|
|
|
- Stewart Wiggins
- 6 years ago
- Views:
Transcription
1
2
3
4
5
6
7 Problem: The GC base pairs are more stable than AT base pairs. Why?
8 5. Triple-stranded DNA was first observed in Scientists later discovered that the formation of triplestranded DNA involves a type of base pairing called Hoogsteen pairing, which differs from the Watson-Crick base pairing observed in normal double-stranded DNA. Below is an example of a Hoogsteen base pair. N N 1 NH 2 N N DNA O HN O 2 N DNA a. Identify each of these bases by name. b. Redraw these two base pairs showing all lone pair electrons. c. Draw the hydrogen bond interactions expected for this Hoogsteen base pair.
9 a.formation of a triple helix requires three bases to interact with each other to form a base trio rather than a base pair. One way in which this three-way interaction can take place is for the three bases to engage in both Watson- Crick base pairing and Hoogsteen base pairing. Show how two thymines and an adenine could interact with each other to form a base trio by using both Watson-Crick and Hoogsteen base pairing.
10 DNA N O N H O N N H N N H N H O N O N DNA DNA
11
12 The DNA molecules have T instead of U (which is found in RNA). Can you hypothesize why that is, knowing that it was established that the amino group in the cytosine is spontaneously hydrolyzed about 120 times in a day in a normal human cell.
13
14
15
16
17 Problem: The nucleotide sequence of one DNA strand of a DNA double helix is: 5 -GGATTCTTTTGGCTATCGGG-3 What is the sequence of the complementary strand?
18 Lamivudine is phosphorylated in a cell and is a substrate for HIV RT. Lamivudine is a nucleotide analogue. Which one? Based on your knowledge of DNA polymerization can you predict the effect of this molecule on RT and DNA polymerization. Lamivudine
19
20 Problem To amplify the DNA fragments Taq polymerase is used during the PCR reaction. Can you name some of the qualities of Taq polymerase which make it the enzyme of choice? Can you name several differences between Taq polymerase and human polymerase? The incorporation of the non-complementary nucleotide within the daughter chain of DNA is a relatively rare event. Why?
21 Problem: Two strands of DNA double helix can be separated by heating. If you raise the temperature in a solution that has the following three molecules, in what order do you suppose they would melt? GCGGGGCTCCCCGATTTCGGGCGCCCGGGGTTTTAAA CGCCCCGAGGGGCTAAAGCCCGCGGGCCCCAAAATTT ATTTTTCCTTTTAACGCTCACTGCATGCCATATCGATGC TAAAAAGGAAAATTGCGAGTGAGTACGGTATAGCTACG AGATCGCTCAGGCTGCATG TCTAGCGAGTCCGACGTAC
22 3' 5' 3' 5' A - T T - A T - A G - C C - G T 5' T C AT DNA polymerase datp, dttp, dgtp, dctp 72 o - - A TT - G - C - A - A - G - T - A - T A A C G T T C A T 3' 5' 3' 3' 5' A T T G C A A G T 5' T A A C G 3' DNA polymerase datp, dttp, dgtp? 72 o
23 Reverse transcriptase incorporates 10 to 100 times more DNA errors when generating the daughter DNA molecules, unlike mammalian polymerases. Explain how this affects the use of drugs that target viral protein-dependent functions? You need to diagnose HIV infection. Briefly describe how you could go about detecting the target?
24 LS1a Review Session Peptide bond Structures and properties of the 20 key amino acids Amino acid interactions Alison Stewart Sunday, October 15 th, 2006
25 Peptide bond Amide or peptide bond What is unique about this bond?
26 Resonance of peptide bond Double bond character Does not rotate Polar due to resonance, strong dipole
27 Amino acid structure All amino acids have the same general formula, but differ in their side chains or R groups
28 Aspartate or Aspartic acid Acidic Aspartic acid or Aspartate = Asp = D pka = 4 (Do not need to know!)
29 Glutamate or Glutamic acid Acidic Glutamic acid or GlutamatE = Glu = E pka = 4.5 (Do not need to know!)
30 Lysine Basic Lysine = Lys = K pka = (Do not need to know!)
31 Arginine Basic Arginine = Arg = R pka = 12 (Do not need to know)
32 Histidine Basic Histidine = His = H pka = 6-7 (Do not need to know!)
33 Serine Polar Serine = Ser = S
34 Threonine Polar Threonine = Thr = T
35 Cysteine Polar, not very polar so can be called nonpolar Cysteine = Cys = C Makes disulfide bonds!!!
36 Proline Important for peptide shape Conformationally constrained Can be cis OR trans Proline = Pro = P
37 Asparagine Polar Asparagine = Asn = N
38 Glutamine Polar Glutamine = Gln = Q
39 Phenylalanine Cyclic, nonpolar Phenylalanine = Phe = F
40 Tyrosine Cyclic, polar Tyrosine = Tyr = Y
41 Tryptophan Cyclic Tryptophan = Trp = W
42 Glycine Important for peptide shape Conformationally flexible Glycine = Gly = G
43 Alanine Nonpolar Alanine = Ala = A
44 Valine Nonpolar Valine = Val = V
45 Nonpolar Leucine = Leu = L Leucine
46 Methionine Nonpolar Methionine = Met = M
47 Isoleucine Nonpolar Isoleucine = Ile = I
48 Amino Acid Interaction Question 1 Which amino acids can form ionic bonds (at ph 7)? Two categories: Acidic: Aspartic acid and Glutamic acid Basic: Histidine, Lysine, Arginine
49 Amino Acid Interaction Question 2a Which amino acids can participate in hydrogen bonding (via their side chains)? Acidic: Aspartic acid and Glutamic acid Basic: Histidine, Lysine, Arginine Polar: Asparagine, Glutamine, Threonine, Serine, Tyrosine, Tryptophan (Tyr and Trp both are also nonpolar and cyclic)
50 Amino Acid Interaction Question 2b What is unusual about hydrogen bonding for proline? It is conformationally constrained so it can be inaccessible to make linear H bonds The nitrogen is positively charged so it can only be a donor not an acceptor
51 Amino Acid Interaction Question 3 What is the strongest interaction between amino acids? Two good answers: The peptide or amide bond in the backbone Disulfide bonds between cysteines
52 Amino Acid Interaction Question 4 Which amino acids interact most strongly via Van der Waals forces? Nonpolar: Alanine, Leucine, Isoleucine, Methionine, Valine Cyclic: Phenylalanine, (Tryptophan & Tyrosine can potentially H bond or have dipole interactions) Other: Glycine, Proline (possible for the amine in Pro to be an H bond donor if it aligns properly)
53 Amino Acid Interaction Question 5 Which amino acids are important for peptide shape? Glycine, Why? conformationally flexible Proline, Why? cis OR trans, conformationally constrained bends backbone Cysteine, Why? makes disulfide bonds, covalently links sections of peptide together
54 Peptide bond, Amino acid structure or interaction questions?
55 At last! Protein folding & thermodynamics!
56 Anfinsen s protein folding experiment Conclusion: The information required to fold a protein is contained within its sequence
57 Four levels of protein structure 1) Primary Structure: The linear sequence of amino acids 2) Secondary Structure: The local structure adopted by stretches of contiguous amino acids. 3) Tertiary Structure: The fold of a single polypeptide chain. 4) Quaternary Structure: The interaction of individually folded polypeptide chains to form a higher order complex.
58
59
60
61
62
63
64
65
66 Shown below is a picture of a protein. The major interactions that hold the protein in its properly folded conformation are highlighted in yellow. f a c e b d Briefly describe each interaction a-e
11 questions for a total of 120 points
Your Name: BYS 201, Final Exam, May 3, 2010 11 questions for a total of 120 points 1. 25 points Take a close look at these tables of amino acids. Some of them are hydrophilic, some hydrophobic, some positive
Fundamentals of Protein Structure
Outline Fundamentals of Protein Structure Yu (Julie) Chen and Thomas Funkhouser Princeton University CS597A, Fall 2005 Protein structure Primary Secondary Tertiary Quaternary Forces and factors Levels
Structure formation and association of biomolecules. Prof. Dr. Martin Zacharias Lehrstuhl für Molekulardynamik (T38) Technische Universität München
Structure formation and association of biomolecules Prof. Dr. Martin Zacharias Lehrstuhl für Molekulardynamik (T38) Technische Universität München Motivation Many biomolecules are chemically synthesized
Protein Structure and Function! Lecture 4: ph, pka and pi!
Protein Structure and Function! Lecture 4: ph, pka and pi! Definition of ph and pk a! ph is a measure of the concentration of H +.! + ph = log 10[H ] For a weak acid,! HA #!!"! H + + A!, K a = [H + ][A!
36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-
36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic
Protein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
Protein Structure Prediction by Constraint Logic Programming
MPRI C2-19 Protein Structure Prediction by Constraint Logic Programming François Fages, Constraint Programming Group, INRIA Rocquencourt mailto:francois.fages@inria.fr http://contraintes.inria.fr/ Molecules
Key Concept Translation converts an mrna message into a polypeptide, or protein.
8.5 Translation VOBLRY translation codon stop codon start codon anticodon Key oncept Translation converts an mrn message into a polypeptide, or protein. MIN IDES mino acids are coded by mrn base sequences.
CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS
1 CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Jean Gao at UT Arlington Mingon Kang, PhD Computer Science, Kennesaw State University 2 Genetics The discovery of
MOLEBIO LAB #3: Electrophoretic Separation of Proteins
MOLEBIO LAB #3: Electrophoretic Separation of Proteins Introduction: Proteins occupy a central position in the structure and function of all living organisms. Some proteins serve as structural components
Zool 3200: Cell Biology Exam 3 3/6/15
Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either
Biology: The substrate of bioinformatics
Bi01_1 Unit 01: Biology: The substrate of bioinformatics What is Bioinformatics? Bi01_2 handling of information related to living organisms understood on the basis of molecular biology Nature does it.
Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function.
HASPI Medical Biology Lab 0 Purpose Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. Background http://mssdbio.weebly.com/uploads/1//7/6/17618/970_orig.jpg
Lezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins
CHAPTER 1. DNA: The Hereditary Molecule SECTION D. What Does DNA Do? Chapter 1 Modern Genetics for All Students S 33
HPER 1 DN: he Hereditary Molecule SEION D What Does DN Do? hapter 1 Modern enetics for ll Students S 33 D.1 DN odes For Proteins PROEINS DO HE nitty-gritty jobs of every living cell. Proteins are the molecules
THE GENETIC CODE Figure 1: The genetic code showing the codons and their respective amino acids
THE GENETIC CODE As DNA is a genetic material, it carries genetic information from cell to cell and from generation to generation. There are only four bases in DNA and twenty amino acids in protein, so
Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS
UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS Nucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RNA (ribonucleic
Daily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos
Daily Agenda Warm Up: Review Translation Notes Protein Synthesis Practice Redos 1. What is DNA Replication? 2. Where does DNA Replication take place? 3. Replicate this strand of DNA into complimentary
Aipotu I & II: Genetics & Biochemistry
Aipotu I & II: Genetics & Biochemistry Objectives: To reinforce your understanding of Genetics, Biochemistry, and Molecular Biology To show the connections between these three disciplines To show how these
APPENDIX. Appendix. Table of Contents. Ethics Background. Creating Discussion Ground Rules. Amino Acid Abbreviations and Chemistry Resources
Appendix Table of Contents A2 A3 A4 A5 A6 A7 A9 Ethics Background Creating Discussion Ground Rules Amino Acid Abbreviations and Chemistry Resources Codons and Amino Acid Chemistry Behind the Scenes with
The study of protein secondary structure and stability at equilibrium ABSTRACT
The study of protein secondary structure and stability at equilibrium Michelle Planicka Dept. of Physics, North Georgia College and State University, Dahlonega, GA REU, Dept. of Physics, University of
From Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
Name: TOC#. Data and Observations: Figure 1: Amino Acid Positions in the Hemoglobin of Some Vertebrates
Name: TOC#. Comparing Primates Background: In The Descent of Man, the English naturalist Charles Darwin formulated the hypothesis that human beings and other primates have a common ancestor. A hypothesis
Aipotu I: Genetics & Biochemistry
Aipotu I: Genetics & Biochemistry Objectives: To reinforce your understanding of Genetics, Biochemistry, and Molecular Biology To show the connections between these three disciplines To show how these
Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 29 September 2005
Case 7 A Storage Protein From Seeds of Brassica nigra is a Serine Protease Inhibitor Last modified 9 September 005 Focus concept Purification of a novel seed storage protein allows sequence analysis and
Forensic Science: DNA Evidence Unit
Day 2 : Cooperative Lesson Topic: Protein Synthesis Duration: 55 minutes Grade Level: 10 th Grade Forensic Science: DNA Evidence Unit Purpose: The purpose of this lesson is to review and build upon prior
UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR
UNIT I RNA AND TYPES R.KAVITHA,M.PHARM LECTURER DEPARTMENT OF PHARMACEUTICS SRM COLLEGE OF PHARMACY KATTANKULATUR RNA, as previously mentioned, is an acronym for ribonucleic acid. There are many forms
Chapter 3 Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
DNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
Just one nucleotide! Exploring the effects of random single nucleotide mutations
Dr. Beatriz Gonzalez In-Class Worksheet Name: Learning Objectives: Just one nucleotide! Exploring the effects of random single nucleotide mutations Given a coding DNA sequence, determine the mrna Based
Name Date of Data Collection. Class Period Lab Days/Period Teacher
Comparing Primates (adapted from Comparing Primates Lab, page 431-438, Biology Lab Manual, by Miller and Levine, Prentice Hall Publishers, copyright 2000, ISBN 0-13-436796-0) Background: One of the most
Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic
6- Important Molecules of Living Systems. Proteins Nucleic Acids Taft College Human Physiology
6- Important Molecules of Living Systems Proteins Nucleic Acids Taft College Human Physiology Proteins Proteins- made from: C, H, O, N, and S. Proteins are very large molecules composed of long chains
DNA Begins the Process
Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process
Answers to the multiple choice questions are at the bottom of the last page of this document.
Review for Unit Test #2: Cell Parts, Functions and Protein Synthesis, Answers Answers to the multiple choice questions are at the bottom of the last page of this document. 1. Know all of the material on
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
Hmwk # 8 : DNA-Binding Proteins : Part II
The purpose of this exercise is : Hmwk # 8 : DNA-Binding Proteins : Part II 1). to examine the case of a tandem head-to-tail homodimer binding to DNA 2). to view a Zn finger motif 3). to consider the case
Proteins Higher Order Structures
Proteins Higher Order Structures Dr. Mohammad Alsenaidy Department of Pharmaceutics College of Pharmacy King Saud University Office: AA 101 msenaidy@ksu.edu.sa Previously on PHT 426!! Protein Structures
2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.
From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how
Protein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
7.013 Spring 2005 Practice Quiz Practice Quiz 1
MIT Department of Biology 7.013: Introductory Biology Spring 2005 Instructors: Professor azel Sive, Professor Tyler Jacks, Dr. laudette Gardel 7.013 Spring 2005 Practice Quiz 1 7.013 Practice Quiz 1 Question
7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided.
7.014 Quiz II 3/18/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. heck that you
The Transition to Life!
The Transition to Life The Transition to Life Chemical Evolution Biological Evolution? Interacting Chemical Reproduction of Organisms Natural Selection Based on Simplest Life Now: Need: 1. Nucleic Acids
Honors packet Instructions
Honors packet Instructions The following are guidelines in order for you to receive FULL credit for this bio packet: 1. Read and take notes on the packet in full 2. Answer the multiple choice questions
Packing of Secondary Structures
7.88 Lecture Notes - 5 7.24/7.88J/5.48J The Protein Folding and Human Disease Packing of Secondary Structures Packing of Helices against sheets Packing of sheets against sheets Parallel Orthogonal Table:
From Gene to Protein via Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein via Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
All Rights Reserved. U.S. Patents 6,471,520B1; 5,498,190; 5,916, North Market Street, Suite CC130A, Milwaukee, WI 53202
Secondary Structure In the previous protein folding activity, you created a hypothetical 15-amino acid protein and learned that basic principles of chemistry determine how each protein spontaneously folds
info@rcsb.org www.pdb.org Bioinformatics of Green Fluorescent Protein This bioinformatics tutorial explores the relationship between gene sequence, protein structure, and biological function in the context
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
CFSSP: Chou and Fasman Secondary Structure Prediction server
Wide Spectrum, Vol. 1, No. 9, (2013) pp 15-19 CFSSP: Chou and Fasman Secondary Structure Prediction server T. Ashok Kumar Department of Bioinformatics, Noorul Islam College of Arts and Science, Kumaracoil
7.012 Final Exam
7.012 Final Exam 2006 You have 180 minutes to complete this exam. There are 19 pages including this cover page, the AMINO AID page, and the GENETI ODE page at the end of the exam. Please write your name
From Gene to Protein Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
UNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
Describe the features of a gene which enable it to code for a particular protein.
1. Answers should be written in continuous prose. Credit will be given for biological accuracy, the organisation and presentation of the information and the way in which the answer is expressed. Cancer
6. Which nucleotide part(s) make up the rungs of the DNA ladder? Sugar Phosphate Base
DNA Unit Review Worksheet KEY Directions: Correct your worksheet using a non blue or black pen so your corrections can be clearly seen. DNA Basics 1. Label EVERY sugar (S), phosphate (P), and nitrogen
Chapter 2 - DNA MC [37 marks]
![Chapter 2 - DNA MC [37 marks]](/thumbs/74/71041787.jpg "Chapter 2 - DNA MC [37 marks]")
Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order
Molecular Biology of the Gene
hapter 12: pp. 211-232 BIOLOY 10th Edition Molecular Biology of the ene 2 nm opyright The Mcraw-Hill ompanies, Inc. Permission required for reproduction or display. b. 0.34 nm 3.4 nm T sugar-phosphate
Biomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
Unit 2 Review: DNA, Protein Synthesis & Enzymes
1. One of the functions of DNA is to A. secrete vacuoles.. make copies of itself.. join amino acids to each other. D. carry genetic information out of the nucleus. 2. Two sugars found in nucleic acids
Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
Transcription and Translation
Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism
DNA & PROTEIN SYNTHESIS REVIEW
Name: Block: DNA & PROTEIN SYNTHESIS REVIEW 1. Give the purpose of each of the following steps in the process of protein synthesis. a) Ribosome moving along a mrna: (1 mark) b) Adenine bonding to thymine:
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
HASPI Medical Biology Lab 02 Background/Introduction
HASPI Medical Biology Lab 02 Background/Introduction Before humans even knew of the existence of DNA, they recognized that certain traits were inherited. Through observation they saw that plants and animals
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of December
Name: Class: Date: 2015 Biology Unit 4 PRACTICE TEST DNA, Structure, Function, Replication Week of 14-18 December 1. Which scientists figured out the three-dimensional structure of DNA by using a model
Folding simulation: self-organization of 4-helix bundle protein. yellow = helical turns
Folding simulation: self-organization of 4-helix bundle protein yellow = helical turns Protein structure Protein: heteropolymer chain made of amino acid residues R + H 3 N - C - COO - H φ ψ Chain of amino
Gene Expression Translation U C A G A G
Why? ene Expression Translation How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how your body works is carried out by cells through
Thr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
Chapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY
Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic
Central Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
PROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
Honors Research in Molecular Genetics Part 1
Third Base Honors Research in Molecular enetics Part 1 ll bout ene Expression How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
Residue Contact Prediction for Protein Structure using 2-Norm Distances
Residue Contact Prediction for Protein Structure using 2-Norm Distances Nikita V Mahajan Department of Computer Science &Engg GH Raisoni College of Engineering, Nagpur LGMalik Department of Computer Science
Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
Virtual bond representation
Today s subjects: Virtual bond representation Coordination number Contact maps Sidechain packing: is it an instrumental way of selecting and consolidating a fold? ASA of proteins Interatomic distances
Structural bioinformatics
Structural bioinformatics Why structures? The representation of the molecules in 3D is more informative New properties of the molecules are revealed, which can not be detected by sequences Eran Eyal Plant
Site-directed Mutagenesis
Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences
Addison Ault, Department of Chemistry, Cornell College, Mount Vernon, IA. The isoelectric point is a point on the ph scale. It is the ph at which the
1 Isoelectric Points On the Back of the Envelope Addison Ault, Department of Chemistry, Cornell College, Mount Vernon, IA The isoelectric point is a point on the ph scale. It is the ph at which the average
DNA stands for deoxyribose nucleic acid.
1 DNA stands for deoxyribose nucleic acid. DNA controls the kind of cell which is formed (i.e. muscle, blood, nerve). DNA controls the type of organism which is produced (i.e. buttercup, giraffe, herring,
Name: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
SYKAM Amino Acid Analyzer
C H R O M AT O G R A P H Y SYKAM Amino Acid Analyzer Automatic Amino Acid Analyzer S 433 The innovative automatic Amino Acid Analyzer S 433 combines the advantages of the classical ion exchange separation
SMIBIO Case Study in Germany - Green Biorefineries in the Bavarian region of Straubing-Bogen (a case study in progress)
SMIBIO Case Study in Germany - Green Biorefineries in the Bavarian region of Straubing-Bogen (a case study in progress) SMIBIO Workshop Small-scale Biorefineries for Rural Development in Latin America
7.88J Protein Folding Problem Fall 2007
MIT OpenCourseWare http://ocw.mit.edu 7.88J Protein Folding Problem Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. 7.88 Lecture Notes - 8 7.24/7.88J/5.48J
RNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
1. DNA replication. (a) Why is DNA replication an essential process?
ame Section 7.014 Problem Set 3 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68120 by 5:00pm on Friday
STUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has