Supporting Online Material for

Size: px
Start display at page:

Download "Supporting Online Material for"

Transcription

1 Supporting Online Material for AAV Vector Integration Sites in Mouse Hepatocellular Carcinoma Anthony Donsante, Daniel G. Miller, Yi Li, Carole Vogler, Elizabeth M. Brunt, David W. Russell,* Mark S. Sands* *To whom correspondence should be addressed. (M.S.S.); (D.W.R.) This PDF file includes: Materials and Methods SOM Text Fig. S1 Table S1 References Published 27 July 2007, Science 317, 477 (2007) DOI: /science

2 SUPPLEMENTAL ONLINE MATERIALS Results The altered expression of the snornas and micrornas adjacent to the AAV integration sites could be a generalized phenomenon related to the cell cycle status of the tumor cells rather than a direct result of the integrated provirus. We believe that this is unlikely. There is a region on mouse chromosome 7 that contains >50 identified or predicted snornas and micrornas, which is syntenic with the human locus on chromosome 15 associated with Prader Willi /Angelman Syndrome, and is very similar to the locus containing vector proviruses in our study. These snornas and micrornas are between the ubiquitin-protein-ligase E3A (Ube3a) and the small-nuclearribonucleoprotein-n (Snrpn) genes and are thought to be expressed from a common transcript (Supplemental References 1, 2). Twelve primer sets assayed on the microarrays were present in this locus and none were significantly over expressed (expression levels were 22 to +1.6 fold changed in the tumor samples). The Snrpn transcript that encompasses the snornas and micrornas was changed 3 and 5 fold based on two separate primer sets. Thus there is not a generalized increase in the expression of snornas or micrornas in the tumor samples, and the 10 to >100-fold increased expression of the small RNA-containing transcripts on chromosome 12 can be explained by the presence of cis-acting elements within the integrated proviral sequences. Methods Animals. MPS VII and normal mice were produced by breeding B6.C-H-2 bm1 /ByBirgus mps /+ mice and were identified by GUSB assays and PCR. The transgenic animals are on the same genetic background as the experimental animals and have been described

3 previously. All AAV-treated mice received intravenous injections of 1.5 x genomecontaining particles of AAV-GUSB or AAV-GUSB Prom as described. AAV vector stocks were produced at the University of Florida Powell Gene Therapy Center and were all serotype 2. Mice undergoing bone marrow transplantation received either 5 x 10 6 unfractionated nucleated bone marrow cells with no radiation or 1 x 10 6 unfractionated nucleated bone marrow cells following 200 rads of total body radiation from a 137 Cs source at birth. Five µm-thick H&E-stained sections of liver and tumor samples from each of the 163 total animals were examined by two independent, board-certified pathologists (E.M.B. and C.V.) that were blinded to genotype and treatment. Statistically significant differences in tumor frequency between groups was determined by Fisher s exact test. Helicobacter hepaticus and bilus are known to cause hepatocellular carcinoma in mice. Representative AAV-treated mice (6 with, and 3 without HCC) were negative for H. hepaticus and bilus, as determined by assays performed at Charles River Laboratories (Wilmington, MA) using a fluorogenic PCR-based method. Cloning of junction fragments by inverse PCR. Two µg of genomic DNA purified from each liver tumor was digested with 8 units of Fat I restriction endonuclease (New England Biolabs) at 37 o C for 2 hours. Nucleic acid pellets were resuspended in 355 µl of water, 40 µl of 10X ligase buffer, and 5 µl of T4 DNA ligase (New England Biolabs, Beverly, MA). Ligation reactions were incubated at 15 o C for 18 hours. The ligase reactions were heat-inactivated and brought to 50 mm NaCl. Sixty units of Dpn I restriction endonuclease were added to each tube and reactions were incubated at 37 o C for 2 hours. DNA was resuspended in 5 µl of 10 mm Tris (ph 8.0), 1 mm EDTA and 1 µl was used as template for PCR amplification with oligonucleotides 369-(5 -

4 GCAGTACATCAAGTGTATCATATGCCAA) and 370-(5 - GCTATGAACTAATGACCCCGTAATTGAT). DNA fragments were excised from agarose gels and cloned using the TA cloning vector pgem T-easy (Promega). DNA sequences were obtained from these cloned PCR products. PCR quantification of vector:chromosome junctions. Integration site junctions were quantified in genomic DNA samples using a model 7500 Fast Real-Time PCR machine (Applied Biosystems) and SYBR Green JumpStart Taq ReadyMix (Sigma- Aldrich). A single vector specific primer 406-(5 - CTTGGCATATGATACACTTGATGTACT) was used in combination with primer 408- (5 - ACACAATTCCCTTTAGTTTTCAGAGT) for junctions 1 and 2, primer 413-(5 - CACAGCTCTCCTGGATGACTAAG) for junction 3, and primer 412-(5 - TTGCATTTATTCAGTCTGAGTGTTC) for junction 4. Microarray analysis. RNA was isolated, and cdna was synthesized from tumor and adjacent, normal-appearing liver tissue from animals containing AAV integration sites 1, 3 and 4. The cdna was hybridized to the MU430-2 Gene Chip (Affymetrix, Santa Clara, CA). Expression signals from tumor samples were divided by those from adjacent, normal-appearing tissue to establish fold difference in expression levels. Supplemental References 1. M. Runte et al., Hu Mol Genet 10, 2687 (2001). 2. E. Le Meur et al., Dev Biol 286, 587 (2005).

5 Table 1. Incidence of HCC in AAV-treated mice. Group (treatment and mouse strain) Fraction of all mice with HCC Fraction of mice 13 months old with HCC Age of onset (months) AAV2-BGUS 6/18 6/ ) (p=0.008) MPSVII (p=0 BMT alone MPSVII BMT radiation MPSVII 1/25 1/ /12 0/8 N.A. AAV2-BGUS 9/16 7/13 001) (p=.0005) 9-18 WT (p=.0 AAV2-BGUS Prom WT Untreated WT Untreated Transgenic 2/6 (p=.105) 2/4 (p=.05) /60 4/ /26 0/24 N.A. The p value is a comparison with the combined BMT alone MPSVII and BMT radiation MPSVII groups. The p value is a comparison with the Untreated WT group. N.A.: Not applicable.

6 Supplemental Figure 1. AAV vectors. Maps of the AAV vectors used are shown with viral ITRs, CMV enhancer, chicken β- actin promoter and first intron (β-act), human β-glucuronidase gene (GUSB), and polyadenyation site (pa) indicated. A promoterless version of the AAV2-BGUS vector was also used in this study, which retains the CMV enhancer but lacks the β-actin promoter (AAV2-BGUS Prom).

7 5 -ITR AAV-GUSB 3 -ITR CMV β-act Human GUSB pa AAV-GUSBΔProm CMV Human GUSB pa Supplemental Figure 1. AAV vectors. Maps of the AAV vectors used are shown with viral ITRs, CMV enhancer, chicken β-actin promoter and first intron (β-act), human β-glucuronidase gene (GUSB), and polyadenyation site (pa) indicated. A promoterless version of the AAV2-BGUS vector was also used in this study, which retains the CMV enhancer but lacks the β-actin promoter (AAV2- BGUS Prom).

SUPPLEMENTAL MATERIALS. Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary

SUPPLEMENTAL MATERIALS. Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary SUPPLEMENTAL MATERIALS METHODS Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary and liver cells were prepared from the indicated transgenic mice, as described (Ho et al, 2002).

More information

Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA

Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA Supplementary Table 1: Flurochrome labelled antibody used Marker Antibody Supplier CD3 CD4 CD8 CD25 CD26 CD127 CCR4 CCR7 Ki67 Viability stain Alexa Fluor 700 anti-human CD3 Fluorescein isothiocyanate antihuman

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Supplemental Materials and Methods. Yeast strains. Strain genotypes are listed in Table S1. To generate MATainc::LEU2,

Supplemental Materials and Methods. Yeast strains. Strain genotypes are listed in Table S1. To generate MATainc::LEU2, Supplemental Materials and Methods Yeast strains. Strain genotypes are listed in Table S1. To generate MATainc::LEU2, the LEU2 marker was inserted by PCR-mediated recombination (BRACHMANN et al. 1998)

More information

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit

SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets

More information

Supplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes

Supplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Cell, Volume 135 Supplemental Data Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Andrzej T. Wierzbicki, Jeremy R. Haag, and

More information

scgem Workflow Experimental Design Single cell DNA methylation primer design

scgem Workflow Experimental Design Single cell DNA methylation primer design scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq)

Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Last updated: Oct 28, 2016 Overview First-strand cdna is synthesized using oligo-dt containing primers and an RNA oligo

More information

GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International

GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2*

Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2* Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2* 1 Department of Plant Pathology and Environmental Microbiology, Pennsylvania State University,

More information

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES

BIOTECHNOLOGY : PRINCIPLES AND PROCESSES CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into

More information

Enzymatic assembly of DNA molecules up to several hundred kilobases

Enzymatic assembly of DNA molecules up to several hundred kilobases nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

PV92 PCR Bio Informatics

PV92 PCR Bio Informatics Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure

More information

Ligation Independent Cloning (LIC) Procedure

Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only

User Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only DNA Walking SpeedUp TM Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion/ Insertion/ Isoform Detection User Manual Version

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Percent survival. Supplementary fig. S3 A.

Percent survival. Supplementary fig. S3 A. Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice

More information

NEBNext RNase III RNA Fragmentation Module

NEBNext RNase III RNA Fragmentation Module SAMPLE PREPARATION NEBNext RNase III RNA Fragmentation Module Instruction Manual NEB #E6146S 100 reactions NEBNext RNase III RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

Quality Control Assays

Quality Control Assays QUALITY CONTROL An integral part of the Penn Vector Core is its robust quality control program which is carried out by a separate quality control group. Quality control assays have been developed and optimized

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

MethylAffinity TM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA. Cat.No.MAK-GCM-30 (30 reactions) User Manual

MethylAffinity TM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA. Cat.No.MAK-GCM-30 (30 reactions) User Manual MethylAffinity TM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA Cat.No.MAK-GCM-30 (30 reactions) User Manual GeneCopoeia, Inc. 9620 Medical Center Drive, #101 Rockville,

More information

pbroad3-lacz An optimized vector for mouse and rat transgenesis Catalog # pbroad3-lacz

pbroad3-lacz An optimized vector for mouse and rat transgenesis Catalog # pbroad3-lacz pbroad3-lacz An optimized vector for mouse and rat transgenesis Catalog # pbroad3-lacz For research use only Version # 03B04-MT PRODUCT INFORMATION Content: - 20 µg of pbroad3-lacz provided as lyophilized

More information

BIO 202 Midterm Exam Winter 2007

BIO 202 Midterm Exam Winter 2007 BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive

More information

Genomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes

Genomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes Supplementary information Methods DNA and RNA extraction Genomic DNA was extracted from to ml of blood collected in EDTA blood collection tubes using the Gentra Puregene Blood kit (Qiagen, California,

More information

Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection

Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection Chao Shi, Xiaotong Shen, Shuyan Niu and Cuiping Ma *, Key Laboratory of Sensor Analysis

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*

More information

Supplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line

Supplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line Supplemental Data mrna Protein A kda 75 40 NEO/vector NEO/RNase L RNASE L β-actin RNASE L β-actin B % of control (neo vector), normalized 240 ** 200 160 120 80 40 0 Neo Neo/RNase L RNase L Protein Supplementary

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

AAVpro Titration Kit (for Real Time PCR) Ver.2

AAVpro Titration Kit (for Real Time PCR) Ver.2 Cat. # 6233 For Research Use AAVpro Titration Kit (for Real Time PCR) Ver.2 Product Manual Table of Contents I. Description... 4 II. Components... 6 III. Storage... 6 IV. Materials Required but not Provided...

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Supplemental methods:

Supplemental methods: Supplemental methods: ASC-J9 treatment ASC-J9 was patented by the University of Rochester, the University of North Carolina, and AndroScience Corp., and then licensed to AndroScience Corp. Both the University

More information

of the Triphosphate of ATP

of the Triphosphate of ATP A Small Aptamer with Strong and Specific Recognition of the Triphosphate of Peter L. Sazani, Rosa Larralde and Jack W. Szostak Howard Hughes Medical Institute, and Department of Molecular Biology, Massachusetts

More information

Supplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines.

Supplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines. Supplemental Table S1, page 1 Supplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines. ITEM TO ERXPERIMENTAL DESIGN Definition of experimental

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Supplementary Material. Efficient and scalable serial extraction of DNA and RNA from biobanked tissue samples

Supplementary Material. Efficient and scalable serial extraction of DNA and RNA from biobanked tissue samples Supplementary Material Efficient and scalable serial extraction of DNA and RNA from biobanked tissue samples Lucy Mathot, Monica Lindman and Tobias Sjöblom Department of Genetics and Pathology, Rudbeck

More information

NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE

NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products

More information

Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples

Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,

More information

Mutagenesis and Expression of Mammalian Clotting Factor IX. Mark McCleland The Children s Hospital of Philadelphia and Lycoming College

Mutagenesis and Expression of Mammalian Clotting Factor IX. Mark McCleland The Children s Hospital of Philadelphia and Lycoming College Mutagenesis and Expression of Mammalian Clotting Factor IX Mark McCleland The Children s Hospital of Philadelphia and Lycoming College Hemophilia B X-linked blood clotting disorder characterized by a deficiency

More information

User Manual. Version 5. Published February Catalog No. K1021 ~

User Manual. Version 5. Published February Catalog No. K1021 ~ GeneFishing TM DEG Premix Kit User Manual Version 5 Published February 2005 Catalog No. K1021 ~ 1026 Table of Contents 1. Notices to Customers 1.1 Product Warranty and Liability------------------------------------

More information

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John

More information

NEBNext Ultra Ligation Module

NEBNext Ultra Ligation Module LIBRARY PREPARATION NEBNext Ultra Ligation Module Instruction Manual NEB #E7445S/L 24/96 reactions This product is intended for research purposes only. This product is not intended to be used for therapeutic

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Myofibroblasts in kidney fibrosis. LeBleu et al.

Myofibroblasts in kidney fibrosis. LeBleu et al. Origin and Function of Myofibroblasts in Kidney Fibrosis Valerie S. LeBleu, Gangadhar Taduri, Joyce O Connell, Yingqi Teng, Vesselina G. Cooke, Craig Woda, Hikaru Sugimoto and Raghu Kalluri Supplementary

More information

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio 2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

NEBNext Magnesium RNA Fragmentation Module

NEBNext Magnesium RNA Fragmentation Module SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the

More information

The role of erna in chromatin looping

The role of erna in chromatin looping The role of erna in chromatin looping Introduction Enhancers are cis-acting DNA regulatory elements that activate transcription of target genes 1,2. It is estimated that 400 000 to >1 million alleged enhancers

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr

More information

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste

More information

Pinpoint Slide DNA Isolation System Catalog No. D3001

Pinpoint Slide DNA Isolation System Catalog No. D3001 INSTRUCTIONS Pinpoint Slide DNA Isolation System Catalog No. D3001 Highlights Easily isolates genomic DNA in any targeted microscopic tissue area on a slide. The simple procedure combines Pinpoint tissue

More information

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%

More information

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1 Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7

More information

Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples

Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,

More information

Ampligase Thermostable DNA Ligase

Ampligase Thermostable DNA Ligase Cat. Nos. A0102K, A0110K, A1905B, A3202K, A3210K, A32750, and A8101 www.lucigen.com MA023E-Ampligase Thermostable DNA Ligase 11/2017 1 1. Introduction Ampligase Thermostable DNA Ligase catalyzes the NAD-dependent

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

Methods (detailed). for all the experiments. Cells were grown in 50 ml YEA. The cells were harvested and

Methods (detailed). for all the experiments. Cells were grown in 50 ml YEA. The cells were harvested and Methods (detailed). Purification of yeast chromosomal DNA. Strain JZ105 (mat1m Δmat2,3::LEU2, ade6-210, leu1-32, ura4-d18, his2) was used for all the experiments. Cells were grown in 50 ml YEA. The cells

More information

Research techniques in genetics. Medical genetics, 2017.

Research techniques in genetics. Medical genetics, 2017. Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR

More information

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity

SUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE

FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Uppsala 2001-04-01 REPORT FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Laboratory assistants: Maria Jönsson Amera Gibreel Students: Contents ASSIGNMENT:... 3 INTRODUCTION:... 3 MATERIAL AND

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application

More information

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers Wataru Sakai, Elizabeth M. Swisher, Beth Y. Karlan, Mukesh K. Agarwal, Jake Higgins, Cynthia Friedman, Emily Villegas,

More information

QUICK-Clone TM User Manual. cdna

QUICK-Clone TM User Manual. cdna QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion

Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion SUPPLEMENTARY FIGURE 1. Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion mixture was incubated at 37 C for 0 to 120 minutes. The cutting was nearly complete

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom

More information

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132 Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/318/5851/794/dc1 Supporting Online Material for A Gene Regulatory Network Subcircuit Drives a Dynamic Pattern of Gene Expression Joel Smith, Christina Theodoris, Eric

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost

Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Figure S1. Study of mgtl translation in vitro. (A) Detection of 5 LR RNA using wild-type and anti-sd (91-95) substituted templates in a transcription-translation

More information

Manipulation of Purified DNA

Manipulation of Purified DNA Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA

More information

8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and

8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Supplementary material and methods

Supplementary material and methods Supplementary material and methods raav production and animal experiments The paav-rsvp-gfp-pa vector plasmid contained the Rous Sarcoma Virus promoter (RSVp), followed by a short synthetic intron (pci

More information

Supplementary Protocol: CIRCLE-seq Library Preparation

Supplementary Protocol: CIRCLE-seq Library Preparation Supplementary Protocol: CIRCLE-seq Library Preparation Reagent Gentra Puregene Tissue Kit Qubit dsdna BR Assay Kit Agencourt AMPure XP magnetic beads High throughput, with bead, PCR-free Library Preparation

More information

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information