Two aspects of the regulation of gene expression : transcription and mrna polyadenylation
|
|
- Wilfred Shields
- 6 years ago
- Views:
Transcription
1 Two aspects of the regulation of gene expression : transcription and mrna polyadenylation Laboratoire de Génétique moléculaire de la Neurotransmission, Paris Director : Pr. Mallet Division of Molecular Neurobiology, University of Tokyo Director : Pr. Mikoshiba Supervisor : Pr. Mizutani Hélène Kiefer Shimizu Higashi High School November 28,
2 2
3 3
4 University High school 3-10 years 3 years Mathematics Mathematics Sciences Sciences Medical studies Law studies Economy Economy Foreign languages Litterature History Litterature, etc 4
5 5
6 Agricultural science and technology university (5 years) Production, improvement and transformation of agricultural products Biology Economy European rules for agriculture and environment Company Research PhD 6
7 Why did I choose to do a PhD rather than to work in a company? Aim of research = to better understand the world, in order to improve the quality of life Research is exciting (for me) and may be usefull (for our children or grandchildren!) Good balance between manual and intellectual work, at least in experimental sciences Less money but more independency 7
8 Why am I interested in studying the regulation of gene expression? 8
9 We all come from one cell... that will give an organism after many division and differentiation steps 9
10 All the cells in our body contain the same genetic information... But they have different appearance and function 10
11 How is this diversity possible? B A Same genetic information but different environment B A Gene expression A B A Different proteins different functions B B A 11
12 What is gene expression? Dinner Let s take an example... 12
13 What is gene expression? Books = information Dinner Selection of one book Cooking Copy of the book Library Kitchen 13
14 What is gene expression? Genes = information Proteins Selection of one gene Protein synthesis Copy of the gene = messenger RNA (mrna) Nucleus Cytoplasm 14
15 What is gene expression? Genes = information Original paper = DNA sequence Amino acids Proteins Selection of one gene Protein synthesis Copy of the gene = messenger RNA (mrna) Copy paper = RNA sequence Nucleus Cytoplasm 15
16 What is gene expression? DNA sequence = INFORMATION Protein synthesis = FUNCTION Genes TRANSCRIPTION TRANSLATION mrna Nucleus Cytoplasm 16
17 Why do two cells in a different environment have a different gene expression pattern? B A Same genetic information but different environment B A Gene expression A B A Different proteins different functions B B A 17
18 Because extracellular environment contains signals that regulate gene expression 1 Modification of the environment 2 Signal transmission 3 Gene expression regulation 4 Answer : division, death or differentiation
19 Because environment changes, the regulation of gene expression is : Time-dependent : Steps of the development (regulation of cell cycle, differentiation) Physiological state of the cell (stimulus) Space-dependent Different cell types in the organism Deregulation of gene expression leads to pathology (ex : cancer, neurodegenerative disease...) 19
20 Regulation of transcription by transcription factors 20
21 What is gene expression? DNA sequence = INFORMATION Protein synthesis = FUNCTION Genes TRANSCRIPTION TRANSLATION mrna Nucleus Cytoplasm 21
22 Transcription requires many DNA sequences and proteins DNA Regulatory sequences Gene Proteins Transcription factors Transcription machinery 22
23 Transcription requires many DNA sequences and proteins Regulatory sequences Gene Transcription factors Transcription machinery 23
24 Transcription requires many DNA sequences and proteins Regulatory sequences Gene TRANSCRIPTION TRANSCRIPTION FACTORS HELP OR PREVENT TRANSCRIPTION MACHINERY TO INITIATE TRANSCRIPTION Transcription factors Transcription machinery 24
25 The combination of regulatory sequences is unique for one gene during all the life B B A A 25
26 The combination of transcription factors is unique for one cell at one time point + B A + B A 26
27 Regulation of transcription is due to specific interactions between transcription factors and regulatory sequences B A Same genetic information but different environment B A Gene expression A + B A Different proteins Different functions B + B A 27
28 Isolate new transcription factors and determine in which cells they are = one step to understand that phenomenon 28
29 One transcription factor is caracterized by : +/- 1 1 Its effect on transcription 2 2 Its affinity for one specific regulatory sequence CAGGTG These properties can be used to isolate novel transcription factors 29
30 Aim of my PhD work : isolate novel transcription factors involved in the development of the nervous system CAGGTG = a regulatory sequence important for the development of the nervous system Search for all the transcription factors able to bind to this regulatory sequence in the brain Strategy = one-hybrid screening in the yeast Identification of ZENON, a novel transcription factor 30
31 One-hybrid screening in yeast His- mutant his3 his- medium 31
32 One-hybrid screening in yeast Gal4 ADNc his3 his- medium 32
33 One-hybrid screening in yeast Gal4 ADNc his3 his- medium 33
34 ZENON expression is restricted to old neurons in the nervous system Function in protection? 34
35 ZENON = Zinc finger protein Expressed in NeurONs ZENON? 35
36 Why a post-doc? 36
37 Research is international Available data Publications by the scientific community Hypothesis Experiment Result Report 37
38 Research is expensive Available data Publications by the scientific community Hypothesis Experiment Money!!! Public and private sources Result Report 38
39 And competition is high! Available data Publications by the scientific community Hypothesis Competition Experiment Money!!! Public and private sources Result Report 39
40 So we have to work hard and accumulate many papers! PhD (3-5 years) Not enough papers Post-doc 2 years or more Enough papers More stable position Money for experiments Etc 40
41 It is nice to go abroad for a post-doc Personal reasons : good opportunity to live in a foreign country Learn a new language Discover a strong and original culture Career reasons : Research is international, so it is nice to have an international experience English Financial reasons : easier to find money to go abroad than to stay at home. Thank you to JSPS! 41
42 But of course There are many excellent researchers that did not go abroad for a post-doc Going abroad is not a guarantee to have a better situation after coming back in the home country So it is better to go abroad not only for career! 42
43 Regulation of protein synthesis by cytoplasmic mrna polyadenylation 43
44 What is gene expression? DNA sequence = INFORMATION Protein synthesis = FUNCTION Genes TRANSCRIPTION TRANSLATION mrna Nucleus Cytoplasm 44
45 Sometimes extracellular signals directly regulate translation Stimulus (ex : progesterone) Quicker In some situations, regulation of transcription is not possible 45
46 Cytoplasmic mrna polyadenylation Polyadenylation = add a lot of adenine (A) at the end of mrna Necessary for stability and translation of mrna Occurs in the nucleus of all cells and sometimes also observed in the cytoplasm regulation of translation Nucleus Cytoplasm mrna PA (A) (A) 250 (A) 250 Translation Stimulus PA DA PA mrna (A) (A) 250 (A) 250 (A) (A) 250 Storage Translation 46
47 Meiotic maturation of Xenopus laevis oocytes : a model to study cytoplasmic mrna polyadenylation Model = Simple system A lot of information available Transposition to more complicated systems 47
48 Meiotic maturation of Xenopus laevis oocytes : a model to study cytoplasmic mrna polyadenylation Immature oocytes 1 mm Lay-out Fertilization 1 mm Mature oocytes Very small cells 48
49 Meiotic maturation of Xenopus laevis oocytes is cytoplasmic polyadenylation-dependent * * Trancription and storage of mrna Polyadenylation and translation of stored mrna 49
50 Meiotic maturation of Xenopus laevis oocytes : a model to study cytoplasmic mrna polyadenylation Meiotic maturation is cytoplasmic polyadenylation-dependent Meiotic maturation can occur in vitro (progesterone addition in the culture medium) Meiotic maturation is very easy to detect Frog oocytes are very big and easy to manipulate 50
51 Isolation of Xenopus laevis oocytes by surgery (I) Anesthesy of a Xenopus laevis female 51
52 Isolation of Xenopus laevis oocytes by surgery (II) A piece of ovary is pulled out 52
53 Isolation of Xenopus laevis oocytes by surgery (III) Culture of the oocytes 53
54 Isolation of Xenopus laevis oocytes by surgery (IV) Rescue of the frog 54
55 Isolation of Xenopus laevis oocytes by surgery (V) 6 weeks after the frog can be re-used! 55
56 Aim of my post-doc work in Japan : to determine if IRBIT regulates mrna polyadenylation or not IRBIT = a novel protein Potential function in the regulation of mrna polyadenylation IRBIT protein IRBIT antisense Over-expression Down-expression? 1 mm 1 mm 56
57 Over-expression and down-expression by injection 57
58 Conclusion : I am very happy to be in Japan! Powerfull and high-tech research, systematic approach For the moment, amount of money devoted to research is too limited Good synergy inside a team French are very individualistic poeple Data is more important than theory Theory is more important than data 58
59 59
60 60
61 61
62 62
63 63
64 64
65 65
66 66
67 67
68 68
69 69
70 70
71 71
72 72
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationCh 10.4 Protein Synthesis
Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationClick here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationDevelopmental Biology BY1101 P. Murphy
Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationProtein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives
Lab Exercise Protein Synthesis Contents Objectives 1 Introduction 1 Activity.1 Overview of Process 2 Activity.2 Transcription 2 Activity.3 Translation 3 Resutls Section 4 Introduction Having information
More informationTRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationMolecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationSynthesis. In your composition book, draw and fill out this table, be sure to include today s date (1/22/18): Definition (you write this)
In your composition book, draw and fill out this table, be sure to include today s date (1/22/18): Synthesis The word in another language Definition (you write this) Root of the word: Ancient Greek synthesis
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationStudent Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationMOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS
03-442 Lectures: MWF 9:30-10:20 a.m. Doherty Hall 2105 03-742 Advanced Discussion Section: Time and place to be announced Probably Mon 4-6 p.m. or 6-8p.m.? Once we establish who is taking the advanced
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationGene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
More informationO C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
More informationStandards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes.
Delicious DNA: Transcription and Translation Simulation Using an Edible Model Authors: Darcy Holoweski and Catherine Quist Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation,
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationChapter 15 DNA and RNA
Chapter 15 DNA and RNA www.mrcbiology.com 1 Variation Variation means that individuals in a species have different characteristics to one another. Acquired Variation are not inherited. e.g learnt during
More informationDNA: The Molecule of Heredity
DNA: The Molecule of Heredity STRUCTURE AND FUNCTION - a nucleic acid o C, H, O, N, P o Made of nucleotides = smaller subunits o Components of nucleotides: Deoxyribose (simple sugar) Phosphate group Nitrogen
More information7.22 Example Problems for Exam 1 The exam will be of this format. It will consist of 2-3 sets scenarios.
Massachusetts Institute of Technology Department of Biology 7.22, Fall 2005 - Developmental Biology Instructors: Professor Hazel Sive, Professor Martha Constantine-Paton 1 of 10 7.22 Fall 2005 sample exam
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More information1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).
1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil
More informationTemperature sensitive gene expression: Two rules.
32 Research Notes Dros. Inf. Serv. 92 (2009) Temperature sensitive gene expression: Two rules. Gupta, Anand P. Johnson C. Smith University, Department of Science and Mathematics, 100 Beatties Ford Road,
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationTranscription and Translation
Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationCHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
More informationRNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
More informationCharles Shuler, Ph.D. University of Southern California Los Angeles, California Approved for Public Release; Distribution Unlimited
AD Award Number: DAMD17-01-1-0100 TITLE: Smad-Mediated Signaling During Prostate Growth and Development PRINCIPAL INVESTIGATOR: Charles Shuler, Ph.D. CONTRACTING ORGANIZATION: University of Southern California
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationIf Dna Has The Instructions For Building Proteins Why Is Mrna Needed
If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary
More informationWhat is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationRead and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationDNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
More informationBiochemistry. Central dogma. Structure and Function of Biomolecules II
. Paper : 03 Module : 07 Principal Investigator: Dr. Sunil Kumar Khare, Professor Dept. of Chemistry, I.I.T. Delhi Paper Coordinator: Content Writer: Dr. Sunil Kumar Khare and Prof. M. N. Gupta Dr. Sunil
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationHelps DNA put genetic code into action RNA Structure
13.1 RNA Helps DNA put genetic code into action RNA Structure Single Stranded Nucleotides building blocks to RNA Ribose (5C sugar) Phosphate Group Nitrogenous base: Adenine, Uracil Guanine, Cytosine Disposable
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationGENETICS and the DNA code NOTES
GENETICS and the DNA code NOTES BACKGROUND DNA is the hereditary material of most organisms. It is an organic compound made of two strands, twisted around one another to form a double helix. Each strand
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationThe common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
More informationComparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
More informationThe Nobel Prize in Chemistry 2006
I n f o r m a t i o n f o r t h e p u b l i c The Nobel Prize in Chemistry 2006 This year s Nobel Prize in Chemistry is awarded to Roger D. Kornberg for his fundamental studies concerning how the information
More informationEXECUTIVE SUMMARY GLOBAL GENOMICS AND BIOINFORMATICS RESEARCH INSTITUTE. May 24, 2017
EXECUTIVE SUMMARY GLOBAL GENOMICS AND BIOINFORMATICS RESEARCH INSTITUTE May 24, 2017 Introduction to the Institute Inova Health System Foundation ( Inova ), The Rector and Visitors of the University of
More informationPre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationDNA Structure and Protein synthesis
DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making
More informationEmbryonic development, epigenics and somatic cell nuclear transfer - The science and its social implications -
Embryonic development, epigenics and somatic cell nuclear transfer - The science and its social implications - Moshe Yaniv Unité d Expression Génétique et Maladies, Institut Pasteur, Paris, France September
More informationDNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationLecture 20: Drosophila melanogaster
Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3
More informationWhat is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed
RNA Section 3.1 What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed Used to direct the production of proteins that determines an organisms characteristics
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationEukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
More information