DNA Function: Information Transmission

Size: px
Start display at page:

Download "DNA Function: Information Transmission"

Transcription

1 DNA Function: Information Transmission

2 DNA is called the code of life. What does it code for? *the information ( code ) to make proteins!

3 Why are proteins so important? Nearly every function of a living thing is carried out by proteins -DNA replication -structural proteins (skin, muscles, etc.) -transport proteins (hemoglobin, etc.) -fight infection (antibodies) -enzymes (digest food, copy DNA, etc.)

4 How does the information in DNA get converted to PROTEINS? **Remember proteins are long chains of amino acids (there are 20 different amino acids) **the order / sequence of amino acids is CRUCIAL DNA determines the order of amino acids

5

6 Protein Synthesis / Gene Expression consists of 2 steps: 1) TRANSCRIPTION 2) TRANSLATION

7 TRANSCRIPTION: DNA has the information ( blueprints ) to make proteins, BUT it can t leave the nucleus (too big!) So, it needs a MESSENGER to carry the blueprints from the nucleus to the proteinmaking factories the RIBOSOMES! the messenger is messenger RNA (or mrna)

8

9 RNA (ribonucleic acid) is different from DNA in 3 ways: 1) RNA is single stranded 2) the sugar in RNA is RIBOSE (instead of deoxyribose) 3) Instead of thymine (T), RNA contains URACIL (U) (base pairing rules still apply: C with G; A with U)

10

11 Enzymes unzip DNA and RNA nucleotides link to the bases, forming mrna (see fig. 17.9)

12 for each gene, only 1 of the 2 strands (the template strand) is transcribed Template strand

13 transcription of mrna from template DNA is catalyzed by RNA polymerases which separate the 2 DNA strands and link RNA nucleotides as they base-pair along the DNA template

14 RNA nucleotides are added only to the 3 end (mrna is synthesized in the 5 3 direction)

15 RNA polymerases bind to DNA at regions called PROMOTERS. This binding site is where transcription begins (initiation site)

16

17 Transcription (continued) During transcription, mrna grows about nucleotides per second *as the mrna strand elongates, it peels away from the DNA template; *2 strands of DNA double helix are reunited

18 Transcription proceeds until RNA polymerase reaches a termination site on the DNA

19 How does mrna produce a protein?

20

21 TRANSLATION: During translation, proteins are synthesized according to the genetic message of sequential codons along the mrna

22 Transfer RNA (trna) is the interpreter between the 2 forms of information: the base sequence in mrna and the amino acid sequence in polypeptides

23 trna aligns the appropriate amino acid to form a new polypeptide by transferring the amino acid from the cytoplasm to a ribosome and recognizing the correct codons in mrna Amino acid location 3 exposed bases

24 Amino acid Molecules of trna are specific for only 1 amino acid -one end of trna attaches to a specific amino acid -the other end attaches to mrna codon by base pairing (anticodon = a sequence of 3 bases on trna)

25 trna s decode the genetic message codon by codon

26 as trna s deposit amino acids in the correct order, ribosomal enzymes (peptidyl transferases) catalyze formation of peptide bonds between the polypeptide and each new amino acid

27

28 **figure 17.5 shows the dictionary for the codons and their corresponding amino acids

29

30

31

32

33 Protein Synthesis in Prokaryotes vs. Eukaryotes In bacteria, transcription and translation happen in the same location and often happen simultaneously! In eukaryotic cells, the nuclear envelope separates transcription from translation this provides time for RNA processing (this is an extra step between transcription and translation that does not occur in prokaryotes).

34 Post-transcription modification of mrna in eukaryotes: 1) Alteration of mrna ends: *the 5 end is capped with a modified form of guanine (G) -protects the mrna from hydrolytic enzymes; -serves as an attach here signal for small ribosomal subunits

35 Post-transcription modification of mrna in eukaryotes: *at the 3 end, an enzyme adds a poly-a tail ( adenine nucleotides) -inhibits degradation of the mrna -may facilitate the export of mrna from the nucleus to the cytoplasm

36 Post-transcription modification of mrna in eukaryotes: 2) RNA Splicing *INTRONS = noncoding segments of DNA; intervening sequences (between the coding segments) *EXONS = coding regions of DNA; exons are eventually expressed

37

38 Both introns and exons are transcribed to form an oversized mrna molecule; Enzymes excise (cut out) the introns and join the exons to form a continuous coding sequence.

39 INTRONS AND EXONS: POST TRANSCRIPTION MODIFICATION

40

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

Molecular Genetics. Before You Read. Read to Learn

Molecular Genetics. Before You Read. Read to Learn 12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase

More information

Protein Synthesis. OpenStax College

Protein Synthesis. OpenStax College OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein? Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering

Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Ch 10.4 Protein Synthesis

Ch 10.4 Protein Synthesis Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

Activity A: Build a DNA molecule

Activity A: Build a DNA molecule Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Gene Expression. Student:

Gene Expression. Student: Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the

More information

TRANSCRIPTION AND TRANSLATION

TRANSCRIPTION AND TRANSLATION TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

C. Incorrect! Threonine is an amino acid, not a nucleotide base.

C. Incorrect! Threonine is an amino acid, not a nucleotide base. MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Review? - What are the four macromolecules?

Review? - What are the four macromolecules? Review? - What are the four macromolecules? Lipids Carbohydrates Protein Nucleic Acids What is the monomer of nucleic acids and what do nucleic acids make up? Nucleotides; DNA and RNA 12-1 DNA DNA Stands

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How

More information

Read and take notes on pages

Read and take notes on pages Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Molecular Biology of the Gene

Molecular Biology of the Gene Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides

More information

DNA, Replication and RNA

DNA, Replication and RNA DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

More information

Gene Expression REVIEW Packet

Gene Expression REVIEW Packet Name Pd. # Gene Expression REVIEW Packet 1. Fill-in-the-blank General Summary Transcription & the Big picture Like, ribonucleic acid (RNA) is a acid a molecule made of nucleotides linked together. RNA

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016 Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

Neurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants

Neurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

14 Gene Expression: From Gene to Protein

14 Gene Expression: From Gene to Protein CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

DNA & Protein Synthesis UNIT D & E

DNA & Protein Synthesis UNIT D & E DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

DNA Replication and Protein Synthesis

DNA Replication and Protein Synthesis DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls

More information

STUDY GUIDE SECTION 10-1 Discovery of DNA

STUDY GUIDE SECTION 10-1 Discovery of DNA STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has

More information

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:

More information

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases. DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types

More information

Gene Expression Transcription

Gene Expression Transcription Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction

More information

Section A: The Connection Between Genes and Proteins

Section A: The Connection Between Genes and Proteins CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

Unit 2 Review: DNA, Protein Synthesis & Enzymes

Unit 2 Review: DNA, Protein Synthesis & Enzymes 1. One of the functions of DNA is to A. secrete vacuoles.. make copies of itself.. join amino acids to each other. D. carry genetic information out of the nucleus. 2. Two sugars found in nucleic acids

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information