Aims: -Purification of a specific protein. -Study of protein-protein interactions
|
|
- Cecily Hubbard
- 6 years ago
- Views:
Transcription
1
2 Aims: -Purification of a specific protein -Study of protein-protein interactions
3
4 This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin beads) binds to the Fc portion of IgG (immunoglobulin). The beads are used in a chromatography column or loose in a test tube.
5
6 globalmedicaldiscovery.com
7
8 Pull-down assays: Use strong non-covalent interactions between a protein of interest (bait) and the potential interacting partners (prey proteins).
9 The bait can be expressed in E. coli as a fusion protein. The fusion protein is then immobilized on a solid support or solid particles using an affinity ligand specific for the fusion tag. Other unwanted products from E. coli are washed off. The immobilized bait protein is incubated with the prey protein (in a mixture), and other non-interacting molecules can be rinsed off.
10
11
12
13
14 A common method to generate a fusion protein (bait) is to use GST (glutathione-s transferase) as the fusion tag by expression in E. coli. Fusion at C-terminus of GST. The GST tag interacts very strongly with glutathione (GSH). The fusion protein is then immobilized on agarose particles bearing GSH. Other unwanted products are washed off. The immobilized bait protein is incubated with the prey protein, and non interacting molecules can be rinsed off.
15
16 GSH (γ-glutamylcysteinylglycine)
17 Specific GST approach: membrane-associated proteins
18 Specific GST approach: Use a GST-PDZ fusion protein to pull down membrane associated proteins by affinity from HeLa cells. Expression of GST-PDZ in E. coli and attachment to agarose-glutathione particles; washing. Incubation of particles with HeLa cancer cells to capture interactive proteins. Non interacting proteins rinsed off. Elution of captured proteins and separation by SDS-PAGE. J Proteome Res Sep;5(9):
19
20 Add all proteins from HeLa cells Stir and let equilibrate; centrifuge. Proteins with no affinity for PDZ1 are in the supernatant. Detach proteins of interest from beads using a strong eluent.
21 PDZ affinity proteins on SDS-PAGE ~36 kda Connexin 36?
22 Identification of other proteins pulled down by GST-PDZ Keratin and cytokeratin 8 Trypsin (contaminant) GST-PDZ1 Vimentin Actin Alpha-actinin kda ARN/ADN nuclear binding protein 54 kda Proline/glutamine-rich splicing protein 76 kda Nucleolin 74 kda Beta-tubulin kda Carbonic anhydrase + connexin 36 kda
23 Another common bait used for pulling down proteins: the His 6 -tag The tag may be placed at the N or C terminus: (His) 6 -Protein or Protein-(His) 6
24 His tags have a high affinity for Ni 2+ and Co 2+
25 A mixture of proteins (including the His-tagged fusion protein) is incubated with an affinity resin containing chelated Ni 2+ or Co 2+ Resins are available commercially in different varieties, and are generally sepharose/agarose functionalized with a chelator. Immobilized metal affinity chromatography (IMAC)
26 Chelators: iminodiacetic acid (Ni-IDA) and nitrilotriacetic acid (Ni-NTA) are used for Ni 2+
27 Carboxylmethyl aspartate (Co-CMA) is used for cobalt The resin is then washed with phosphate buffer to remove proteins that do not specifically interact with Ni 2+ or Co 2+ Imidazole in high conc. (200 mm) is then used to detach His-tag proteins.
28 Affinity chromatography is aimed at protein purification, although it can yield the protein of interest plus interacting partners. As opposed to chromatography, affinity pulldown methods are often aimed at studying protein-protein interactions rather than purification. GST tags are quite bulky and can significantly change the properties of the bait protein to which they are fused. His tags are much smaller and in most cases do not change the bait protein s properties. Affinity and pulldown methods are usually followed by SDS- PAGE.
Lecture 8: Affinity Chromatography-III
Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The
More informationProduct. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin
Novagen offers a large variety of affinity supports and kits for the purification of recombinant proteins containing popular peptide fusion tags, including His Tag, GST Tag, S Tag and T7 Tag sequences.
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography
More informationTechnical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
More informationKinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
More informationPROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)
1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of
More informationNickel-NTA Agarose Suspension
Nickel-NTA Agarose Suspension Agarose beads for purification of His-tagged proteins Product No. A9735 Description Nickel-NTA Agarose Suspension is an agarose-based affinity chromatography resin allowing
More informationINSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing.
1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE Nickel NTA Agarose Beads DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous
More informationPurification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki
Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric
More informationGST Fusion Protein Purification Kit
Glutathione Resin GST Fusion Protein Purification Kit Cat. No. L00206 Cat. No. L00207 Technical Manual No. TM0185 Version 01042012 Index 1. Product Description 2. Related Products 3. Purification Procedure
More informationAFFINITY HIS-TAG PURIFICATION
DESCRIPTION Nickel NTA Agarose Cartridges 5ml are used for purification of histidine-tagged proteins in native or denaturing conditions. This cartridge can be used with an automated chromatography system,
More informationAFFINITY HIS-TAG PURIFICATION
DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted
More informationAFFINITY HIS-TAG PURIFICATION
DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted
More informationIMMUNOPRECIPITATION TROUBLESHOOTING TIPS
IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds
More informationNi-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650)
Ni-NTA Agarose User Manual 320 Harbor Way South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 871-8796 www. Contents Introduction -----------------------------------------------------------------------
More information1 ml gel corresponds to ml of 75% (v/v) Glutathione Agarose suspension.
1 AFFINITY GST PURIFICATION Procedure for Use Glutathione Agarose 4 Resin DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding
More informationNewsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions
www.iba-biotagnology.com Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions Strep-tag and One-STrEP-tag PPI Analysis with the co-precipitation/ mass spectrometry approach 3 Background
More informationAFFINITY HIS-TAG PURIFICATION
DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 20% ethanol. INSTRUCTIONS The resins are adapted to work mainly in native conditions
More informationAFFINITY GST PURIFICATION
DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding proteins. are products that allow batch or column purifications. Purification
More informationMagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study
MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationStrep-Tactin XT Spin Column
Strep-Tactin XT Spin Column Purification Protocol Last date of revision Last June date 2017 of revision June 2017 Version PR90-0001 Version PR90-0001 For research use only Important licensing information
More informationSUMOstar Gene Fusion Technology
Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com
More informationSmall-Molecule Drug Target Identification/Deconvolution Technologies
Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily
More informationAmintra Affinity Resins
Amintra Affinity Resins Ni-NTA Metal Chelate Affinity Resin Technical Data and Instruction Manual info@expedeon.com 2 TABLE OF CONTENTS TABLE OF CONTENTS 3 Introduction 4 Storage 4 Chemical compatibility
More informationI Introduction II Product Description III Immobilized Metal Ion Affinity Chromatography (IMAC)... 4
A M E R S H A M B I O S C I E N C E S Chelating Sepharose Fast Flow INSTRUCTIONS Table of contents Page I Introduction.......................................... 2 II Product Description.....................................
More informationRhinophase -AB, Zirconia-based Monoclonal Antibody Purification System
Rhinophase -AB, Zirconia-based Monoclonal Antibody Purification System Welcome to the sixth issue of ZirChrom's electronic newsletter. This newsletter introduces a biocompatible stationary phase useful
More informationBio-Scale Mini Nuvia IMAC Ni-Charged Cartridges, 1 and 5 ml
Bio-Scale Mini Nuvia IMAC Ni-Charged Cartridges, 1 and 5 ml Instruction Manual Catalog numbers 780-0811 780-0812 Table of Contents Section 1 Introduction... 1 Section 2 Product Information... 2 Section
More informationab Antibody Serum Purification Kit (Protein A) Protocol
ab109209 Antibody Serum Purification Kit (Protein A) Protocol For preparing antibodies for conjugation The components of Ab109209 are fully compatible with our Conjugation kits however they are not compatible
More informationProtein Purification. igem TU/e 2016 Biomedical Engineering
igem TU/e 2016 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +1 50 247 55 59 2016.igem.org/Team:TU-Eindhoven Protein
More informationRapid GST Inclusion Body Solubilization and Renaturation Kit
Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His
More informationThermo Scientific Pierce FPLC Purification
3 E A 28 25 2 15 1 5 Thermo Scientific Pierce FPLC Purification. 1. 2. 3. 4. Table of Contents Introduction FPLC Cartridge Overview 1 Product Introduction 1 Highlights Thermo Scientific Products 1 2-3
More information1. Bloomsbury BBSRC Centre for Structural Biology, Birkbeck College and University College London.
Purification/Polishing of His-tagged proteins - Application of Centrifugal Vivapure Ion-exchange Membrane Devices to the Purification/Polishing of Histagged Background Multi-milligram quantities of highly
More informationSelective Profinity IMAC Resins Provide Ultrahigh-Purity Recombinant His-Tagged Proteins
PROTEIN PURIFICATION Profinity IMAC Resins Unique open pore structure facilitates purification of large MW proteins and protein-protein interaction studies Excellent purity of target proteins Stability
More informationAntibody Purification Guide
Guide Innova Biosciences Guide Innova Biosciences Ltd. Babraham Research Campus, Cambridge, UK, CB22 3AT +44 (0)1223 661000 info@innovabiosciences.com Guide 2 Innova Biosciences specializes in easy to
More informationProtein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra
GE Healthcare Data file 28-9768-1 AA Protein sample preparation Protein A Mag Sepharose Xtra Xtra products are magnetic beads designed for efficient, high capacity small-scale purification/screening of
More informationPurification of His-tag proteins
Purification of His-tag proteins User manual Protino Ni-TED 150 Packed Columns Protino Ni-TED 1000 Packed Columns Protino Ni-TED 2000 Packed Columns Protino Ni-TED Resin July 2017 / Rev. 07 www.mn-net.com
More informationProtein Purification. Handbook & Selection Guide. G-Biosciences
G-Biosciences Protein Purification Handbook & Selection Guide G-Biosciences 1-800-628-7730 www.gbiosciences.com Protein Estimation Assays Apoptosis Assays Cytotoxicity Assays SAM Methyltransferase Assays
More informationFastPure Spin Columns (Mini and Midi)
G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name FastPure Spin Columns (Mini and Midi) (Cat. # 786-1088, 786-1089, 786-1090, 786-1091) think
More informationProtein Techniques 1 APPENDIX TO CHAPTER 5
Protein Techniques 1 APPENDIX T CHAPTER 5 Dialysis and Ultrafiltration If a solution of protein is separated from a bathing solution by a semipermeable membrane, small molecules and ions can pass through
More informationDenis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov
NEW AFFINITY SORBENTS FOR PURIFICATION OF RECOMBINANT PROTEINS WITH THE USE OF CHITIN-BINDING DOMAIN AS AN AFFINITY TAG Denis V. Kurek, Sergey A. Lopatin, *Vladimir E. Tikhonov, Valery P. Varlamov Centre
More informationAffinity Chromatography. Teaching Kit Manual. GeNei TM. Cat No. New Cat No. KT Revision No.:
Affinity Chromatography Teaching Kit Manual Cat No. New Cat No. KT41 106192 Revision No.: 00010905 CONTENTS Page No. Objective 3 Principle 3 Kit Description 4 Materials Provided 6 Procedure 7 Result 12
More informationAutomated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter)
Automated Protocol for High-throughput Recombinant Protein Purification Using the Biomek FX (Beckman Coulter) HIS-Select HF Nickel Affinity Gel Catalog Number H0537 Automation Guide 2 I. Description 2
More informationStrep-Tactin Spin Column Purification Protocol
Strep-Tactin Spin Column Purification Protocol Last date of revision February 2008 Version PR10-0005 IBA Headquarters IBA GmbH Rudolf-Wissell-Str. 28 D-37079 Göttingen Germany Tel: +49 (0) 551-50672-0
More informationAffi-Gel Protein A MAPS II Kit Instruction Manual
Affi-Gel Protein A MAPS II Kit Instruction Manual Catalog Number 153-6159 For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800-4BIORAD (1-800-424-6723) Table of Contents Introduction...1
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationab GST tag ELISA Kit
ab126581 GST tag ELISA Kit Instructions for Use For the quantitative measurement of the GST tag protein expression. This product is for research use only and is not intended for diagnostic use. Version
More informationBio-Scale Mini Profinity IMAC Cartridges, 1 and 5 ml. Instruction Manual. Catalog #
Bio-Scale Mini Profinity IMAC Cartridges, 1 and 5 ml Instruction Manual Catalog # 732-4610 732-4612 732-4614 Table of Contents Section 1...Introduction...1 Section 2 Product Information...2 Section 3 Connection
More informationRho activation kit. Catalog Number: ADI-EKS-465. Table of Contents
Rho activation kit Catalog Number: ADI-EKS-465 Table of Contents Assay Design Page 1 Scientific Overview 2 Precautions 2 Materials Provided 3 Storage of Materials 3 Materials Required but Not Provided
More informationRas activation kit. Catalog Number: ADI-EKS-460. Table of Contents
Ras activation kit Catalog Number: ADI-EKS-460 Table of Contents Assay Design Page 1 Scientific Overview 1 Precautions 1 Materials Provided 2 Storage of Materials 2 Materials Required but Not Provided
More informationMBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications
MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein
More informationAnnouncements. Next week s discussion will have a quiz on Chapter 3fg and Chapter 11ab Computer Lab (Chapter 11ab): 10/17 10/22
Announcements Next week s discussion will have a quiz on Chapter 3fg and Chapter 11ab Computer Lab (Chapter 11ab): 10/17 10/22 SCI 162 will be open for 2 hours of each lab section to finish Chapter 3 Chapters
More informationProtein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra
GE Healthcare Instructions 28-9670-57 AA Mag Sepharose Protein A Mag Sepharose Xtra Protein G Mag Sepharose Xtra Protein A Mag Sepharose Xtra and Protein G Mag Sepharose Xtra are available in the following
More informationAmicon Pro Affinity Concentration Kit - GST
Amicon Pro Affinity Concentration Kit - GST Purification of GST-tagged recombinant proteins. Catalog Nos. ACR5000GS, ACK5003GS, ACK5010GS, ACK5030GS, ACK5050GS, ACK5100GS FOR RESEARCH USE ONLY Not for
More informationNext Generation Zirconia-Based Antibody Purification Media
Next Generation Zirconia-Based Antibody Purification Media Dr. Clayton McNeff, Dwight Stoll, Danielle Hawker (ZirChrom), Dr. Andy Clausen (Merck) Dr. Peter W. Carr and Dr. Anuradha Subramanian (U of MN)
More informationHiTrap convenient protein purification
GE Healthcare Life Sciences HiTrap convenient protein purification Column Guide Ion Exchange Chromatography (IEX) IEX separates proteins with differences in charge. The separation is based on the reversible
More informationIntroduction to Protein Purification
Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography
More informationStabilization of a virus-like particle and its application as a nanoreactor at physiological conditions
Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van
More informationAn effective platform for purification of IgM monoclonal antibodies using Hydroxyapatite
An effective platform for purification of IgM monoclonal antibodies using Hydroxyapatite Frank Hensel, Patrys, GmbH Pete Gagnon, Validated Biosystems 5th International Conference on Hydroxyapatite and
More informationThermo Scientific GTPase Research Tools
Thermo Scientific Research Tools Active Pull-Down Assays We offer two different tools to study biology, one for active monitoring and one for global profiling. The Thermo Scientific Pierce Active Pull-Down
More informationNOTE ACRYLAMIDE IS NEUROTOXIN YOU MUST WEAR GLOVES.
GST Purfication and Pulldown Part I Instructor: David Deitcher TA: Kristy Lawton In order to study the function of a protein it is often useful to have that protein purified away from others in the cell.
More information3. Close the bottom end of the column and apply the packing device on top. Pump water through the upper adaptor to remove air.
INSTRUCTIONS FOR USE WorkBeads Protein A Product name Pack size Article number WorkBeads Protein A Bulk Media 1.5 ml 40605001 Bulk Media 5 ml 40605002 Bulk Media 10 ml 40605003 Bulk Media 100 ml 40605004
More informationG Sep Size Exclusion Columns
G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name G Sep Size Exclusion Columns (Cat. # 786 1297, 786 1298, 786 1300, 786 1301, 786 1302, 786
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More information2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11
Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae for PCR-based template generation Cat. No. EGE-2010-15 FOR RESEARCH USE ONLY. NOT INTENDED
More informationStrep-Tactin Spin Column
Strep-Tactin Spin Column Purification Protocol Last date of revision November 2012 Version PR10-0006 www.strep-tag.com For research use only Important licensing information Products featuring Strep-Tactin
More informationApplication Note USD Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent
Application Note USD 241 Purification of Mouse IgM from Cell Culture Supernatant by Cation Exchange Chromatography on CM Ceramic HyperD F Sorbent What this Study Demonstrates T h i s s t u d y o n C a
More informationHiPer Immunoprecipitation Teaching Kit
HiPer Immunoprecipitation Teaching Kit Product Code: HTI016 Number of experiments that can be performed: 5 Duration of Experiment Storage Instructions The kit is stable for 6 months from the date of receipt
More informationImmunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
More informationHiFliQ Ni-NTA FPLC Columns User Guide
HiFliQ Ni-NTA FPLC Columns User Guide Protein Ark s HiFliQ Ni-NTA FPLC columns designed for rapid one-step purification, and ideal for preparative purification and contaminant removal. HiFliQ Ni-NTA FPLC
More informationProtein G HP SpinTrap / Ab Spin Trap
GE Healthcare Life Sciences Protein G HP SpinTrap / Ab Spin Trap Product booklet Codes: 28-9031-34 28-4083-47 Page finder 1. Legal 3 2. Handling 4 2.1. Safety warnings and precautions 4 2.2. Storage 4
More informationSeize X Protein G Immunoprecipitation Kit
INSTRUCTIONS Seize X Protein G Immunoprecipitation Kit 3747 N. Meridian Road P.O. Box 117 Rockford, IL 61105 45210 0936.4 Number Description 45210 Seize X Protein G Immunoprecipitation Kit, contains sufficient
More informationRapid GST Inclusion Body Solubilization and Renaturation Kit
Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His
More informationA Novel Tag System for the Purification and Processing of Fusion-Tagged Proteins
AFFINITY PURIFICATION SYSTEMS Profinity exact Purification Resin A Novel Tag System for the Purification and Processing of Fusion-Tagged Proteins Introduction Research on the structure and function of
More informationProtein A HP SpinTrap
GE Healthcare Protein A HP SpinTrap Product booklet Code: 28-9031-32 Page finder 1. Legal 3 2. Handling 4 2.1. Safety warnings and precautions 4 2.2. Storage 4 2.3 Expiry 4 3. Introduction 5 4. General
More informationab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression
ab128573 GST 6XHis-tag ELISA Kit Instructions for Use For the quantitative measurement of 6XHis-tag protein expression This product is for research use only and is not intended for diagnostic use. 1 Table
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationPresto Soil DNA Extraction Kit
Instruction Manual Ver. 02.23.17 For Research Use Only Presto Soil DNA Extraction Kit Advantages SLD004 (4 Preparation Sample Kit) SLD050 (50 Preparation Kit) SLD100 (100 Preparation Kit) Sample: 250-500
More informationIon Exchange Chromatography. Learning Objectives:
Proteomics Ion Exchange Chromatography Ion Exchange Chromatography Ion exchange chromatography is a purification technique, which involves the separation of the proteins based on the ion exchange property
More informationPurification of alpha-1 antitrypsin using an antibody based affinity chromatography medium
Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium Ulrika Meyer a, Hanna Wlad a, Sven Blokland b, Frank J.M. Detmers b and Henrik Ihre a a GE Healthcare Bio-Sciences
More informationHALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS
HALOLINK ESIN FO POTEIN PULL-DOWN AND ANALYSIS MAJETA UH, PH.D. 1, DAN SIMPSON, PH.D. 1, JACQUI SANKBEIL, M.S. 1, DANETTE HATZELL, PH.D. 1, NATASHA KAASSINA, M.S. 1, NADINE NASSIF, M.S. 1, JAMI ENGLISH,
More informationHisTALON Superflow 1 ml & 5 ml Cartridges
User Manual HisTALON Superflow 1 ml & 5 ml Cartridges User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More informationAbout the Kits...2 Description 2 Components 4 Storage 4. Overview...5. Cell Extract Preparation...5. His Bind Resin Chromatography...
Novagen User Protocol TB054 Rev. F 0106 1 of 16 His Bind Kits Table of Contents About the Kits...2 Description 2 Components 4 Storage 4 Overview...5 Cell Extract Preparation...5 His Bind Resin Chromatography...8
More informationProtein & Antibody. Purification & Detection Tools
Abbkine featured PurKine isolation and purification portfolio with complete antitag antibodies and synthetic peptides to meet and satisfy your most types of protein purification, sample preparation and
More informationPresto Stool DNA Extraction Kit
Instruction Manual Ver. 10.21.17 For Research Use Only Presto Stool DNA Extraction Kit Advantages STLD004 (4 Preparation Sample Kit) STLD050 (50 Preparation Kit) STLD100 (100 Preparation Kit) Sample: 180-200
More informationAbout the Kits... 2 Description 2 Components 3. Overview... 3
Table of Contents About the Kits... 2 Description 2 Components 3 Overview... 3 Cell Extract Preparation... 5 Mechanical disruption method 5 Cell extract preparation using BugBuster reagent 6 Soluble fraction
More informationBIOL 3380 Combined Lab Report T AM W-AM R-AM F-AM T PM W-PM R-PM F-PM
BIOL 3380 Combined Lab Report Name: Younghee Kwon Circle your lab section: T AM W-AM R-AM F-AM T PM W-PM R-PM F-PM Instructor: Dr. Scott Rippel Graduate TA: Nymisha Date: November 9, 2014 Partner: Mauricio
More informationOne-Step Western TM Kit using TMB
Technical Manual No. 0203 Version 03272008 I Description.. 1 II Kit Contents.. 2 III Applications 3 IV Key Features.. 3 V Storage.. 3 VI One-Step Western TM Protocol. 3 VII Examples. 3 VIII Troubleshooting..
More informationGE Healthcare. Affinity Chromatography. Principles and Methods
GE Healthcare Affinity Chromatography Principles and Methods Handbooks from GE Healthcare Protein Purification Handbook 18-1132-29 Gel Filtration Principles and Methods 18-1022-18 Affinity Chromatography
More informationA General Protocol for GST Pull-down Lili Jing *
A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down
More informationrprotein A GraviTrap Protein G GraviTrap rprotein A/Protein G GraviTrap
GE Healthcare Life Sciences Data file 28-9921-04 AA rprotein A GraviTrap Protein G GraviTrap rprotein A/Protein G GraviTrap Protein sample preparation rprotein A GraviTrap, Protein G GraviTrap, and rprotein
More information2. The Principles of Dynabeads
2. The Principles of What Are? 9 How Are Used? 9 Different Types of 10 Surface Activated, Primary and Secondary-Coated 10 Small and Large 10 Different Separation Strategies 11 Positive Isolation: Binding
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationPurification of mfp. from an Overnight Culture. Laboratory 17
Purification of mfp from an Overnight Culture When scientists at a therapeutics company, like Amgen, have successfully identified a promising therapeutic protein, two objectives would be to locate and
More informationTALON Products. For polyhistidine-tagged protein purification
TAL Products For polyhistidine-tagged protein purification Product TAL Metal Affinity Resin Resin ready for loading in columns for small or medium-scale purification of is-tagged proteins. Purify > 5 mg
More informationSMART Digest ImmunoAffinity (IA) Kit User Manual. Version 1
MART Digest ImmunoAffinity (IA) Kit User Manual Version 1 XX21549-EN 0816 Revision A August 2016 MART Digest ImmunoAffinity (IA) Kits Delivering Fast, imple and ighly Reproducible Immunocapture and Digestion
More informationGel Filtration Chromatography. Teaching Kit Manual. GeNei TM. Cat No. New Cat No. KT Revision No.:
Gel Filtration Chromatography Teaching Kit Manual Cat No. New Cat No. KT39 106190 Revision No.: 00130405 CONTENTS Page No. Objective 3 Principle 3 Kit Description 6 Materials Provided 7 Procedure 8 Observation
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationFusion Protein Products. Screen Purify Detect Cleave
Fusion Protein Products Screen Purify Detect Cleave Afusion protein consists of two gene sequences that are ligated together and transcribed as a single molecule. One sequence encodes for a tag, which
More information