Name HOUR EXAM II BIOLOGY 108 FALL, 2003

Size: px
Start display at page:

Download "Name HOUR EXAM II BIOLOGY 108 FALL, 2003"

Transcription

1 Name First Last PD Number - (Pease Print) HOUR EXAM BOLOGY 108 FALL, 2003 n the spirit of the honor code, pedge that have neith 1 Signature

2 1. (10 points) From the foowing ist circe a of the components required for transation in E. coi. (Note that points wi be subtracted for incorrect answers). RNA poymerase ribosomes mrna trna ATP GTP datp,dttp,dctp,dgtp DNA poymerase amino acids igase reverse transcriptase aminoacy-trna synthase DNA poymerase ribosomes initiation factors RNA-dependent poymerase peptidogycan gucose eongation factors sigma factor termination factors primase heicase singe-stranded DNA binding protein DNA From the foowing ist circe a of the components required for repication of DNA in E. coi. (Note that points wi be subtracted for incorrect answers). RNA poymerase ribosomes mrna trna ATP GTP datp,dttp,dctp,dgtp DNA poymerase amino acids igase reverse transcriptase aminoacy-trna synthase DNA poymerase initiation factors RNA-dependent poymerase peptidogycan gucose eongation factors sigma factor termination factors primase heicase singe-stranded DNA binding protein DNA 2. (6 points) n answering the questions beow ist as many proteins as are necessary; if none are required state Anone@. What proteins does a bacterium require for the transcription of vegetative genes? What virus-encoded proteins does poio require for the transcription of its genes? What virus encoded proteins does T7 need for transcription of ate genes?

3 3. (14 points) RNA viruses that grow in pant or anima ces have to sove the probem that eukaryotic ces generay ony make one protein using one piece of mrna. Different viruses have used different strategies to circumvent this probem. Describe the strategy used by tobacco mosaic virus (a tobamo virus). Describe the strategy used by infuenza virus.

4 Use the foowing information for the remainder of the questions on the exam. amino acids vitamins sugars antibiotics threonine (thr) biotin (bio) gucose (gu) streptomycin (sm) eucine (eu) thiamine (thi) actose (ac) rifampicin (rif) histidine (his) matose (ma) ampiciin (amp) tryptophan (trp) arabinose (ara) arginine (arg) tetracycine (tet) 4. ( 9 points) You perform an conjugation between two E. coi strains with the foowing genotypes: F - : sm R, thr -, his -, thi -, ma -, ac + Hfr : sm S, thr +, his +, thi +, ma +, ac + You have avaiabe the ingredients isted above as we as minima medium and compex medium. What medium woud you use to seect transconjugants of each of the foowing genotypes? thr + ma + thi +

5 5. (9 points)you perform an interrupted mating between two E. coi strains with the foowing genotypes: F - : rif R arg -, eu -, thi -, ara - Hfr : rif S arg +, eu +,thi +, ara + The conjugates are pated on the foowing minima media at the times indicated: Media 1: eu, thi, gu, rif Media 2: arg, eu, gu, rif Media 3: arg, thi, eu, ara, rif Time of interrupted # of coonies Mating Media 1 Media 2 Media 3 5 min min min min min Graph these data on the suppied graph paper. Be sure to abe the axes and to indicate which ine represents which data. Given the above data abe the order of gene transfer beow (1 st, 2 nd, or 3 rd ): arg thi ara What is the time of transfer of each gene (in min.)? arg thi ara

6 6. ( 10 points)you wish to determine the gene order and reative distances of three genes from E. coi. You prepare DNA from E. coi which is his - thi + ma + and use it to transform E. coi which is his + thi - ma -. You seect for ces which are thi + or ma + and test them for the abiity to make a his or thi, or to grow on matose. You obtain the foowing resuts: Seected marker Percentage of seected ces which are his + thi + ma + thi ma Draw a diagram to show the gene order and reative positions What medium did you use to test whether the thi + bacteria are his +? Why didn=t you pace the origina transformation on media to seect for his + ces

7 For the next two questions you have a of the foowing avaiabe: competent E. coi ac - your bacterium competent your bacterium DNA of pasmid pugh, which contains an origin of repication recognized by E. coi but not by your bacterium and a transposon Tn5 which encodes sm R pasmid p108 restriction enzymes and a other necessary enzymes and sma moecues and buffers X-ga the toxic chemica minima medium compex medium a of the chemicas, etc. isted on page wheat pants and medium in which to grow them _ phage mice 7. (9 points)you find a bacterium which can grow on a toxic chemica (using it as a carbon source) in the soi at a superfund site. You are interested to identify the genes required for growth on this chemica and decide to use transposon mutagenesis to identify these genes. Given the foowing things, fi in the banks in a protoco for transposon mutagenesis that wi enabe you to find these genes. Fi in the banks in the protoco beow for isoating transposon mutants of your bacterium which are unabe to grow on the toxic chemica. 1. ntroduce into by (process) 2. Grow the resut on medium containing. 3. To identify mutants which can no onger grow on the toxic chemica do the foowing: 4. n step 2, you are seecting/screening (circe one) for bacteria which carry the transposon 5. n step 3, you seecting/screening (circe one) for the particuar mutants you wish to obtain. 8. (14 points) Your ab partner has the same materias avaiabe in her ab. She decides to use gene coning instead of transposon mutagenesis to try to find the genes required for growth on the toxic chemica. Fi in the missing steps in her protoco.

8 1. 1. soate from and digest it with. Do a partia or compete (circe one) digest. 2. soate from and digest it with. Do a partia or compete (circe one) digest. 3. Mix the products of #s 1 and 2 and add (enzyme). 4. the product of # 3 into (ces). 5. Pate the resuting ces on medium containing. Keep the coonies. These coonies contain the genes required for growth on the toxic chemica.

9 9. (11 points) You are doing a survey of various strains of a bacterium which can produce a toxin. You wish to determine which isoated carry the toxin gene. For this purpose you decide to use pcr. You have sequenced the toxin gene from strain 1. The partia sequence is shown beow: 5'ATGCCGTGGCAGGACTTCGC...GTGCAGCGATTGCGCATTGCC 3' 3' TACGGCACCGTCCTGAAGCG...CACGTCGCTAACGCGTAACGG 5' The dots represent the midde of the gene. Given the foowing materias fi the protoco shown for obtaining the DNA encoding the gene by pcr from your various strains. oigonuceotide 1 5'ATGCCGTGGCAGGACTTCGC 3' oigonuceotide 2 5' GTGCAGCGATTGCGCATTGCC 3' oigonuceotide 3 3' TACGGCACCGTCCTGAAGCG 5' oigonuceotide 4 3' CACGTCGCTAACGCGTAACGG 5' your strains of bacteria igase competent E. coi ATP GTP E. coi DNA poymerase Thermobacterium aquaticus DNA poymerase datp,dctp, dgtp, dttp ATP, GTP, CTP, UTP buffers, etc. a heating bock with a programabe temperature contro 1. Extract and purify from. 2. Add to the purified materia the foowing :. 3. Program the heating bock to repeat the foowing cyce about 30 times: and incubate your reactions in the heat bock.

10 You now have your pcr products and decide to anayze them using ge eectrophoresis. You obtain the foowing resuts: strai n - + Where the represent the we where the sampe was appied to the ge and represents the stained DNA band observed. Remember that strain 1 was the strain from which the DNA sequence was obtained. What can you say about the toxin gene in strains 2, 3, 7, and 8? What can you say about the toxin gene in strain 4? What can you say about the toxin gene in strain 5? What can you say about the toxin gene in strain 6?

HOUR EXAM II BIOLOGY 422 FALL, In the spirit of the honor code, I pledge that I have neither given nor received help on this exam.

HOUR EXAM II BIOLOGY 422 FALL, In the spirit of the honor code, I pledge that I have neither given nor received help on this exam. Name First Last (Please Print) PID Number - HOUR EXAM II BIOLOGY 422 FALL, 2010 In the spirit of the honor code, I pledge that I have neither given nor received help on this exam. 1 Signature 2 3 4 5 6

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How

More information

The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally.

The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally. Name Microbial Genetics, BIO 410/510 2008 Exam II The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally. 1.) Indicate where replication

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

The Fertility Factor, or F

The Fertility Factor, or F The Fertility Factor, or F Pili Contains pili genes, tra genes, replication genes, but no genes essential for cell survival or growth. Chromosome F factor 100,000 bp Closely related R factor contains multiply

More information

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

The Regulation of Bacterial Gene Expression

The Regulation of Bacterial Gene Expression The Regulation of Bacterial Gene Expression Constitutive genes are expressed at a fixed rate Other genes are expressed only as needed Inducible genes Repressible genes Catabolite repression Pre-transcriptional

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

The Transition to Life!

The Transition to Life! The Transition to Life The Transition to Life Chemical Evolution Biological Evolution? Interacting Chemical Reproduction of Organisms Natural Selection Based on Simplest Life Now: Need: 1. Nucleic Acids

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,

Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

Viruses and Bacteria Notes

Viruses and Bacteria Notes Viruses and Bacteria Notes A. Virus Structure: Viruses are in contrast to bacteria. Viruses are (DNA or RNA) enclosed in a coat called a. Also some viruses have a that helps them infect their host. These

More information

DO NOT OPEN UNTIL TOLD TO START

DO NOT OPEN UNTIL TOLD TO START DO NOT OPEN UNTIL TOLD TO START BIO 312, Section 1, Spring 2011 February 21, 2011 Exam 1 Name (print neatly) Instructor 7 digit student ID INSTRUCTIONS: 1. There are 11 pages to the exam. Make sure you

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

Gene Expression REVIEW Packet

Gene Expression REVIEW Packet Name Pd. # Gene Expression REVIEW Packet 1. Fill-in-the-blank General Summary Transcription & the Big picture Like, ribonucleic acid (RNA) is a acid a molecule made of nucleotides linked together. RNA

More information

Biology (Microbiology): Exam #3

Biology (Microbiology): Exam #3 NAME: PLEDGE: Biology 50-384 (Microbiology): Exam #3 1. You have isolated a series of mutants that have altered patterns of ß-galactosidase and lactose permease activity (i.e. they are different that the

More information

7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided.

7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided. 7.014 Quiz II 3/18/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. heck that you

More information

BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005

BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005 BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005 Lab Exercise 7 Drosophila crosses, three weeks Vocabulary: phenotype, genotype, gene, allele, locus (loci), sex chromosomes, autosomes, homozygous,

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

Eukaryotic Gene Structure

Eukaryotic Gene Structure Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

7.02/ Genetics Exam Study Questions Spring The exam will be: Thursday, April 27 th, :05-11:55 AM Walker Gym, 3 rd floor (50-340)

7.02/ Genetics Exam Study Questions Spring The exam will be: Thursday, April 27 th, :05-11:55 AM Walker Gym, 3 rd floor (50-340) 7.02/10.702 Genetics Exam Study Questions Spring 2006 Annoucements: The exam will be: Thursday, April 27 th, 2006 11:05-11:55 AM Walker Gym, 3 rd floor (50-340) Please note that these practice questions

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-

36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic

More information

number Done by Corrected by Doctor Hamed Al Zoubi

number Done by Corrected by Doctor Hamed Al Zoubi number 3 Done by Neda a Baniata Corrected by Waseem Abu Obeida Doctor Hamed Al Zoubi Note: it is important to refer to slides. Bacterial genetics *The main concepts we will talk about in this lecture:

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein? Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

Transcription and Translation

Transcription and Translation Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism

More information

AP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET

AP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET AP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of heat-killed

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

encodes a sigma factor to modify the recognition of the E.coli RNA polymerase (Several other answers would also be acceptable for each phage)

encodes a sigma factor to modify the recognition of the E.coli RNA polymerase (Several other answers would also be acceptable for each phage) Name Student ID# Bacterial Genetics, BIO 4443/6443 Spring Semester 2001 Final Exam 1.) Different bacteriophage utilize different mechanisms to ensure that their own genes (and not host s genes) are transcribed

More information

Gene Expression. Student:

Gene Expression. Student: Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the

More information

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming

More information

Viruses 11/30/2015. Chapter 19. Key Concepts in Chapter 19

Viruses 11/30/2015. Chapter 19. Key Concepts in Chapter 19 Chapter 19 Viruses Dr. Wendy Sera Houston Community College Biology 1406 Key Concepts in Chapter 19 1. A virus consists of a nucleic acid surrounded by a protein coat. 2. Viruses replicate only in host

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Solutions to Quiz II

Solutions to Quiz II MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1

More information

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

2. From the first paragraph in this section, find three ways in which RNA differs from DNA. Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

7.014 Quiz III 4/22/05. Write your name on this page and your initials on all the other pages in the space provided.

7.014 Quiz III 4/22/05. Write your name on this page and your initials on all the other pages in the space provided. 7.014 Quiz III 4/22/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. Check that you

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

1. What is the structure and function of DNA? Describe in words or a drawing the structure of a DNA molecule. Be as detailed as possible.

1. What is the structure and function of DNA? Describe in words or a drawing the structure of a DNA molecule. Be as detailed as possible. INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment, insulin. You also learned that the best way to

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

The Mosaic Nature of Genomes

The Mosaic Nature of Genomes The Mosaic Nature of Genomes n DNA sequence is not static Mutations of single bases Large deletions Large insertions of sequence n Transferred from other species n New functions useful in particular situations

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

2012 GENERAL [5 points]

2012 GENERAL [5 points] GENERAL [5 points] 2012 Mark all processes that are part of the 'standard dogma of molecular' [ ] DNA replication [ ] transcription [ ] translation [ ] reverse transposition [ ] DNA restriction [ ] DNA

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Biotech CTE Practice Take Home Version A

Biotech CTE Practice Take Home Version A Biotech CTE Practice Take Home Version A True/False Indicate whether the statement is true or false. 1. Antibiotics can be used to treat a viral infection. Multiple Choice Identify the choice that best

More information

Chapter 18. Viral Genetics. AP Biology

Chapter 18. Viral Genetics. AP Biology Chapter 18. Viral Genetics AP Biology What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron microscope size smaller than ribosomes ~20 50 nm

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Zool 3200: Cell Biology Exam 2 2/20/15

Zool 3200: Cell Biology Exam 2 2/20/15 Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

O C. 5 th C. 3 rd C. the national health museum

O C. 5 th C. 3 rd C. the national health museum Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

STUDY GUIDE SECTION 10-1 Discovery of DNA

STUDY GUIDE SECTION 10-1 Discovery of DNA STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.

2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule. From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how

More information

Chapter 13 DNA The Genetic Material Replication

Chapter 13 DNA The Genetic Material Replication Chapter 13 DNA The Genetic Material Replication Scientific History The march to understanding that DNA is the genetic material T.H. Morgan (1908) Frederick Griffith (1928) Avery, McCarty & MacLeod (1944)

More information

Zool 3200: Cell Biology Exam 3 3/6/15

Zool 3200: Cell Biology Exam 3 3/6/15 Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function.

Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. HASPI Medical Biology Lab 0 Purpose Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. Background http://mssdbio.weebly.com/uploads/1//7/6/17618/970_orig.jpg

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

Protein Synthesis Making Proteins

Protein Synthesis Making Proteins Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?

More information

Confirming the Phenotypes of E. coli Strains

Confirming the Phenotypes of E. coli Strains Confirming the Phenotypes of E. coli Strains INTRODUCTION Before undertaking any experiments, we need to confirm that the phenotypes of the E. coli strains we intend to use in the planned experiments correspond

More information

Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 19 Viruses PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Exam 2 BIO200, Winter 2012

Exam 2 BIO200, Winter 2012 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Molecular Scissors: Lambda Digest Student Materials

Molecular Scissors: Lambda Digest Student Materials Molecular Scissors: Lambda Digest Student Materials Introduction 2 Pre-Lab Questions. 5 Lab Protocol 6 Data Collection Worksheet. 9 Post-Lab Questions and Analysis.. 10 Plasmid Maps. 13 Last updated: August

More information

Assembling Protein Molecules

Assembling Protein Molecules How Does Dna Provide Instructions For Assembling Protein Molecules What does the information in DNA molecules provide instructions for? A. Assembling B. Assembling protein molecules into amino acids. C.

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Protein Synthesis. Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy

Protein Synthesis. Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Protein Synthesis Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy STRUCTURE OF RNA RNA, adenine forms a base pair with

More information

TRANSCRIPTION AND TRANSLATION

TRANSCRIPTION AND TRANSLATION TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.

More information

7.02/ Microbial Genetics Exam Study Questions

7.02/ Microbial Genetics Exam Study Questions MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 7.02/10.702 Microbial Genetics Exam Study Questions These questions adapted from old exam questions--are

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information