Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Size: px
Start display at page:

Download "Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with"

Transcription

1 Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated times at 25 C. The amount of dg generated at each indicated time point is shown, as detected by the absorbance at A260nm.

2 Supplementary Fig. S2. Electrostatic potential surface maps of SAMHD1. (a) Blue indicates positive charge, and red indicates negative charge. The allosteric sites (in three circles) have a high degree of positive charge. (b) and (c) are rotated around the vertical axis by 180 degrees relative to (a). Interestingly, the active site has both positive and negative charge.

3 Supplementary Fig. S3. Topology diagram of SAMHD.1 SAMHD1 contains two additional N-terminal β-sheets (green).

4 a Allosteric site: dgtp-1 b Allosteric site: dgtp-2 Supplementary Fig. S4. Schematic diagram of protein-ligand interactions in the allosteric site. Analyzed by Ligplot 48. Blue bonds represent dntp ligands, and yellow bonds represent the SAMHD1 protein. Hydrogen bonds and coordination bonds are indicated by green dashed lines. Hydrophobic contacts with dntp are shown as yellow semicircles with radiating spokes. N2 of dgtp2 has no interaction with any of the amino acids in the allosteric site and datp can also be tolerated.

5 c Supplementary Fig. S5. Electron density maps for dntps in the allosteric sites at 1.8 Å resolution. Grey: 2Fo Fc densities at +1.5σ level; Red and green: Fo Fc densities at -3σ level and +3σ level, respectively. Green sphere: Mg ion. For Site2, when it is assigned as dgtp(shown in a), red negative Fo-Fc densities are observed at N2 atom. When it is assigned as datp (shown in b), green positive Fo-Fc densities are observed near C2 atom. So Site2 of the allosteric site should be occupied by a mixture of dgtp and datp. (c) A stereo image of a portion of the electron density map for the allosteric site of SAMHD1 (2Fo Fc map contoured at +1.0σ level).

6 Supplementary Fig. S6. Schematic diagram of protein-ligand interactions in the active site. Analyzed by Ligplot. Blue bonds represent a dgtp substrate, and yellow bonds represent SamHD1. H bonds are shown as green dashed lines. Hydrophobic contacts are shown as yellow semicircles with radiating spokes. The H-bond marked by a red star does not exist in the datp substrate.

7 Supplementary Fig. S7. A detailed comparison of active sites from our structure and 3U1N. The regions connecting the active site and the allosteric site are shown in red (aa ) and purple (aa ). 3U1N is in beige.

8 Supplementary Fig. S8. Comparison with 3U1N. (a) The dimer comparison. The 3U1N dimer is shown in beige. The interactions are similar to each other, except for the N-terminal shown in the red circle, which binds to an allosteric site in our structure. The arrow indicates a movement of the C-terminal region. (b and c) Two views of the monomer comparison, rotated by 90. Cyan, blue, and green indicate the three domains of our structure. Beige indicates 3U1N. It shows that the relative position of the N-terminal (cyan and blue) and C-terminal regions is a major difference between the two structures.

9 Supplementary Fig. S9. Effects of SAMHD1 variants on SIVmac Vpx-induced degradation. (a) Immunoblot of SAMHD1 WT and variants in the presence and absence of Vpx. HA-tagged SAMHD1 constructs were co-expressed with Flag-tagged Vpx or empty vector in HEK293T cells. Cell extracts were harvested 48 h later and analyzed by SDS-PAGE, followed by immunoblotting to detect SAMHD1-HA, SAMHD1c -HA, SAMHD1c-HA, and Flag-Vpx. Tubulin was used as the loading control. Vpx-induced degradation of SAMHD1-HA and SAMHD1c -HA was detected (lanes 1-6). In contrast, Vpx-induced degradation of SAMHD1c-HA was not detected (lanes 7-9). (b) The bar graph shows the percentages of the relative band intensities for SAMHD1 in the presence of Vpx vs. in the absence of Vpx (set to 100%). The error bars indicate the S.D. of five independent experiments.

10 Supplementary Fig. S10. Modulation of human LINE-1 retrotransposition by SAMHD1 tetramer. (a) Schematic of 99 PUR RPS EGFP (LINE-1) and JM111 EGFP (JM111), which have been previously described. The 99 PUR RPS EGFP contains combined promoters from both CMV and the 5 -UTR of the LINE-1. An antisense cassette of EGFP containing an inserted intron sequence was cloned near the 3' end of the L1 3' UTR. JM111 contains a double mutation of R261A/R262A in ORF1, which has been determined to abolish the retrotransposition activity of LINE- 1. (b). Representative flow chart of LINE-1 retrotransposition assay. The negative control JM111, containing mutations in ORF1, gave few GFP-positive cells and was used for flow cytometry gating. VR1012 was the empty vector used for SAMHD1 expression. SAMHD1-expressing plasmids (SAMHD1c, SAMHD1c D137A, or SAMHD1c) were co-transfected with LINE-1 into HEK293T cells. GFP-positive cells were determined by flow cytometry 5 days after transfection. (c) Tetramer formation of SAMHD1 is required for LINE-1 inhibition. Plasmids expressing SAMHD1c, SAMHD1c D137A, or SAMHD1c were co-transfected with LINE-1 into HEK293T cells. VR1012 was used as negative control for SAMHD1 expression,

11 while JM111 as negative control for LINE-1. EGFP-positive cells were determined by flow cytometry 5 days after transfection. All the data in this figure are representative of at least three independent experiments. The error bars indicated the S.D. of three replicates within one experiment. Student s t test was performed with Microsoft Excel to calculate p-values.

12 Supplementary Fig. S11. Modulation of mouse LINE-1 retrotransposition by SAMHD1 variants. (a) Schematics of the synthetic mouse LINE-1 construct used in this study. The mouse LINE-1 construct is based on native murine LINE-1 sequence, with theorf1p and ORF2p coding region optimized for expression in human cells. Also, it lacks part of the 3'-UTR sequence, which is replaced with a SV40pA signal. (b) SAMHD1c' has a higher potency against murine LINE-1 than does SAMHD1c. The negative control JM111, containing mutations in ORF1, showed few GFP-positive cells and was used for flow cytometry gating. VR1012 was the empty vector used for SAMHD1 expression. SAMHD1-expressing plasmids (SAMHD1c or SAMHD1c) were co-transfected with LINE-1 into HEK293T cells. GFP-positive cells were determined by flow cytometry 5 days after transfection. The expression of HA-tagged SAMHD1-related proteins was examined by immunoblot analysis using an anti-ha antibody. Tubulin was used as the cellular protein loading control. All the data in this figure are representative of at least three independent experiments. The error bars indicated the S.D. of three replicates within one experiment. Student s t test was performed with Microsoft Excel to calculate p-

13 values. (c) Representative flow cytometry data.

14 Supplementary Fig. S12. A representation of the mutations found in AGS patients. Labeled residues in sticks and red color indicate the AGS-related mutations.

15 Supplementary Fig. S13: Full scan for western blotting result shown in Supplementary Figure S9a.

16 Supplementary Fig. S13 (cont.). Full scan for western blotting result shown in Supplementary Figure S10c.

17 Supplementary Fig. S13 (cont.). Full scan for western blotting result shown in Supplementary Figure S11b. The lane next to the marker is irrelevant to this study.

18 Supplementary Table S1. Potential impact of AGS-related mutations on SAMHD1 H123P R143H R145Q H167Y I201N/M254V G209S L369S Located in β2 and forms an H bond with D314. D314 also forms an H bond with H167, which is involved in Zn coordination. H123P may affect Zn binding in the active site and β2 structure in the allosteric site. R143H mutation loses interaction with H210 and affects amino acid interactions in the active site. Furthermore, R143 is next to Q142 and R145, which are important for dgtp binding. R143H may affect allosteric site function. R145 directly binds dgtp in the allosteric site. H167 coordinates Zn in the active site, and mutation may affect protein folding. I201 is close to H206 and D207, which are important for Zn coordination. I201 also faces M254, which is in a hydrophobic pocket. I201N and M254V may affect protein folding. Next to D207, which is involved in Zn binding. G209S would affect D207 and Zn binding and the active site structure because of its longer side chain. L369 is located between the active site and allosteric site. L369S will create an interaction with Y374 and affect active site function. M385V M385 is in a hydrophobic pocket created by I444, I448, L453, F454 and supports loop Loop interacts with allosteric site.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Nature Structural and Molecular Biology: doi: /nsmb.2937

Nature Structural and Molecular Biology: doi: /nsmb.2937 Supplementary Figure 1 Multiple sequence alignment of the CtIP N-terminal domain, purified CtIP protein constructs and details of the 2F o F c electron density map of CtIP-NTD. (a) Multiple sequence alignment,

More information

X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction

X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction X-ray structures of fructosyl peptide oxidases revealing residues responsible for gating oxygen access in the oxidative half reaction Tomohisa Shimasaki 1, Hiromi Yoshida 2, Shigehiro Kamitori 2 & Koji

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Assessment of quaternary structure of soluble RSV F proteins. Soluble variants of F proteins from A2 and B1 RSV strains were expressed in HEK293 cells. The cell culture supernatants

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed

More information

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen

More information

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently

More information

Hmwk # 8 : DNA-Binding Proteins : Part II

Hmwk # 8 : DNA-Binding Proteins : Part II The purpose of this exercise is : Hmwk # 8 : DNA-Binding Proteins : Part II 1). to examine the case of a tandem head-to-tail homodimer binding to DNA 2). to view a Zn finger motif 3). to consider the case

More information

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation 1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura

More information

Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna

Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna

More information

Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a

Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a HNH-state 1 in PDB 4OO8, in which the distance from the C atom of the HNH catalytic residue 840 to the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors

RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors Supplementary Information RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors Pablo Perez-Pinera 1, Daniel D. Kocak 1, Christopher M. Vockley 2,3, Andrew F. Adler 1, Ami M. Kabadi 1,

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

over time using live cell microscopy. The time post infection is indicated in the lower left corner.

over time using live cell microscopy. The time post infection is indicated in the lower left corner. Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected

More information

Watson BM Gene Capitolo 11 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. ? Le proteine della trasposizione Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A.

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina

More information

Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1

Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1 Bi 8 Lecture 7 PROTEIN STRUCTURE, Functional analysis, and evolution Ellen Rothenberg 26 January 2016 Reading: Ch. 3, pp. 109-134; panel 3-1 (end with free amine) aromatic, hydrophobic small, hydrophilic

More information

ENZYMES. Unit 3 - Energy

ENZYMES. Unit 3 - Energy ENZYMES Unit 3 - Energy What is an enzyme? What do they do? What is an enzyme? What do they do? Key Things to remember: They are proteins They are catalysts They are reusable - not consumed in reaction

More information

Protocol S1: Supporting Information

Protocol S1: Supporting Information Protocol S1: Supporting Information Basis for the specificity of the kinase domain of Abl for peptide substrates The crystal structures reported in this work were obtained using two different ATP analog-peptide

More information

Sam68 STARR Sam68 QUA1- KH. p(r ) [Å] [Å] TSTAR STAR. Sam68 QUA1-KH and. constructs are

Sam68 STARR Sam68 QUA1- KH. p(r ) [Å] [Å] TSTAR STAR. Sam68 QUA1-KH and. constructs are a b Sam68 STARR Sam68 QUA1- KH c d e ) p(r p(r ) r [Å] r [Å] Supplementary Figure 1: The QUA2 domain is not involved in i the overall conformation of the STAR domain (a) Overlay of T-STAR QUA1-KH in complex

More information

3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors

3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors 3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

Paul Bowyer. (Baker Lab, London School of Hygiene and Tropical Medicine)

Paul Bowyer. (Baker Lab, London School of Hygiene and Tropical Medicine) Evaluation of selective inhibitors of the malarial cyclic GMP dependent protein kinase (PKG) Paul Bowyer (Baker Lab, London School of Hygiene and Tropical Medicine) Talk summary An overview of the P. falciparum

More information

Regulation of gene expression. (Lehninger pg )

Regulation of gene expression. (Lehninger pg ) Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Gene Expression - Transcription

Gene Expression - Transcription DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making

More information

Applications of HTRF and Tag-lite Assays for HTP Antibody Screening

Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Brigitte Devaux, PhD Bristol Myers Squibb, Redwood City CA HTRF Symposium April 25, 2013 1 Introduction Generate human therapeutic antibodies

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,

More information

Electrophoresis and transfer

Electrophoresis and transfer Electrophoresis and transfer Electrophoresis Cation = positively charged ion, it moves toward the cathode (-) Anion = negatively charged ion, it moves toward the anode (+) Amphoteric substance = can have

More information

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide Protein name and full primary structure, by providing a NCBI (or UniProt) accession

More information

Vectors for Gene Cloning: Plasmids and Bacteriophages

Vectors for Gene Cloning: Plasmids and Bacteriophages Vectors for Gene Cloning: Plasmids and Bacteriophages DNA molecule must be able to replicate within the host cell to be able to act as a vector for gene cloning, so that numerous copies of the recombinant

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Quantitative analysis of recombination in YFP and CFP gene of FRET biosensor induced by lentiviral or retroviral gene transfer.

Quantitative analysis of recombination in YFP and CFP gene of FRET biosensor induced by lentiviral or retroviral gene transfer. Supplementary Information: Quantitative analysis of recombination in and gene of FRET biosensor induced by lentiviral or retroviral gene transfer. Akira T. Komatsubara, Michiyuki Matsuda,, and Kazuhiro

More information

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

Human IL10RB ELISA Pair Set ( CRFB4 )

Human IL10RB ELISA Pair Set ( CRFB4 ) Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Validation of RaPID with EDEN15

Nature Methods: doi: /nmeth Supplementary Figure 1. Validation of RaPID with EDEN15 Supplementary Figure 1 Validation of RaPID with EDEN15 (a) Full Western Blot of conventional biotinylated RNA pulldown with EDEN15 and scrambled control (n=3 biologically independent experiments, representative

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

SUPPLEMENTAL MATERIALS

SUPPLEMENTAL MATERIALS SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

Ensemble refinement shows conformational flexibility in crystal structures of human complement factor D

Ensemble refinement shows conformational flexibility in crystal structures of human complement factor D Supplementary Information for Ensemble refinement shows conformational flexibility in crystal structures of human complement factor D Federico Forneris a,b, B. Tom Burnley a,b,c and Piet Gros a * a Crystal

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions www.iba-biotagnology.com Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions Strep-tag and One-STrEP-tag PPI Analysis with the co-precipitation/ mass spectrometry approach 3 Background

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

A novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression

A novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression Xi et al. Genome Biology (2015) 16:231 DOI 10.1186/s13059-015-0791-1 RESEARCH A novel two-step genome editing strategy with CRISPR-Cas9 provides new insights into telomerase action and TERT gene expression

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

ENCODE RBP Antibody Characterization Guidelines

ENCODE RBP Antibody Characterization Guidelines ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document

More information

5 ZFHD sites in variable distances to transcription start site (Fig. S2) pmrlucf luciferase reniformis for Gal4 yeast pmrlucfpa 12Galn

5 ZFHD sites in variable distances to transcription start site (Fig. S2) pmrlucf luciferase reniformis for Gal4 yeast pmrlucfpa 12Galn protein origin reference region (aa) construct comment Gal4 yeast -47 pmcgal4-47 pmcrluc-gal4-65 fusion of Rluc, Gal4(-47) and AD of artificial (0) pmczf s fused C-terminally to with 3x myc linker (EQKLISEEDLNG)

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

****** Competition ELISA Kit Instruction

****** Competition ELISA Kit Instruction FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC PURPOSES ****** Competition ELISA Kit Instruction Kit name and catalog number Your analyte ELISA Kit, Catalog#: ***** Intended use The kit is used to detect the

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Supplementary materials. Computational study of β-n-acetylhexosaminidase from. Talaromyces flavus, a glycosidase with high substrate flexibility

Supplementary materials. Computational study of β-n-acetylhexosaminidase from. Talaromyces flavus, a glycosidase with high substrate flexibility Supplementary materials Computational study of β-n-acetylhexosaminidase from Talaromyces flavus, a glycosidase with high substrate flexibility Natallia Kulik 1,*, Kristýna Slámová 2, Rüdiger Ettrich 1,3,

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

Supplemental Material for Xue et al. List. Supplemental Figure legends. Figure S1. Related to Figure 1. Figure S2. Related to Figure 3

Supplemental Material for Xue et al. List. Supplemental Figure legends. Figure S1. Related to Figure 1. Figure S2. Related to Figure 3 Supplemental Material for Xue et al List Supplemental Figure legends Figure S1. Related to Figure 1 Figure S. Related to Figure 3 Figure S3. Related to Figure 4 Figure S4. Related to Figure 4 Figure S5.

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

Supplemental Data. Aung et al. (2011). Plant Cell /tpc

Supplemental Data. Aung et al. (2011). Plant Cell /tpc 35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco

More information

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

More information

Final exam. Please write your name on the exam and keep an ID card ready.

Final exam. Please write your name on the exam and keep an ID card ready. Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,

More information

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of

More information

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the

More information

Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with

Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with transcription buffer with or without a high salt concentration

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of

More information

Supplemental Information. Natural RNA Polymerase Aptamers. Regulate Transcription in E. coli

Supplemental Information. Natural RNA Polymerase Aptamers. Regulate Transcription in E. coli Molecular Cell, Volume 67 Supplemental Information Natural RNA Polymerase Aptamers Regulate Transcription in E. coli Nadezda Sedlyarova, Philipp Rescheneder, Andrés Magán, Niko Popitsch, Natascha Rziha,

More information

Biophysical characterization of proteinprotein

Biophysical characterization of proteinprotein Biophysical characterization of proteinprotein interactions Rob Meijers EMBL Hamburg EMBO Global Exchange Lecture Course Hyderabad 2012 Bottom up look at protein-protein interactions Role of hydrogen bonds

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences)

Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) ANTI-FLAG High Sensitivity, M2 coated 96-well plate P 2983 Automation

More information

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated

More information

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK

More information

STRUCTURAL BIOLOGY. α/β structures Closed barrels Open twisted sheets Horseshoe folds

STRUCTURAL BIOLOGY. α/β structures Closed barrels Open twisted sheets Horseshoe folds STRUCTURAL BIOLOGY α/β structures Closed barrels Open twisted sheets Horseshoe folds The α/β domains Most frequent domain structures are α/β domains: A central parallel or mixed β sheet Surrounded by α

More information

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm) I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary

More information

BETA STRAND Prof. Alejandro Hochkoeppler Department of Pharmaceutical Sciences and Biotechnology University of Bologna

BETA STRAND Prof. Alejandro Hochkoeppler Department of Pharmaceutical Sciences and Biotechnology University of Bologna Prof. Alejandro Hochkoeppler Department of Pharmaceutical Sciences and Biotechnology University of Bologna E-mail: a.hochkoeppler@unibo.it C-ter NH and CO groups: right, left, right (plane of the slide)

More information

The mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches

The mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches The mechanism(s) of protein folding What is meant by mechanism Computational approaches Experimental approaches Questions: What events occur and in what time sequence when a protein folds Is there a specified

More information

(Hadlock, Journal of Virology, 2000), (Keck, Journal of Virology, 2008) CBH-5 Domain B 412, 416, 417, 418, 420, 421, 422, 423, 483, 484, 485, 488,

(Hadlock, Journal of Virology, 2000), (Keck, Journal of Virology, 2008) CBH-5 Domain B 412, 416, 417, 418, 420, 421, 422, 423, 483, 484, 485, 488, Supplementary Table. mabs analyzed mab Antigenic Critical Binding Residues by Citations Domains Alanine Scanning 2 CBH-4B Domain A NA (Hadlock, Journal of Virology, 2), (Keck, Journal of Virology, 24)

More information

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac. + NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α

More information

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

Supplementary Figure 2 Diagram of the expression vector pet28a with an individual gene of interest. Nature Methods: doi: /nmeth.

Supplementary Figure 2 Diagram of the expression vector pet28a with an individual gene of interest. Nature Methods: doi: /nmeth. Supplementary Figure 1 Microfluidic chip overview. (a) Photograph of a microfluidic chip bonded to a glass slide with a US dime for scale. Control channels are filled with food dye for better visualization.

More information

Alternative Cleavage and Polyadenylation of RNA

Alternative Cleavage and Polyadenylation of RNA Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related

More information