from customizable
More informationAmoyDx JAK2 Mutation Detection Kit
AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instruction for Use For Research Use Only Instruction Version: B2.6 Revision Date: October 2013 Store at -20±5 Xiamen,
More informationRT 2 Profiler PCR Array Handbook
December 2014 RT 2 Profiler PCR Array Handbook RT 2 Profiler PCR Array RT 2 First Strand Kit RT 2 SYBR Green qpcr Mastermix RT 2 SYBR Green Fluor qpcr Mastermix RT 2 SYBR Green ROX qpcr Mastermix RT 2
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationPCR Array FAQ s. PCR Arrays: Placing an order
PCR Array FAQ s PCR Arrays: Placing an order What PCR Array services does the facility provide? The DNA Analysis Facility provides support for gene expression studies using PCR Array technology from a
More informationKAPA PROBE FAST qpcr Master Mix (2X) Kit
KR0397_S v1.17 Product Description s are designed for fast-cycling, real-time PCR (qpcr) using sequence-specific fluorogenic probes. These kits are compatible with all fluorogenic probe-based technologies,
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationStratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationQuant-X One-Step qrt-pcr TB Green Kit User Manual
Takara Bio USA Quant-X One-Step qrt-pcr TB Green Kit User Manual Cat. No. 638317 PT5058-1 (022818) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United
More informationReliable and sensitive RT-qPCR analysis of whole-blood RNA samples
APPLICATION NOTE SuperScript IV Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples Introduction Most commercially available reverse transcription products do not perform well with difficult
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationGene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
More informationBioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR
BioBank cdna kit Instructions for the use of BioBank control cdna in real-time PCR Contents Introduction 3 Kit contents 4 Reagents and equipment to be supplied by user 4 Kit storage and stability 4 Primerdesign
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationTQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationSOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
More informationSus scrofa Pig Speciation Kit
Techne qpcr test Sus scrofa Speciation Kit 100 tests For general laboratory and research use only 1 2 Kit Contents specific primer/probe mix (BROWN) FAM labelled positive control template (RED) Internal
More informationExProfile TM Gene qpcr Arrays
ExProfile TM s For high-throughput profiling of coding-gene expression User Manual GeneCopoeia, Inc. 9620 Medical Center Drive, #101 Rockville, MD 20850 USA 301-762-0888 866-360-9531 support@genecopoeia.com
More informationPerfect Real Time PCR Products Guide
Perfect Real Time PCR Products Guide Choose the best Real Time PCR solution for your application! DNA & RNA template preparation One Step and Two Step Real Time RT-PCR Real Time PCR Premixes PrimerArray
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationPrimerdesign Ltd. High risk Human Papillomavirus. Multiplex screening kit. genesig kit. 100 tests. For general laboratory and research use only
Primerdesign Ltd High risk Human Papillomavirus Multiplex screening kit genesig kit 100 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus Papillomaviruses are a
More informationSupplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application
Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_173959.4 CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationStratagene QPCR Human Reference Total RNA
Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationRT 2 RNA QC PCR Array Handbook
December 2012 RT 2 RNA QC PCR Array Handbook For quality control analysis prior to gene expression profiling using real-time RT-PCR Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN
More informationMir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationM. tuberculosis_mpb64/is611. genesig Advanced Kit. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd M. tuberculosis_mpb64/is611 0 genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to M.tuberculosis_MPB64/IS6110 2 Specificity MAX MIN The Primerdesign
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationViral Hemorrhagic Septicemia Virus
Techne qpcr test Viral Hemorrhagic Septicemia Virus Non-coding region 150 tests For general laboratory and research use only 1 Introduction to Viral Hemorrhagic Septicemia Virus Viral Hemorrhagic Septicaemia
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationBrilliant II SYBR Green QPCR Master Mix
Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationSus scrofa Pig genesig Advanced Speciation Kit
TM Primerdesign Ltd Pig genesig Advanced Speciation Kit 100 tests For general laboratory and research use only 1 Principles of the test Real-time PCR This kit provides a method for detecting mitochondrial
More informationThe Pathways to Understanding Diseases
FOR PHARMA & LIFE SCIENCES White paper The Pathways to Understanding Diseases Deciphering complex biological processes Executive Summary Understanding complex biological processes is critical whether doing
More informationHuman Papillomavirus 16
TM Primerdesign Ltd Human Papillomavirus 16 E6 gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus 16 Papillomaviruses are a diverse
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationAmoyDx JAK2 Mutation Detection Kit
AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use For Research Use Only and For Reference Only Instructions Version: B1.2 Date of Revision: June 2016
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationLightCycler EvoScript RNA Masters Datasheet
LightCycler EvoScript RNA Masters Datasheet Witness the evolution of one-step RT-qPCR Extracting reliable answers from RNA can be a challenge. When samples are poor and copy numbers are low, rely on the
More informationSus scrofa Pig genesig Speciation Kit
TM Primerdesign Ltd Sus scrofa genesig Speciation Kit 100 tests For general laboratory and research use only 1 Principles of the test Real-time PCR This kit provides a method for detecting Sus scrofa mitochondrial
More informationBacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationSYBR Advantage qpcr Premix User Manual
SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General
More informationAmoyDx TM JAK2 V617F Mutation Detection Kit
AmoyDx TM JAK2 V617F Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use Instructions Version: B1.0 Date of Revision: July 2012 Store at -20±2 o C -1/5- Background
More informationLightCycler 480 qpcr Tools. Meeting the Challenge of Your Research
LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing
More informationUser Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR
User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationHepatitis A Virus. genesig Standard Kit 5 NCR. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Hepatitis A Virus 5 NCR genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Hepatitis A Virus Hepatitis virus (HAV) is a non-enveloped ssrna
More informationAnas platyrhynchos Duck. Advanced Speciation Kit. 100 tests. For general laboratory and research use only
Anas platyrhynchos Duck Advanced Speciation Kit 100 tests For general laboratory and research use only Carry over contamination between PCR reactions can be prevented by including uracil-nglycosylase
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationDengue Virus subtypes 1, 2, 3 and 4 (Multiplex kit)
Primerdesign TM Ltd Dengue Virus subtypes 1, 2, 3 and 4 (Multiplex kit) genesig advanced kit 100 tests For general laboratory and research use only 1 Contents Introduction to Dengue Virus 3 Specificity
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationEpstein Barr Virus (Human Herpes virus 4)
TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to
More informationHuman Papillomavirus 52 and 52b
Techne qpcr test Human Papillomavirus 52 and 52b E6 gene 150 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus 52 and 52b Papillomaviruses are a diverse group of
More informationQuantiTect Multiplex PCR Handbook
Second Edition December May 2005 2011 QuantiTect Multiplex PCR Handbook QuantiTect Multiplex PCR Kit with master mix containing ROX passive reference dye QuantiTect Multiplex PCR NoROX Kit with master
More informationPrimePCR Assays, Panels, and Controls for Real-Time PCR. Instruction Manual
PrimePCR Assays, Panels, and Controls for Real-Time PCR Instruction Manual Bio-Rad Technical Support For help and technical advice, please contact the Bio-Rad Technical Support department. In the United
More informationFastFire qpcr PreMix (Probe)
FastFire qpcr PreMix (Probe) For fast, quantitative, specific real-time PCR using sequence-specific probe www.tiangen.com/en FP130820 Kit Contents FastFire qpcr PreMix (Probe) Contents 2 FastFire qpcr
More informationHuman T-lymphotropic Virus 1
TM Primerdesign Ltd Human T-lymphotropic Virus 1 Polymerase gene (POL) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human T-lymphotropic Virus 1 Human T-lymphotropic
More informationModeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis
icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,
More informationBrilliant SYBR Green QPCR Master Mix
Brilliant SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600548 (single kit) #929548 (10-pack kit) Revision B.01 For In Vitro Use Only 600548-12 LIMITED PRODUCT WARRANTY This warranty limits our
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
More informationAll-in-One TM mirna qrt-pcr Detection Kit
mirna qrt-pcr Detection Kit For quantitative detection of mature mirna Cat. No. QP015 (20 RT and 200 qpcr reactions) Cat. No. QP016 (60 RT and 600 qpcr reactions) Used in combination with the All-in-One
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationBioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna
BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign
More informationProtein/Cytokine Array Services
Protein/Cytokine Array Services at the Analytical Instrumentation Core Boston University, AIC, DOM, BMC, BUMC 2015 Analytical Instrumentation Core Mission: The AIC supports investigators through both cutting-edge
More informationMycobacterium Tuberculosis
TM Primerdesign Ltd Mycobacterium Tuberculosis rep13e12 genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis
More informationDengue Virus subtypes 1,2 3 and 4
TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Dengue Virus subtypes 1,2
More informationAntibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene. genesig Advanced Kit. 150 tests.
TM Primerdesign Ltd Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Antibiotic
More informationHuman Herpes Virus 1 (Herpes simplex type 1)
TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human
More informationFoot & Mouth Disease Virus
TM Primerdesign Ltd Foot & Mouth Disease Virus 5' untranslated region (5'UTR) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Foot & Mouth Disease Virus Foot-and-mouth
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More information