Supporting Online Material for
|
|
- Sybil York
- 6 years ago
- Views:
Transcription
1 Supporting Online Material for AAV Vector Integration Sites in Mouse Hepatocellular Carcinoma Anthony Donsante, Daniel G. Miller, Yi Li, Carole Vogler, Elizabeth M. Brunt, David W. Russell,* Mark S. Sands* *To whom correspondence should be addressed. (M.S.S.); (D.W.R.) This PDF file includes: Materials and Methods SOM Text Fig. S1 Table S1 References Published 27 July 2007, Science 317, 477 (2007) DOI: /science
2 SUPPLEMENTAL ONLINE MATERIALS Results The altered expression of the snornas and micrornas adjacent to the AAV integration sites could be a generalized phenomenon related to the cell cycle status of the tumor cells rather than a direct result of the integrated provirus. We believe that this is unlikely. There is a region on mouse chromosome 7 that contains >50 identified or predicted snornas and micrornas, which is syntenic with the human locus on chromosome 15 associated with Prader Willi /Angelman Syndrome, and is very similar to the locus containing vector proviruses in our study. These snornas and micrornas are between the ubiquitin-protein-ligase E3A (Ube3a) and the small-nuclearribonucleoprotein-n (Snrpn) genes and are thought to be expressed from a common transcript (Supplemental References 1, 2). Twelve primer sets assayed on the microarrays were present in this locus and none were significantly over expressed (expression levels were 22 to +1.6 fold changed in the tumor samples). The Snrpn transcript that encompasses the snornas and micrornas was changed 3 and 5 fold based on two separate primer sets. Thus there is not a generalized increase in the expression of snornas or micrornas in the tumor samples, and the 10 to >100-fold increased expression of the small RNA-containing transcripts on chromosome 12 can be explained by the presence of cis-acting elements within the integrated proviral sequences. Methods Animals. MPS VII and normal mice were produced by breeding B6.C-H-2 bm1 /ByBirgus mps /+ mice and were identified by GUSB assays and PCR. The transgenic animals are on the same genetic background as the experimental animals and have been described
3 previously. All AAV-treated mice received intravenous injections of 1.5 x genomecontaining particles of AAV-GUSB or AAV-GUSB Prom as described. AAV vector stocks were produced at the University of Florida Powell Gene Therapy Center and were all serotype 2. Mice undergoing bone marrow transplantation received either 5 x 10 6 unfractionated nucleated bone marrow cells with no radiation or 1 x 10 6 unfractionated nucleated bone marrow cells following 200 rads of total body radiation from a 137 Cs source at birth. Five µm-thick H&E-stained sections of liver and tumor samples from each of the 163 total animals were examined by two independent, board-certified pathologists (E.M.B. and C.V.) that were blinded to genotype and treatment. Statistically significant differences in tumor frequency between groups was determined by Fisher s exact test. Helicobacter hepaticus and bilus are known to cause hepatocellular carcinoma in mice. Representative AAV-treated mice (6 with, and 3 without HCC) were negative for H. hepaticus and bilus, as determined by assays performed at Charles River Laboratories (Wilmington, MA) using a fluorogenic PCR-based method. Cloning of junction fragments by inverse PCR. Two µg of genomic DNA purified from each liver tumor was digested with 8 units of Fat I restriction endonuclease (New England Biolabs) at 37 o C for 2 hours. Nucleic acid pellets were resuspended in 355 µl of water, 40 µl of 10X ligase buffer, and 5 µl of T4 DNA ligase (New England Biolabs, Beverly, MA). Ligation reactions were incubated at 15 o C for 18 hours. The ligase reactions were heat-inactivated and brought to 50 mm NaCl. Sixty units of Dpn I restriction endonuclease were added to each tube and reactions were incubated at 37 o C for 2 hours. DNA was resuspended in 5 µl of 10 mm Tris (ph 8.0), 1 mm EDTA and 1 µl was used as template for PCR amplification with oligonucleotides 369-(5 -
4 GCAGTACATCAAGTGTATCATATGCCAA) and 370-(5 - GCTATGAACTAATGACCCCGTAATTGAT). DNA fragments were excised from agarose gels and cloned using the TA cloning vector pgem T-easy (Promega). DNA sequences were obtained from these cloned PCR products. PCR quantification of vector:chromosome junctions. Integration site junctions were quantified in genomic DNA samples using a model 7500 Fast Real-Time PCR machine (Applied Biosystems) and SYBR Green JumpStart Taq ReadyMix (Sigma- Aldrich). A single vector specific primer 406-(5 - CTTGGCATATGATACACTTGATGTACT) was used in combination with primer 408- (5 - ACACAATTCCCTTTAGTTTTCAGAGT) for junctions 1 and 2, primer 413-(5 - CACAGCTCTCCTGGATGACTAAG) for junction 3, and primer 412-(5 - TTGCATTTATTCAGTCTGAGTGTTC) for junction 4. Microarray analysis. RNA was isolated, and cdna was synthesized from tumor and adjacent, normal-appearing liver tissue from animals containing AAV integration sites 1, 3 and 4. The cdna was hybridized to the MU430-2 Gene Chip (Affymetrix, Santa Clara, CA). Expression signals from tumor samples were divided by those from adjacent, normal-appearing tissue to establish fold difference in expression levels. Supplemental References 1. M. Runte et al., Hu Mol Genet 10, 2687 (2001). 2. E. Le Meur et al., Dev Biol 286, 587 (2005).
5 Table 1. Incidence of HCC in AAV-treated mice. Group (treatment and mouse strain) Fraction of all mice with HCC Fraction of mice 13 months old with HCC Age of onset (months) AAV2-BGUS 6/18 6/ ) (p=0.008) MPSVII (p=0 BMT alone MPSVII BMT radiation MPSVII 1/25 1/ /12 0/8 N.A. AAV2-BGUS 9/16 7/13 001) (p=.0005) 9-18 WT (p=.0 AAV2-BGUS Prom WT Untreated WT Untreated Transgenic 2/6 (p=.105) 2/4 (p=.05) /60 4/ /26 0/24 N.A. The p value is a comparison with the combined BMT alone MPSVII and BMT radiation MPSVII groups. The p value is a comparison with the Untreated WT group. N.A.: Not applicable.
6 Supplemental Figure 1. AAV vectors. Maps of the AAV vectors used are shown with viral ITRs, CMV enhancer, chicken β- actin promoter and first intron (β-act), human β-glucuronidase gene (GUSB), and polyadenyation site (pa) indicated. A promoterless version of the AAV2-BGUS vector was also used in this study, which retains the CMV enhancer but lacks the β-actin promoter (AAV2-BGUS Prom).
7 5 -ITR AAV-GUSB 3 -ITR CMV β-act Human GUSB pa AAV-GUSBΔProm CMV Human GUSB pa Supplemental Figure 1. AAV vectors. Maps of the AAV vectors used are shown with viral ITRs, CMV enhancer, chicken β-actin promoter and first intron (β-act), human β-glucuronidase gene (GUSB), and polyadenyation site (pa) indicated. A promoterless version of the AAV2-BGUS vector was also used in this study, which retains the CMV enhancer but lacks the β-actin promoter (AAV2- BGUS Prom).
SUPPLEMENTAL MATERIALS. Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary
SUPPLEMENTAL MATERIALS METHODS Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary and liver cells were prepared from the indicated transgenic mice, as described (Ho et al, 2002).
More informationMarker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA
Supplementary Table 1: Flurochrome labelled antibody used Marker Antibody Supplier CD3 CD4 CD8 CD25 CD26 CD127 CCR4 CCR7 Ki67 Viability stain Alexa Fluor 700 anti-human CD3 Fluorescein isothiocyanate antihuman
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationSupplemental Materials and Methods. Yeast strains. Strain genotypes are listed in Table S1. To generate MATainc::LEU2,
Supplemental Materials and Methods Yeast strains. Strain genotypes are listed in Table S1. To generate MATainc::LEU2, the LEU2 marker was inserted by PCR-mediated recombination (BRACHMANN et al. 1998)
More informationSuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit
SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets
More informationSupplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes
Cell, Volume 135 Supplemental Data Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Andrzej T. Wierzbicki, Jeremy R. Haag, and
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationPreparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq)
Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Last updated: Oct 28, 2016 Overview First-strand cdna is synthesized using oligo-dt containing primers and an RNA oligo
More informationGENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International
Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationTargeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2*
Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2* 1 Department of Plant Pathology and Environmental Microbiology, Pennsylvania State University,
More informationBIOTECHNOLOGY : PRINCIPLES AND PROCESSES
CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationPV92 PCR Bio Informatics
Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure
More informationLigation Independent Cloning (LIC) Procedure
Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationUser Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only
DNA Walking SpeedUp TM Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion/ Insertion/ Isoform Detection User Manual Version
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationPercent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
More informationNEBNext RNase III RNA Fragmentation Module
SAMPLE PREPARATION NEBNext RNase III RNA Fragmentation Module Instruction Manual NEB #E6146S 100 reactions NEBNext RNase III RNA Fragmentation Module Table of Contents: Description....2 Applications....2
More informationQuality Control Assays
QUALITY CONTROL An integral part of the Penn Vector Core is its robust quality control program which is carried out by a separate quality control group. Quality control assays have been developed and optimized
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationMethylAffinity TM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA. Cat.No.MAK-GCM-30 (30 reactions) User Manual
MethylAffinity TM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA Cat.No.MAK-GCM-30 (30 reactions) User Manual GeneCopoeia, Inc. 9620 Medical Center Drive, #101 Rockville,
More informationpbroad3-lacz An optimized vector for mouse and rat transgenesis Catalog # pbroad3-lacz
pbroad3-lacz An optimized vector for mouse and rat transgenesis Catalog # pbroad3-lacz For research use only Version # 03B04-MT PRODUCT INFORMATION Content: - 20 µg of pbroad3-lacz provided as lyophilized
More informationBIO 202 Midterm Exam Winter 2007
BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive
More informationGenomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes
Supplementary information Methods DNA and RNA extraction Genomic DNA was extracted from to ml of blood collected in EDTA blood collection tubes using the Gentra Puregene Blood kit (Qiagen, California,
More informationSupporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection
Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection Chao Shi, Xiaotong Shen, Shuyan Niu and Cuiping Ma *, Key Laboratory of Sensor Analysis
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationSupplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line
Supplemental Data mrna Protein A kda 75 40 NEO/vector NEO/RNase L RNASE L β-actin RNASE L β-actin B % of control (neo vector), normalized 240 ** 200 160 120 80 40 0 Neo Neo/RNase L RNase L Protein Supplementary
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationAAVpro Titration Kit (for Real Time PCR) Ver.2
Cat. # 6233 For Research Use AAVpro Titration Kit (for Real Time PCR) Ver.2 Product Manual Table of Contents I. Description... 4 II. Components... 6 III. Storage... 6 IV. Materials Required but not Provided...
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationSupplemental methods:
Supplemental methods: ASC-J9 treatment ASC-J9 was patented by the University of Rochester, the University of North Carolina, and AndroScience Corp., and then licensed to AndroScience Corp. Both the University
More informationof the Triphosphate of ATP
A Small Aptamer with Strong and Specific Recognition of the Triphosphate of Peter L. Sazani, Rosa Larralde and Jack W. Szostak Howard Hughes Medical Institute, and Department of Molecular Biology, Massachusetts
More informationSupplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines.
Supplemental Table S1, page 1 Supplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines. ITEM TO ERXPERIMENTAL DESIGN Definition of experimental
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationSupplementary Material. Efficient and scalable serial extraction of DNA and RNA from biobanked tissue samples
Supplementary Material Efficient and scalable serial extraction of DNA and RNA from biobanked tissue samples Lucy Mathot, Monica Lindman and Tobias Sjöblom Department of Genetics and Pathology, Rudbeck
More informationNUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products
More informationRapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples
Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,
More informationMutagenesis and Expression of Mammalian Clotting Factor IX. Mark McCleland The Children s Hospital of Philadelphia and Lycoming College
Mutagenesis and Expression of Mammalian Clotting Factor IX Mark McCleland The Children s Hospital of Philadelphia and Lycoming College Hemophilia B X-linked blood clotting disorder characterized by a deficiency
More informationUser Manual. Version 5. Published February Catalog No. K1021 ~
GeneFishing TM DEG Premix Kit User Manual Version 5 Published February 2005 Catalog No. K1021 ~ 1026 Table of Contents 1. Notices to Customers 1.1 Product Warranty and Liability------------------------------------
More informationEfficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
More informationNEBNext Ultra Ligation Module
LIBRARY PREPARATION NEBNext Ultra Ligation Module Instruction Manual NEB #E7445S/L 24/96 reactions This product is intended for research purposes only. This product is not intended to be used for therapeutic
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationMyofibroblasts in kidney fibrosis. LeBleu et al.
Origin and Function of Myofibroblasts in Kidney Fibrosis Valerie S. LeBleu, Gangadhar Taduri, Joyce O Connell, Yingqi Teng, Vesselina G. Cooke, Craig Woda, Hikaru Sugimoto and Raghu Kalluri Supplementary
More informationIdentification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio
2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationNEBNext Magnesium RNA Fragmentation Module
SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the
More informationThe role of erna in chromatin looping
The role of erna in chromatin looping Introduction Enhancers are cis-acting DNA regulatory elements that activate transcription of target genes 1,2. It is estimated that 400 000 to >1 million alleged enhancers
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationFigure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4
Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr
More informationFunctional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq
Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste
More informationPinpoint Slide DNA Isolation System Catalog No. D3001
INSTRUCTIONS Pinpoint Slide DNA Isolation System Catalog No. D3001 Highlights Easily isolates genomic DNA in any targeted microscopic tissue area on a slide. The simple procedure combines Pinpoint tissue
More informationCalifornia Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab
Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%
More informationProtocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7
More informationRapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples
Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,
More informationAmpligase Thermostable DNA Ligase
Cat. Nos. A0102K, A0110K, A1905B, A3202K, A3210K, A32750, and A8101 www.lucigen.com MA023E-Ampligase Thermostable DNA Ligase 11/2017 1 1. Introduction Ampligase Thermostable DNA Ligase catalyzes the NAD-dependent
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationMethods (detailed). for all the experiments. Cells were grown in 50 ml YEA. The cells were harvested and
Methods (detailed). Purification of yeast chromosomal DNA. Strain JZ105 (mat1m Δmat2,3::LEU2, ade6-210, leu1-32, ura4-d18, his2) was used for all the experiments. Cells were grown in 50 ml YEA. The cells
More informationResearch techniques in genetics. Medical genetics, 2017.
Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR
More informationSUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity
SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationFROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE
Uppsala 2001-04-01 REPORT FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Laboratory assistants: Maria Jönsson Amera Gibreel Students: Contents ASSIGNMENT:... 3 INTRODUCTION:... 3 MATERIAL AND
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationComparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques
Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationSUPPLEMENTARY INFORMATION
Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers Wataru Sakai, Elizabeth M. Swisher, Beth Y. Karlan, Mukesh K. Agarwal, Jake Higgins, Cynthia Friedman, Emily Villegas,
More informationQUICK-Clone TM User Manual. cdna
QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationOptimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion
SUPPLEMENTARY FIGURE 1. Optimization of site-specific RNase H cutting of 1037 nt renilla luciferase mrna. The digestion mixture was incubated at 37 C for 0 to 120 minutes. The cutting was nearly complete
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/318/5851/794/dc1 Supporting Online Material for A Gene Regulatory Network Subcircuit Drives a Dynamic Pattern of Gene Expression Joel Smith, Christina Theodoris, Eric
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationPurification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost
Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen
More informationSupplementary Information
Supplementary Information Supplementary Figures Figure S1. Study of mgtl translation in vitro. (A) Detection of 5 LR RNA using wild-type and anti-sd (91-95) substituted templates in a transcription-translation
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More information8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationSupplementary material and methods
Supplementary material and methods raav production and animal experiments The paav-rsvp-gfp-pa vector plasmid contained the Rous Sarcoma Virus promoter (RSVp), followed by a short synthetic intron (pci
More informationSupplementary Protocol: CIRCLE-seq Library Preparation
Supplementary Protocol: CIRCLE-seq Library Preparation Reagent Gentra Puregene Tissue Kit Qubit dsdna BR Assay Kit Agencourt AMPure XP magnetic beads High throughput, with bead, PCR-free Library Preparation
More informationEPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More information