Exam 2 BIO200, Winter 2012

Size: px
Start display at page:

Download "Exam 2 BIO200, Winter 2012"

Transcription

1 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide backwards? A. The G base has been rotated along its bond to the ribose sugar. B. It s joined in a 5 to 5 linkage. C. The G base is methylated. D. It is synthesized by Reverse Transcriptase. E. The 5 cap covalently connects the front of the mrna to the back of the mrna. 2. The ORC complex associates with a(n) A. poly A tail. B. origin of replication. C. telomere. D. start codon. E. lariat structure. 3. Holliday junctions are associated with A. replication forks and replication bubbles. B. proofreading. C. the proteosome. D. homologous recombination. E. splicing. 4. HATs catalyze the of proteins. A. acetylation histone B. ubiquitination specific transcription factors C. phosphorylation general transcription factors D. phosphorylation specific transcription factors E. glycosylation glycoproteins. 5. The Exon Shuffling Model provides one explanation to why A. human cells encode a larger number of proteins than gene. B. a 5 to 2 connection is formed at the branchpoint A. C. mrnas must be fully spliced before being exported from the nucleus. D. eukaryotic gemes contain introns. E. snrnps can catalyze alternative patterns of splicing. February 15, 2012 page 1 of 7 Version A

2 6. To be used for an IF experiment, a secondary antibody has been modified by covalently attaching a(n) A. epitope. B. blocking reagent. C. enzyme. D. fixing reagent. E. fluorescent molecule. 7. Suppose that we hypothesize that the activity of the Hap2 transcription factor is controlled by whether or t the gene is transcribed. Which experiment would we carry out to evaluate this hypothesis? A. PCR B. Western blot C. IF D. Northern blot E. Southern blot 8. Which proteins help hold other proteins in a semi-denatured state before they are imported to the mitochondria? A. Guide Proteins B. Escorts C. Importins D. Chaperones E. Remodelers 9. An Initiator (Inr) is required for which process? A. Export of mrna from the nucleus B. Replication C. Recombination D. 5 capping E. Transcription by RNA polymerase II 10. Telomerase differs from DNA polymerase because it A. uses NTPs instead of dntps. B. does t require a template. C. does t require a primer. D. reverse transcribes its template. E. can add nucleotides to a 5 end. February 15, 2012 page 2 of 7 Version A

3 11. The charging reaction covalent connects a trna with its matching ami acid. 11A. What class of enzymes catalyze the charging reaction? (2 points) 11B. Draw the product of this reaction, showing the structure of an ami acid connected to the last nucleotide of a trna. Use R for the side chain of the ami acid and B for the base on the nucleotide. The structure of a nucleotide is shown on the right for your assistance. (3 points) 11C. If the ami acid is histidine (his), what will be the sequence of the anticodon? (2 points) 12. Three of the four anticodons listed below exist in a human trna. Circle the one that does t exist and explain why it doesn t exist. (4 points) AUG GUA UAG UAU Wobble Rules Anticodon Base Codon Base C G A U U A or G G C or U I U, C or A February 15, 2012 page 3 of 7 Version A

4 13. One strand of the extremely tiny gene Liliputian is shown below, with its start and stop codons underlined. 5 -TGAGGCATCATCGGTATGGCACCCTTAATGGGCATTGCACCCATAGTACGATAAGCATGTCCTGAAACTAGT-3 13A. Is this the template or the ntemplate strand? (1 point; circle one) 13B. I want to use PCR to make a copy of the entire Liliputian gene, so I synthesize two short primers whose sequences are 5 -ATGGCACC-3 and 5 -TACGATAA-3. After running my PCR reaction in the thermocycler, what technique would I use to find out if I had successfully synthesized DNA? (2 points) 13C. The technique in 13B shows that my PCR reaction failed and one of my students pointed out politely that one of my primers is the problem. Re-design one of the primers with a new sequence of seven nucleotides so that the PCR experiment will w work. (3 points) 14. My friend GFP-tagged the ami-terminus of Citrate Synthase (which is part of the TCA Cycle and therefore should be in the mitochondrial matrix). When he viewed his cells by fluorescent microscopy, he was shocked to see that the GFP-Citrate Synthase was cytosolic! In hindsight, he should t have been shocked at all. Please explain why the fusion protein is in the cytosol. (4 points) 15. By scanning the sequence of the geme, we can discover some interesting information about uncharacterized genes. For example, if four different genes on four different chromosomes have the same enhancer sequences located nearby, what can we hypothesize about those four genes? (2 points) February 15, 2012 page 4 of 7 Version A

5 16A. In a microarray experiment, the microarray or gene chip itself consists of several thousand spots precisely placed on a glass slide. What is actually placed on each one of those spots? How do the spots differ from one ather? (3 points) 16B. Which of the following questions would we use a microarray to address? Circle for each question that would reasonably be answered using a microarray experiment. (½ point each) How does infection with the influenza virus affect the abundance of the Ras protein in human cells? How does infection with the influenza virus affect which origins of replication are used in human cells? Which genes are repressed in human cells that have been infected with the influenza virus? How does the structure of human chromatin change when cells are infected with the influenza virus? 16C. For one question that in 16B that can be answered with a microarray experiment, describe the biological samples that you ll need to collect and how they need to be treated before being placed on the microarray. (5 points) 17. A diagram of the primary sequence of the Gpr1 protein is shown below with several sequences highlighted. After translation, draw the structure of the mature protein on the rough ER membrane, labeling all domains. (3 points) N- A B C D -C Start Transfer Stop Transfer Start Transfer Cytosol Lumen February 15, 2012 page 5 of 7 Version A

6 18. Lagging strand synthesis can be thought of as a metabolic pathway, where the product of one enzyme is a substrate for the next enzyme. Supply the names of the four key enzymes in the lagging strand synthesis pathway shown below. (8 points) dsdna ssdna RNA Okazaki fragment Completed Lagging Strand 18B. The second and third enzymes in this pathway also require additional substrates to make their products. List those additional substrates on the pathway above. (2 points) 19. For each statement below, indicate the one type of sequence that is being described. (1 point each) This sequence is bound by the protein Importin. This sequence is NOT located at a protein s N- terminus. This sequence is an amphipathic -helix. This sequence is bound by the SRP complex of proteins. This sequence is NOT removed in the correctly localized protein. The translation of this protein leads to a temporary pausing by the ribosome. Targeting Targeting Targeting Targeting Targeting Targeting 20. Does each of the statements below accurately describe a rthern blot, a southern blot or a western blot? Circle all that apply. (2 points each) Could reveal the presence of a post-translational modification. Northern Blot Southern Blot Western Blot The probe may be synthesized by PCR. Northern Blot Southern Blot Western Blot Requires a blocking step. Northern Blot Southern Blot Western Blot Requires the addition of SDS during electrophoresis. Northern Blot Southern Blot Western Blot Could be used to determine the size of a gene. Northern Blot Southern Blot Western Blot Is sometimes referred to as an immublot. Northern Blot Southern Blot Western Blot February 15, 2012 page 6 of 7 Version A

7 21. Two different DNA repair pathways are shown here. In the boxes below, name each pathway. (2 points each; standard abbreviations are acceptable). 22. Name the protein or protein complex described by each statement. (2 points each) This protein is responsible for proofreading. This enzyme connects ATP nucleotides together without a template. TBP is the core protein in this complex. This protein helps escort a charged trna into the ribosome s A site. This protein increases the processivity of DNA polymerases, leading to longer DNA molecules. This linker histone is located between nucleosomes. February 15, 2012 page 7 of 7 Version A

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

5 -GAC-3 5 -GTC-3 5 -CAG Which of these are NOT important for RNA Polymerase interacting with DNA?

5 -GAC-3 5 -GTC-3 5 -CAG Which of these are NOT important for RNA Polymerase interacting with DNA? Name This exam is schedule for 75 minutes and I anticipate it to take the full time allotted. You are free to leave if you finish. The exam is split into two sections. Part 1 is multiple choice select

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

AP2013-DNAPacket-II. Use the list of choices below for the following questions:

AP2013-DNAPacket-II. Use the list of choices below for the following questions: Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.

More information

Biology Lecture 2 Genes

Biology Lecture 2 Genes Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

2012 GENERAL [5 points]

2012 GENERAL [5 points] GENERAL [5 points] 2012 Mark all processes that are part of the 'standard dogma of molecular' [ ] DNA replication [ ] transcription [ ] translation [ ] reverse transposition [ ] DNA restriction [ ] DNA

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Information Readout: Transcription and Post-transcriptional Processing Translation

Information Readout: Transcription and Post-transcriptional Processing Translation Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Chapter 4: How Cells Work

Chapter 4: How Cells Work Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

STRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA

STRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA STRUCTURE AND DIAGNOSTIC APPLICATIONS OF DNA UNIVERSITY OF PAPUAN NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY LECTURE

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

Fig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm

Fig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many

More information

C. Incorrect! Threonine is an amino acid, not a nucleotide base.

C. Incorrect! Threonine is an amino acid, not a nucleotide base. MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

DNA, RNA, protein synthesis. Sections , , and

DNA, RNA, protein synthesis. Sections , , and DNA, RNA, protein synthesis Sections 14.1 14.5, 15.1 15.5, and 16.4 16.6 05-09-16 Today s class Extra-credit essay Activity on mitosis, meiosis, and inheritance Lecture and activities on the lecture Extra-credit

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

DNA Replication AP Biology

DNA Replication AP Biology DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.

More information

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a true nucleus. Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic

More information

TRANSCRIPTION AND TRANSLATION

TRANSCRIPTION AND TRANSLATION TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

1. Mitosis = growth, repair, asexual reproduc4on

1. Mitosis = growth, repair, asexual reproduc4on Places Muta4ons get passed on: Cell Reproduc4on: 2 types of cell reproduc4on: 1. Mitosis = growth, repair, asexual reproduc4on Photocopy machine Growth/Repair Passed on in the same body 2. Meiosis = sexual

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.

DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand. DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e. 1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.

More information

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Discuss the ethical considerations that must be taken into account when using embryonic stem cells for research.

Discuss the ethical considerations that must be taken into account when using embryonic stem cells for research. Revised Higher Human Biology Unit 1 Revision Summary STEM CELLS, DIFFERENTATION & CANCER CELLS Stem cells are undifferentiated biological cells, that can differentiate into specialized cells and can divide

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

PUC Vikasana Program- 2012

PUC Vikasana Program- 2012 Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

Higher Human Biology. Unit 1: Human Cells

Higher Human Biology. Unit 1: Human Cells Calderglen High School Higher Human Biology Unit 1: Human Cells Homework Questions Contents Page Sub-Topic 1: Differentiation and stem cells 3-5 Sub-Topic 2: DNA and its replication 6-10 Sub-Topic 3: RNA,

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016 Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red

More information