Development and Application of a Rapid, User-Friendly and Inexpensive. Method to Detect Dehalococcoides sp. Reductive Dehalogenase Genes from
|
|
|
- Aileen Tate
- 6 years ago
- Views:
Transcription
1 1 Supplementary Section 2 3 Applied Microbiology and Biotechnology Development and Application of a Rapid, User-Friendly and Inexpensive Method to Detect Dehalococcoides sp. Reductive Dehalogenase Genes from Groundwater Yogendra H. Kanitkar 1, Robert D. Stedtfeld 1, Paul B. Hatzinger 2, Syed A. Hashsham 1, 3, and Alison M. Cupples*, Department of Civil and Environmental Engineering, Michigan State University, East Lansing, Michigan, USA 2 CB&I Federal Services, 17 Princess Road, Lawrenceville, New Jersey 08648, USA 3 Center for Microbial Ecology, Michigan State University, East Lansing, Michigan, USA *Corresponding Author: Alison M. Cupples A135, 1449 Engineering Research Court, Michigan State University, East Lansing, MI 48824, cupplesa@egr.msu.edu Telephone: (517) Fax: (517) Page 1 of 9
2 Table S1. The gene targets, assay type and template type used for each well and site. Table S2. qpcr primer and probe sequences used for vcra, bvca and tcea in this study. Table S3. LAMP primers for vcra, bvca and tcea used in this study. Table S4. Gene concentrations (vcra and tcea per L) and estimated gene concentration in serial dilutions of cell templates from groundwater from six monitoring wells (Indian Head site). Table S5. Time based comparison of qpcr and SYBR green LAMP assays. Table S6. Cost based comparison of qpcr and SYBR green LAMP assays Figure S1. Examples of SYBR green LAMP assays for vcra with triplicates of X 10 dilutions of centrifuged cells from groundwater from the Indian Head site. The dilution levels increase to the right. Page 2 of 9
3 39 Site Table S1. The gene targets, assay type and template type used for each well and site. San Antonio, TX Well Name Date Templates Cells qpcr tcea LAMP tcea qpcr vcra LAMP vcra qpcr bvca LAMP bvca Direct cells tcea Direct cells vcra Direct cells bvca Centrifuged cells tcea Centrifuged cells vcra Centrifuged cells bvca 34 B1 03/03/15 D D D D ND X D D X D D X 35 B1 03/03/15 D D D D ND X D D X D D X 40 B1 04/13/15 ND ND D D ND X X D X X D X 113 B1 04/13/15 D D D D ND X D D X D D X 504 B1 12/1/15 ND ND D D ND X X D X X D X 513 B1 12/1/15 ND ND D D ND X X D X X D X 514 B1 12/1/15 D D D D ND X D ND X D D X 35 B2 08/06/16 X D X D ND X ND ND X D D X 113 B2 08/06/16 X D X D ND X ND ND X D D X 514 B2 08/06/16 X D X D ND X ND D X D D X Tulsa, OK MW1 06/11/15 D D D D ND X D D X D D X MW2 06/11/15 D D D D ND X D D X D D X MW3 06/11/15 D D D D ND X D D X D D X MW4 06/11/15 D D D D ND X ND ND X D ND X MW5 06/11/15 D D D D ND X ND D X D D X MW6 06/11/15 D D D D ND X D D X D D X MW7 06/11/15 D D D D ND X D D X D D X MW8 06/11/15 D D D D ND X D D X D D X MW9 06/11/15 D D D D ND X D D X D D X IW1 06/11/15 D D D D ND X D D X D D X IW2 06/11/15 D D D D ND X D D X D D X IW3 06/11/15 D D D D ND X D D X D D X IW4 06/11/15 D D D D ND X ND D X ND D X IW5 06/11/15 ND ND ND ND ND X X X X X X X IW6 06/11/15 D D D D ND X ND D X D D X W820 06/11/15 D D D D ND X D D X D D X Quantico, PMW1 B1 11/10/15 D D D D ND X ND ND X ND D X VA PMW3 B1 11/10/15 D D D D ND X ND ND X ND D X CW2 11/16/15 D D D D ND X ND ND X ND D X PMW2 11/16/15 D D D D ND X ND ND X ND ND X AW1 11/16/15 D D D D ND X ND ND X ND ND X MW 15R 11/16/15 D D D D ND X ND ND X ND ND X PMW4 11/16/15 D D D D ND X ND ND X ND ND X PMW1 B2 11/16/15 ND ND ND ND ND X ND ND X ND ND X CW7 11/16/15 ND ND D D ND X ND ND X ND D X PMW3 B2 11/16/15 ND ND ND ND ND X ND ND X ND ND X TW265 11/16/15 ND ND ND ND ND X ND ND X ND ND X Edison, /10/15 D D D D ND X ND D X ND D X Page 3 of 9
4 NJ 303S 11/10/15 D D D D ND X ND ND X ND D X Indian IW5 06/24/16 X D X D ND X X X X D D X Head, IW7 06/24/16 X D X D ND X X X X D D X MD MW38 06/24/16 X D X D ND X X X X D D X MW40 06/24/16 X D X D ND X X X X D D X MW41 06/24/16 X D X D ND X X X X D D X MW43 06/24/16 X D X D ND X X X X D D X D = template was detected ND = template was not detected B1 = Batch 1 = Assay was performed X = Assay was not performed B2 = Batch 2 Page 4 of 9
5 Table S2. qpcr primer and probe sequences used for vcra, bvca and tcea in this study. Target Primer Sequence Reference Gene vcra vcra1022f CGGGCGGATGCACTATTTT (Ritalahti vcra1093r GAATAGTCCGTGCCCTTCCTC (Ritalahti vcra1042probe FAM-CGCAGTAACTCAACCATTTCCT GGTAGTGG-TAMRA (Ritalahti bvca bvca925f AAAAGCACTTGGCTATCAAGGAC (Ritalahti bvca1017r CCAAAAGCACCACCAGGTC (Ritalahti bvca977probe FAM-TGGTGGCGACGTGGCTATGTGG- TAMRA (Ritalahti tcea tcea1270f ATCCAGATTATGACCCTGGTGAA (Aiello 2003; Johnson et al. 2005) tcea1336r GCGGCATATATTAGGGCATCTT (Aiello 2003; Johnson et al. 2005) tcea1294probe FAM-TGGGCTATGGCGACCGCAGG- TAMRA 23, 24 Table S3. LAMP primers for vcra, bvca and tcea used in this study. Target Gene vcra bvca tcea Primer set vcra set C bvca Set A tcea Set A Primer Sequence (5 3 ) Reference F3 GTAAGTTTTACGCGAGATGG (Kanitkar et B3 GTCATCGGCTGAGCTTTC al. 2016) FIP ACCCTCCCATTTTGGTACGCTTGTA TGGTCCGCCACAT BIP AAGACAATTTTCTAATGCTGAGGGC ATTTGGGATCTGCCAGGT LF CATCAGGTGGCGCTGAA LB TGGTGCTGGTGGCGTT F3 ACAATGCCTTTACCAGAAGA (Kanitkar et B3 ACCGTATTTGGGGCTGAT al. 2016) FIP TCGGCCTCCATTAAAAGCCATTCTC TAGGGTGGTCATGT BIP ATCAAGGACTTGGTGGCGACCTTGT TCGGAAAGACACTCA LF AGGCAATCATACTTGAAGCGTC LB TGTGGGGACCTGGTGGT F3 GCCGTTTATTCCATTCATGG (Kanitkar et B3 GCATAGACTGGATGAAGGAA al. 2016) Page 5 of 9
6 72 FIP BIP LF LB ACATAATTGCTGGGAGAACCCG- TCGCATAGAGAGATAAGGCC GCCATTCGTGGCGGCATATAT- CAGATTATGACCCTGGTGAA CTTTATGGACGCTATGAAGGTTCTA TCTTCCCTGCGGTCGCCATA Page 6 of 9
7 Table S4. Gene concentrations (vcra and tcea per L) and estimated gene concentration in serial dilutions of cell templates from groundwater from six monitoring wells (Indian Head site). Sample Replicate tcea gene copies/l vcra gene copies/l # No 10X 100X 1000X 10000X No 10X 100X 1000X 10000X IW X X10 6 ND ND ND 9.04 X X10 5 ND ND ND X X X10 5 ND ND 8.84 X X10 5 ND ND ND X X X10 5 ND ND 5.97 X10 6 ND ND ND ND IW X X X10 5 ND ND 7.77 X10 5 ND ND ND ND X X X10 5 ND ND 9.56 X10 5 ND ND ND ND X X X10 5 ND ND 9.04 X10 5 ND ND ND ND MW X10 6 ND ND ND ND 1.10 X X10 6 ND ND ND X X10 5 ND ND ND 5.78 X X10 5 ND ND ND X X10 5 ND ND ND 3.99 X X10 5 ND ND ND MW X X X10 4 ND ND 2.41 X X10 6 ND ND ND X X X10 5 ND ND 1.38 X X X10 5 ND ND X X10 5 ND ND ND 1.02 X X X10 5 ND ND MW X X X X10 5 ND 6.22 X X X10 5 ND ND X X X X10 5 ND 5.34 X X X10 5 ND ND X X X X10 5 ND 4.13 X X X10 5 ND ND MW X10 5 ND ND ND ND 2.68 X X10 5 ND ND ND X10 5 ND ND ND ND 2.30 X X10 5 ND ND ND X10 5 ND ND ND ND 1.77 X X10 5 ND ND ND ND = template Page 7 of 9
8 84 Table S5. Time based comparison of qpcr and SYBR green LAMP assays Process qpcr SYBR Green LAMP Filtering 5-25 min. per sample 5-25 min. per sample extraction min per sample No extraction Centrifugation and No centrifugation or <15 min per sample template elution sample elution Master Mix Preparation <5 min. if commercial min. Master mix is used. Analysis min <1.5 hr. (1 hr. in the water bath and <0.5 hr. for adding SYBR green a ) Total min min a Value based on a 96 well plate. The value is significantly lower if fewer samples are processed (1 hour in the water bath and < 5 min for adding the SYBR green) Table S6. Cost based comparison of qpcr and SYBR green LAMP assays Process qpcr (20µL reaction) SYBR Green LAMP (50 µl reaction) extraction $ 9.30 per sample a No cost Consumables + reagents $ per sample $ per sample Instrument costs ~$ 20,000 ~$395 (water bath) ~$300 (centrifuge) a MO BIO PowerWater Isolation Kit ($465 for 50 preps) Page 8 of 9
9 Replicate 1: X10 dilution series Replicate 2: X10 dilution series Replicate 3: X10 dilution series Controls MW40 vcra LAMP assay MW41 vcra LAMP assay Figure S1. Examples of SYBR green LAMP assays for vcra with triplicates of X 10 dilutions of centrifuged cells from groundwater from the Indian Head site. The dilution levels increase to the right References Aiello MR (2003) Quantitative environmental monitoring of PCE dechlorinators in a contaminated aquifer and PCE-fed reactor. M.S. thesis, Michigan State University Johnson DR, Lee PK, Holmes VF, Alvarez-Cohen L (2005) An internal reference technique for accurately quantifying specific mrnas by real-time PCR with application to the tcea reductive dehalogenase gene. Appl Environ Microbiol 71(7): Kanitkar YH, Stedtfeld RD, Steffan RJ, Hashsham SA, Cupples AM (2016) Development of loop mediated isothermal amplification (LAMP) for rapid detection and quantification of Dehalococcoides spp. biomarker genes in commercial reductive dechlorinating cultures KB-1 and SDC-9. Appl Environ Microbiol 82: Ritalahti KM, Amos BK, Sung Y, Wu Q, Koenigsberg SS, Löffler FE (2006) Quantitative PCR targeting 16S rrna and reductive dehalogenase genes simultaneously monitors multiple Dehalococcoides strains. Appl Environ Microbiol 72(4): doi: /aem Page 9 of 9
Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC
Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)
Copy number standard curve. for absolute quantification by real-time PCR
Copy number standard curve for absolute quantification by real-time PCR Kit contents Positive control template for standard curve (RED) Template preparation buffer (YELLOW) RNase/DNase free water (WHITE)
Rødekro Vurdering af udviklingen i den naturlige nedbrydning i nedstrømsforureningsfane efter kildeoprensning
Downloaded from orbit.dtu.dk on: Nov 26, 2017 Rødekro 2015. Vurdering af udviklingen i den naturlige nedbrydning i nedstrømsforureningsfane efter kildeoprensning Broholm, Mette Martina; Badin, Alice; Jacobsen,
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
Supporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Simultaneous Elimination of Carryover Contamination and Detection of DNA
John Wilson, Principal Scientist, Scissortail Environmental Solutions, LLC, Ada, OK
Data Needs for Effective Application of MNA and In-Situ Bioremediation Featuring Framework to Apply vel Molecular and Other Screening Tools for MNA Evaluations John Wilson, Principal Scientist, Scissortail
Advanced microbial methods
Advanced microbial methods Group composition and stakeholders: GEUS: Jacob Bælum, arsten Suhr Jacobsen DTU Miljø: harlotte Scheutz, Mette Broholm, (Poul Bjerg) 1 Outline GEUS experiments DTU experiments
User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
LAMP User Guide Assay Design & Primers
Contents Page Page Content 2 Assay Design overview 3 Assay Design Custom Design Service 4 Assay Design - Software 5 Assay Design Target Sequence 7 Primers Primer Concentrations 9 Primers Preparing Primer
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
Relating mrna and protein biomarker levels in a Dehalococcoides and Methanospirillum containing community
Applied Microbiology and Biotechnology Electronic Supplementary Material for: Relating mrna and protein biomarker levels in a Dehalococcoides and Methanospirillum containing community Annette R. Rowe a#,
FINAL REPORT. SERDP Project ER-1560
FINAL REPORT Impacts of Sampling and Handling Procedures on DNA- and RNA-based Microbial Characterization and Quantification of Groundwater and Saturated Soil SERDP Project ER-1560 July 2012 Francis de
User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR
User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
A Paper Machine for Molecular Diagnostics
Electronic Supplementary Information A Paper Machine for Molecular Diagnostics John T. Connelly a,*, Jason P. Rolland a and George M. Whitesides b a Diagnostics For All, 840 Memorial Drive, Cambridge,
Single Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
Assay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
M. tuberculosis_mpb64/is611. genesig Advanced Kit. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd M. tuberculosis_mpb64/is611 0 genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to M.tuberculosis_MPB64/IS6110 2 Specificity MAX MIN The Primerdesign
PrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
Staphylococcus aureus
TM Primerdesign Ltd Staphylococcus aureus FEMB gene (chromosomal gene) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Staphylococcus aureus Staphylococcus
Human Y chromosome detection assay. Detection of the human Y chromosome by real-time PCR
Human Y chromosome detection assay Detection of the human Y chromosome by real-time PCR Contents Kit contents 3 Reagents and equipment to be supplied by user 3 Kit storage and stability 3 Suitable sample
Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,
FastFire qpcr PreMix (Probe)
FastFire qpcr PreMix (Probe) For fast, quantitative, specific real-time PCR using sequence-specific probe www.tiangen.com/en FP130820 Kit Contents FastFire qpcr PreMix (Probe) Contents 2 FastFire qpcr
Same TaqMan Assay quality, new format
Product Bulletin TaqMan Array Plates TaqMan Array Plates TaqMan Gene Expression Assays delivered in ready-to-use 96-well Custom Array Plates or predefined Gene Signature Plates Flexible choose from customizable
Evidence for Nitrogen Fixation by Dehalococcoides ethenogenes Strain 195
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2009, p. 7551 7555 Vol. 75, No. 23 0099-2240/09/$12.00 doi:10.1128/aem.01886-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. Evidence
Internal DNA extraction control
Internal DNA extraction control Instructions for use of DNA real-time PCR internal extraction control kit CTRL Internal controls and gdna detection Contents Introduction 3 Kit contents 4 Reagents and equipment
WarmStart LAMP Kit (DNA & RNA)
POLYMERASES & AMPLIFICATION WarmStart LAMP Kit (DNA & RNA) Instruction Manual NEB #E1700S/L 100/500 reactions Version 1.0 9/16 This product is intended for research purposes only. This product is not intended
Human Herpes Virus 1 (Herpes simplex type 1)
TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human
Mycobacterium Tuberculosis
TM Primerdesign Ltd Mycobacterium Tuberculosis rep13e12 genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis
RT 2 Easy First Strand Handbook
March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,
Human Papillomavirus 16
TM Primerdesign Ltd Human Papillomavirus 16 E6 gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus 16 Papillomaviruses are a diverse
Dengue Virus subtypes 1,2 3 and 4
TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Dengue Virus subtypes 1,2
HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit
![HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit](/thumbs/72/67570787.jpg "HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit")
HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,
Roche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
HiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
Epstein Barr Virus (Human Herpes virus 4)
TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to
Enterococcus faecium. genesig Standard Kit. groes heat shock protein. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Enterococcus faecium groes heat shock protein genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Enterococcus faecium E. faecium is a Gram-positive,
AmoyDx JAK2 Mutation Detection Kit
AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instruction for Use For Research Use Only Instruction Version: B2.6 Revision Date: October 2013 Store at -20±5 Xiamen,
PrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
ReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
Acinetobacter baumannii
TM Primerdesign Ltd Acinetobacter baumannii hypothetical protein sequence gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Acinetobacter baumannii Acinetobacter
Premix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene. genesig Advanced Kit. 150 tests.
TM Primerdesign Ltd Antibiotic resistance OXA -48 Carbapenem-hydrolyzing β- lactamase (blaoxa-48) gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Antibiotic
26 RNA Extraction and cdna Analysis for Quantitative Assessment of Biomarker Transcripts in Groundwater
26 RNA Extraction and cdna Analysis for Quantitative Assessment of Biomarker Transcripts in Groundwater K. M. Ritalahti 1. C. Cruz-García 1. E. Padilla-Crespo 2. J. K. Hatt 1. F. E. Löffler 1,2 1 School
GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
Application Note Detecting low copy numbers. Introduction. Methods A08-005B
Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template
Apium graveolens Celery/Celeriac. genesig Allergen detection Kit. 100 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Apium graveolens Celery/Celeriac genesig Allergen detection Kit 100 tests For general laboratory and research use only 1 Introduction to Apium graveolens Celery (Apium graveolens var.
Acinetobacter baumannii
PCRmax Ltd TM qpcr test Acinetobacter baumannii hypothetical protein sequence gene 150 tests For general laboratory and research use only 1 Introduction to Acinetobacter baumannii Acinetobacter baumannii
USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna
BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
I.QC (quality control of your qpcr)
qpcr data analysis I.QC (quality control of your qpcr)! 1. Check the melt curve if reactions with the same primer pair give only one peak -> proceed with the analysis if you see more than one peak, consider
Efficient qpcr Setup Without Cross Contamination Using the epmotion Family of Automated Liquid Handling Systems
APPLICATION NOTE No. 368 I July 2016 Efficient qpcr Setup Without Cross Contamination Using the epmotion Family of Automated Liquid Handling Systems Eric Gancarek¹, Blandine Vanbellinghen¹, Sandrine Hamels¹,
Texas Hazardous Waste Research Center
TO: FROM: SUBJECT: PROJECT NUMBER: Texas Hazardous Waste Research Center Dr. Mary Jo Kirisits, Mr. Gustavo Ochoa, Dr. Sungwoo Bae, Dr. Juan Pedro Maestre The University of Texas at Austin Department of
Bioremediation of Comingled 1,4-Dioxane and Chlorinated Solvent Plumes
Bioremediation of Comingled 1,4-Dioxane and Chlorinated Solvent Plumes Bilgen Yuncu, PhD, PE; Jessica L. Keener, PG and Robert C. Borden, PhD, PE Solutions-IES, Inc., Raleigh, NC TCE PCE Stephen D. Richardson,
EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide
EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide Table of Contents I. INTRODUCTION II. PRIMER DESIGN A. Finding the target gene using the UCSC Genome Bioinformatics Site B. Identifying
BioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR
BioBank cdna kit Instructions for the use of BioBank control cdna in real-time PCR Contents Introduction 3 Kit contents 4 Reagents and equipment to be supplied by user 4 Kit storage and stability 4 Primerdesign
Human Rhinovirus all subtypes (generic)
TM Primerdesign Ltd Human Rhinovirus all subtypes (generic) 5 non coding region (5 NCR) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rhinovirus all
Amplification: Consumables. Reagent Comparison Guide for Real-Time PCR
Amplification: Consumables Reagent Comparison Guide for Real-Time PCR Introduction With the introduction of the minimum information for publication of quantitative real-time PCR experiments (MIQE) guidelines
Retro-X qrt-pcr Titration Kit. User Manual. User Manual. Catalog No PT (091613)
User Manual Retro-X qrt-pcr Titration Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc. A Takara
SYBR Real-Time PCR Kit
SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...
Real-time LAMP rapid diagnostic method for X. fastidiosa in plant material and insect vectors. Yaseen Thaer Resercher in CIHEAM Bari, ITALY
Real-time LAMP rapid diagnostic method for X. fastidiosa in plant material and insect vectors Yaseen Thaer Resercher in CIHEAM Bari, ITALY The Need Ideal diagnostic test suitable for developing should
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)
The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification
PCR Add-on Kit for Illumina Instruction Manual
PCR Add-on Kit for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina) 015 (QuantSeq 3 mrna-seq Library
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
Syphacia obvelata. genesig Standard Kit. 28S ribosomal RNA. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Syphacia obvelata 28S ribosomal RNA genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Syphacia obvelata Syphacia obvelata is a murine pinworm,
Clostridium difficile
TM Primerdesign Ltd Clostridium difficile Toxin A (tcda) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Clostridium difficile Clostridium difficile is
A portable microfluidic platform for rapid molecular diagnostic. testing of patients with myeloproliferative neoplasms
A portable microfluidic platform for rapid molecular diagnostic testing of patients with myeloproliferative neoplasms Hua Wang 1, Xinju zhang 1, Xiao Xu 1, Qunfeng Zhang 1, Hengliang Wang 2, Dong Li 3,
AmoyDx JAK2 Mutation Detection Kit
AmoyDx JAK2 Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use For Research Use Only and For Reference Only Instructions Version: B1.2 Date of Revision: June 2016
Product# TM Intended Use. use only and not for use in diagnostic procedures.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Norovirus TaqMan RT-PCR Kit Product# TM41400 Product Insert Intended
Title: Quantification of soilborne pathogens of potato using real-time PCR
1 Title: Quantification of soilborne pathogens of potato using real-time PCR Principle Investigator: Neil C. Gudmestad, Department of Plant Pathology, North Dakota State University, Fargo, ND. Neil.Gudmestad@ndsu.edu
Precision MULTIPLEX qpcr Master Mix. Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR
Precision MULTIPLEX qpcr Master Mix Instructions for use of Primerdesign Precision MULTIPLEX Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents
Benchmarking of qpcr and qrt-pcr master mixes Resistance to common inhibitors in animal matrix extracts
Benchmarking of qpcr and qrt-pcr master mixes Resistance to common inhibitors in animal matrix extracts Rick Conrad, Sarah A. Read, Sharon A. Matheny Thermo Fisher Animal Health R&D The world leader in
DNA Genotyping from Human FFPE Samples Reliable and Reproducible
DNA Genotyping from Human FFPE Samples Reliable and Reproducible Use this optimized protocol to obtain reliable and reproducible SNP Genotyping data from those difficult human FFPE samples. 1 FFPE DNA Isolation
Hepatitis A Virus. genesig Standard Kit 5 NCR. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Hepatitis A Virus 5 NCR genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Hepatitis A Virus Hepatitis virus (HAV) is a non-enveloped ssrna
Instructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN
Instructions for Use RealStar Lassa Virus RT-PCR Kit 1.0 04/2017 EN RealStar Lassa Virus RT-PCR Kit 1.0 For research use only! (RUO) 641003 INS-641000-EN-S01 96 04 2017 altona Diagnostics GmbH Mörkenstr.
Pneumocystis jirovecii
TM Primerdesign Ltd Pneumocystis jirovecii Kexin-like serine protease (kex1) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Pneumocystis jirovecii Pneumocystis
Precision FAST qpcr Master Mix. Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR
Precision FAST qpcr Master Mix Instructions for use of Primerdesign Precision FAST Master Mix for real-time PCR Contents Introduction 3 Kit Contents 5 Recommended Accompanying Products 5 Reagents and Equipment
Stratagene QPCR Human Reference Total RNA
Stratagene QPCR Human Reference Total RNA Instruction Manual Catalog #750500 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750500-12 LIMITED PRODUCT WARRANTY This warranty limits
AmoyDx TM PIK3CA Five Mutations Detection Kit
AmoyDx TM PIK3CA Five Mutations Detection Kit Detection of five mutations in PIK3CA gene Instructions For Use Instructions Version: B1.3 Date of Revision: April 2012 Store at -20±2 1/5 Background Phosphatidylinositol
Quantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
Mycobacterium tuberculosis complex
TM Primerdesign Ltd Mycobacterium tuberculosis complex IS6110 repeat region genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Mycobacterium tuberculosis complex
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
Mycobacterium Tuberculosis
PCRmax Ltd TM Mycobacterium Tuberculosis rep13e12 qpcr test 150 tests For general laboratory and research use only 1 Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis is the bacterium
T7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HPV (High Risk) TaqMan PCR Kit Product# TM32200 Product Insert
OBSTACLES TO COMPLETE PCE DEGRADATION DURING REDUCTIVE DECHLORINATION
OBSTACLES TO COMPLETE PCE DEGRADATION DURING REDUCTIVE DECHLORINATION Judie A. Kean, Florida Department of Environmental Protection, Tallahassee, Florida, USA; Duane Graves, Dgraves@GeoSyntec.com, (GeoSyntec
PrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
TBE Buffer, 10X. Product Data Sheet Catalog No. Quantity ml liter. Please recycle Version:
TBE Buffer, 10X (Tris-borate-EDTA) Product Data Sheet Catalog No. Quantity 15002-500 15002-1000 1 liter Please recycle Version: 01042012 1 Description TBE Buffer is used for polyacrylamide and agarose
Israeli Acute Paralysis Virus
TM Primerdesign Ltd Israeli Acute Paralysis Virus Helicase gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Israeli Acute Paralysis Virus Israeli acute
Acinetobacter baumannii
TM Primerdesign Ltd Acinetobacter baumannii hypothetical protein sequence gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Acinetobacter baumannii Acinetobacter
Kessler: Molecular Diagnostics of Viruses Relevant in the Immunocompromised Patient. Wien, November 2012
MOLECULAR DIAGNOSTICS OF VIRUSES RELEVANT IN THE IMMUNOCOMPROMISED PATIENT VIRUSES RELEVANT IN THE IMMUNOCOMPROMISED PATIENT EBV HHV6 (HHV7) (HHV8) HSV1 HSV2 Parvovirus B19 Polyomavirus BK (Polyomavirus
SYBR Advantage qpcr Premix User Manual
SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General