Protein Synthesis. Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy
|
|
- Geoffrey Craig
- 6 years ago
- Views:
Transcription
1 Protein Synthesis Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy
2 STRUCTURE OF RNA RNA, adenine forms a base pair with uracil and guanine with cytosine There are three major types of RNA that participate in the process of protein synthesis: 1. ribosomal RNA (rrna) the complex structures that serve as the sites for protein synthesis. 2. transfer RNA (trna) brings specific amino acids to the ribosome to be assembled as proteins. 3. messenger RNA (mrna) mrna carries genetic information from the nuclear DNA to the cytosol, where it is used as the template for protein synthesis.
3 The Central Dogma of Protein Synthesis Transcription is the synthesis of RNA from DNA. Transcription occurs in the nucleus. mrna carries the information encoded in the gene (DNA) to the ribosome. RNA is copied from gene using base pairing, so is complimentary (but U not T). DNA unwinds in a section. RNA polymerase synthesizes the RNA strand.
4 Transcription of RNA from DNA Strand Involves four stages: Binding, Initiation, Elongation and Termination 1. The binding of RNA polymerase to a DNA promoter sequence - triggers the unwinding of double helix (binding site of RNA polymerase called DNA promoter). 2. RNA polymerase initiates the synthesis of an RNA chain. 3. Elongation: RNA polymerase moves along the DNA template, unwinding DNA (similar to helicase activity) and elongating RNA chain. 4. Termination: Terminators are genetic parts that usually occur at the end of a gene and cause transcription to stopand dependent upon the participation of a protein known as the ρ (rho) factor.
5 Transcription of RNA from DNA Strand Involves four stages: Binding, Initiation, Elongation and Termination
6 Action of antibiotics: Some antibiotics prevent bacterial cell growth by inhibiting RNA synthesis (inhibit transcription). For example, 1. rifampin: inhibits the initiation of transcription by binding to the β subunit of prokaryotic RNA polymerase (Figure 30.10). 2. Dactinomycin (actinomycin D) it is intercalating into the narrow groove of the DNA and interferes with the movement of RNA polymerase along the DNA. Figure Inactivation of prokaryotic RNA polymerase by rifampin.
7 Eukaryotic mrna processing: -methylguanosine cap at 5ˋ Increase mrna stability and position mrna on the ribosome for translation. Poly (A) tail mrna stability and recognised by specific proteins involved in exporting mrna into cytoplasm.
8 prokaryotic mrna processing: The Shine-Dalgarno (SD) sequence is a ribosomal binding site in prokaryotic messenger RNA helps to initiate protein synthesis by aligning the ribosome with the start codon, generally located around 8 bases upstream of the start codon AUG see figure Figure 31.10: Complementary binding between prokaryotic mrna Shine-Dalgarno sequence and 16S rrna.
9 Protein Synthesis: The Genetic Code: Each 3 consecutive bases on RNA is a coded word (the codon) (triplets) that specifies an amino acid. Leads to the open reading frame (ORF) The genetic code consists of 64 codons, (4x4x4 resulting from a combination of 4 possible ribonucleotides), but only 61 code amino acids. One codon, AUG, codes for methionine, and is also the start signal for the initiation of translation. Three codons act as signal terminators of translation called stop codon or non sensecodon(uaa, UAG, UGA) by binding release factors (RF), which cause the ribosomal subunits to disassociate, releasing the amino acid sequence.
10 Protein Synthesis Figure 31.2 Use of the genetic code table to translate the codon AUG.
11 Protein Synthesis III. COMPONENTS REQUIRED FOR TRANSLATION 1. Transfer RNA brings specific amino acids to the ribosome to be assembled as proteins. Amino acid attachment site: Anticodon contains 3 bases that are specific for the attached amino acid base pairs to the complementary triplet code on mrna (the codon) (Figure 31.6). [Note: When a trna has a covalently attached amino acid, it is said to be charged; when it does not, it is said to be uncharged.] Anticodon: Each trna molecule also contains a three-base nucleotide sequence, the anticodon, that pairs with a specific codon on the mrna (see Figure 31.6). Figure 31.6 Complementary, antiparallel binding of the anticodon for methionyl-trna (CAU) to the mrna codon for methionine (AUG), the initiation codon for translation.
12 Protein Synthesis III. COMPONENTS REQUIRED FOR TRANSLATION 2. Aminoacyl-tRNA synthetases a) Aminoacyl-tRNA synthetases is required for attachment of amino acids to the 3' end of a trnas. b) Aminoacyl-tRNA synthetases catalyze the covalent attachment of the carboxyl group of an amino acid to the 3'-end of its corresponding (cognate) trna. (Need energy, the enzyme splits ATP to AMP + PPi). c) The Aminoacyl-tRNA synthetases have a proofreading or editing activity that can remove amino acids from the enzyme or the trna molecule. Figure 31.7 Attachment of a specific amino acid to its corresponding trna by aminoacyl-trna synthetase (E).
13 Protein Synthesis III. COMPONENTS REQUIRED FOR TRANSLATION 3. Messenger RNA carries genetic information from the nuclear DNA to the cytosol D. Functionally competent ribosomes A ribosome consists of rrna with proteins. Ribosomes consist of a large subunit and a small subunit. mrna binds to the small subunit. whose relative sizes are given in terms of their sedimentation coefficients, or S (Svedberg) values.
14 Protein Synthesis D. ribosomal RNA (rrna) the complex structures that serve as the sites for protein synthesis. rrna has three binding sites for trna molecules: the A, P, and E sites, A-site (aminoacyl t RNA site) Holds trna carrying next amino acid. P-site (peptidyl trna site) carrying growing polypeptide chain. E- site (exite site) empty trna leaves ribosome from exit site
15 Protein Synthesis IV. CODON RECOGNITION BY trna A. Antiparallel binding between codon and anticodon antiparallel binding of the trna anticodon to the mrna codon. the mrna codon is read 5' 3' by an anticodon pairing in the flipped (3' 5') orientation (Figure 31.9). B. Wobble hypothesis trnas can recognize A Multiple (more one) codons can code for a single amino acid is described by the wobble hypothesis. Wobble hypothesis: (figure 31.9) 1. Nontraditional base-pairing is possible at third position of codon (3ˋ position). 2. Traditional base pairing in first and second positions of codon.
16 Protein Synthesis V. STEPS IN PROTEIN The process of translation is divided into three separate steps: Initiation, elongation, and 3 termination. (Translation need energy, GTP) A. Initiation: (need GTP) see figure 1. Small subunits separated from large subunit of rrna by IF 1, IF s rrna Small subunits rrna bind with mrna by shine dalgarno sequence. 3. IF2-GTP bring charged trna with methionine. 4. Hydrolysis GTP to GDP and all IF are released. B. Elongation: (need GTP) see figure 1. EF-Tu-GTP and EF-Ts bring charged trna with new amino acid at A site then Hydrolysis GTP to GDP and EF-Tu are released. 2. peptidyltransferase 3. Proofreading by aminoacyl-trna synthetases (bring right amino acid). 4. movement of trna and mrna through the ribosome by hydrolysis of EF-G-GTP to EF-G-GDP + Pi.
17 Protein Synthesis V. STEPS IN PROTEIN The process of translation is divided into three separate steps: Initiation, elongation, and 3 termination. (Translation need energy, GTP) A. Termination: (need GTP) see figure 1. Release factor RF1, RF2 and RF3-GTP bind to stop or termination codon. 2. RF3-GTP hydrolysis to RF3-GDP +Pi then rrna, trna and polypeptide are released.
18 Protein Synthesis
19 Protein Synthesis
20 The inhibitors of prokaryotic translation 1. streptomycin inhibit the Binding of formylmethionyl trna to 30S subunit of ribosomes. 2. Tetracycline prevents synthesis of polypeptide or elongation by Preventing binding of aminoacyl trna to the A site. 3. Puromycin causes inhibition of elongation and premature chain termination in both prokaryotes and eukaryotes. 4. Chloramphenicol inhibits the peptidyltranferase activity of 50S ribosomal subunit. 5. Erythromycin bind irreversibly to a site 50S so inhibiting translocation. The inhibitors of eukaryote translation 1. Diphtheria toxin inhibits EF2 and inhibits translation in eukaryotes by preventing translocation.
21 Q. From double-stranded DNA contains the sequence: (very important) (a) What is the base sequence of the mrna that can be transcribed from this strand? (b) What amino acid sequence could be coded by the mrna base sequence? Answer: 3ˋ 5ˋ N-terminal C-terminal
22 Mutations Mutations: changes to the DNA sequence. Consequences of altering the nucleotide sequence: Changing a single nucleotide base on the mrna chain (a point mutation ) can lead to any one of three results (Figure 31.3): 1. Silent mutation: The codon containing the changed base may code for the same amino acid. For example, if the serine codon UCA is given a different third base, U, to become UCU, it still codes for serine. This is termed a silent mutation. 2. Missense mutation: The codon containing the changed base may code for a different amino acid. For example, if the serine codon UCA is given a different first base,c, to become CCA, it will code for a different amino acid, in this case, proline. The substitution of an incorrect amino acid is called a missense mutation. 3. Nonsense mutation: The codon containing the changed base may become a termination codon. For example, if the serine codon UCA is given a different second base,a, to become UAA, the new codon causes termination of translation at that point, and the production of a shortened (truncated) protein. The creation of a termination codon at an inappropriate place is called a nonsense mutation.
23 Mutations Consequences of altering the nucleotide sequence: Figure 31.3 Possible effects of changing a single nucleotide base in the coding region of an mrna chain. A=adenine; C=cytosine; U=uracil.
24 Mutations Consequences of altering the nucleotide sequence: 4. Frame-shift mutations: one or two nucleotides are either deleted from or added to the coding region of a message sequence. different amino acid sequence, or a truncated product due to the creation of a termination codon (Figure 31.5). Figure 31.5 Frame-shift mutations as a result of addition or deletion of a base can cause an alteration in the reading frame of mrna.
25 Recombinant DNA Technology Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy
26 Gene cloning What is gene cloning? A DNA fragment carrying the gene is inserted into the plasmid molecules (vector) to produce a recombinant DNA molecules. The technology of how this is done is known as recombinant DNA technology.
27 Restriction enzymes Restriction enzymes or restriction endonuclease is an enzyme that cuts DNA at a specific sequence of nucleotides. 1. Some restriction enzymes such as EcoRI produces "sticky" ends. 2. Some restriction enzyme such as SmaI cleavage produces "blunt" ends.
28 Recombinant DNA Technology Steps of recombinant DNA technology: A. Isolation and purification of both DNA and vector (plasmid). B. Why gene cloned? 1. Recombinant human insulin. 2. Recombinant hepatitis B vaccine. 3. Recombinant human growth hormone 4. Insect-resistant crops 5. Diagnosis of infection with HIV. and joined by DNA ligase and inactivated lacz gene. 5. Identification bacteria that contain recombinant DNA
29 1. DNA fragment can be inserted for cloning in: a) Plasmid b)chromosomal DNA c) foreign DNA d) all of these
30 2. which of the following enzyme is used to cut DNA in rdna technology: a) restriction enzyme b) nuclease enzyme c) DNA POL I D) DNA ligase
31 3. Identification bacteria that contain recombinant DNA: a)activation chromosomal DNA. b) inhibition lacz gene or antibiotic resistance gene c) inhibit transcription process d) all of these
32 4. The termination site for transcription is recognized by: A) α Subunit o RNA polymerase B) β Subunit of RNA polymerase C) Sigma factor D) p(rho) factor
33 5. Anticodons are presented on: A) mrna B) trna C) rrna D) None of these
34 6. Translocation of the newly formed peptidyl trna at the A site into the empty P site involves A) EF-G, GTP B) EF-Tu, GTP C) EF-Ts, GDP D) Peptidyl transferase, GTP 7. If the codon UCA on mrna changes into UAA as a result of a base substitution in DNA, it will result in A) Silent mutation B) Acceptable mis-sense mutation C) Nonsense mutation D) Frameshift mutation
35
Gene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationCh 10.4 Protein Synthesis
Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationSection A: The Connection Between Genes and Proteins
CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are
More information3. INHERITED MUTATIONS
THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationMicrobiology: The Blueprint of Life, from DNA to protein
Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationTRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
More informationUnit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationDNA, RNA, protein synthesis. Sections , , and
DNA, RNA, protein synthesis Sections 14.1 14.5, 15.1 15.5, and 16.4 16.6 05-09-16 Today s class Extra-credit essay Activity on mitosis, meiosis, and inheritance Lecture and activities on the lecture Extra-credit
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More information1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).
1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationDo you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering
DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationAP2013-DNAPacket-II. Use the list of choices below for the following questions:
Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.
More informationProtein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationRNA and Protein Synthesis
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
More informationComparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationPUC Vikasana Program- 2012
Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the
More informationAnswers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.
Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationCHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationBIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationDNA REPLICATION REVIEW
Biology Ms. Ye DNA REPLICATION REVIEW 1. Number the steps of DNA replication the correct order (1, 2, 3): Name Date Block Daughter strands are formed using complementary base pairing DNA unwinds The DNA
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More information2. Examine the objects inside the box labeled #2. What is this called? nucleotide
Name Date: Period: Biology: DNA Review Packet Read each question and fill in the proper answer. 1. Label EVERY sugar (S), phosphate (P), and nitrogen base (A, T, C, G) in the diagram below. #2 2. Examine
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:
More informationProtein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationFrom Gene to Phenotype- part 3. Lecture Outline 11/9/05. The genetic code. Translation: overview
DN mrn From ene to Phenotype- part 3 TRNSRIPTION DN 1 RN is transcribed from a DN template. 5 RN RN transcript polymerase RN PROESSIN Exon 2 In eukaryotes, the RN transcript RN transcript (premrn) is spliced
More informationDNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
More information