Protein Synthesis Honors Biology

Transcription

1 Protein Synthesis

2 What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then can DNA be used to build proteins?

3 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA transcription RNA translation protein trait replication DNA gets all the glory, but proteins do all the work!

4 RNA Does the Work Traits, like eye color, are determined by proteins that are coded in DNA. Our cells, however, need a secret decoder ring to express the DNA code. AND, we need to get the instructions on how to make the protein from the nucleus to the ribosomes. ENTER: Ribonucleic Acid (RNA)

5 Protein Synthesis DNA molecules provide the instructions for making proteins BUT, RNA molecules are what build the proteins based on those instructions. The workers for Protein Synthesis (gene expression) are RNA molecules.

6

7 RNA Structure RNA structure differs from DNA structure in 3 ways: 1. RNA is single stranded 2. RNA is composed of the sugar Ribose 3. In RNA, a new base Uracil replaces Thymine

8 RNA Nitrogen Bases Both RNA and DNA contain four nitrogen bases, but instead of Thymine, RNA contains Uracil (U) Uracil forms a base pair with Adenine, just as Thymine does in DNA. RNA: U - A DNA: T - A

9 DNA vs. RNA Venn DNA RNA

10 Types of RNA Molecules 3 types of RNA molecules help to build proteins: 1. Messenger RNA (mrna): the messenger Runs information from DNA in the nucleus to ribsosomes. 2. Ribosomal RNA (rrna): the reader Part of ribosome and reads mrna message. 3. Transfer RNA (trna): the transporter Brings amino acids to the ribosome to be assembled into protein.

11 The Central Dogma Genotype DNA Step 1: transcription RNA Step 2: translation protein Phenotype Step 3: Folding trait replication DNA gets all the glory, but proteins do all the work!

12 Protein Synthesis Step 1: Transcription Rewriting DNA into mrna so that the instructions can leave the nucleus Step 2: Translation Translating RNA into amino acids Step 3: Protein Folding Amino acid chain folds up into finished protein

13 Step 1: Transcription DNA RNA Transcription is the process within the cell nucleus where enzymes make an RNA copy of a DNA gene. The nucleotide sequence rewritten (transcripted) as mrna acts as a genetic message. This message is the complete information for the building of a protein. WHY??? DNA cannot leave the nucleus!

14 Steps of Transcription 1. Separation of Strands Enzyme DNA helicase opens up the DNA molecule 2. Initiation Enzyme RNA Polymerase joins DNA at the beginning of a gene 3. Elongation An RNA Polymerase reads the DNA it adds the complimentary RNA bases 3. Reformation (DNA) mrna is complete and DNA winds back up. 4. Termination mrna is complete and leaves the nucleus to go to the ribosome.

15 Transcription Example DNA mrna TACGCACATTTACGTACGCGG! AUGCGUGUAAAUGCAUGCGCC! Using the RNA base-pairing rules, DNA is easily decoded into the mrna strand.

16 Step 2: Translation RNA protein Translation - converting information in mrna into the language of proteins Takes place at ribosomes in the cytoplasm. The protein language is made up of an alphabet of Amino Acids. Because there are 20 different amino acids and mrna has only 4 bases, biochemists realized that a code was needed to convert the language into a protein.

17 The Genetic Code The Genetic Code is made up of 64 codons. A Codon is a set of 3 nitrogen bases of mrna that represents a certain amino acid. All organisms use the same genetic code! Example: UAC codes for the amino acid tyrosine in the mrna of bacteria, birch trees, and bison. Yeah, me & bacteria go way back.

18 DNA Replication vs. RNA Transcription

19 mrna codes for proteins in triplets DNA TACGCACATTTACGTACGCGG! codon mrna AUGCGUGUAAAUGCAUGCGCC! Codons are read by the ribosome three bases at a time

20 More on Codons Codons do not just code for amino acids. Some codons provide instructions for the assembling of proteins. Stop Codon: (UAA), (UAG), and (UGA) are all stop codons indicating that protein production ends. Start Codon: (AUG) is a codon that indicates where protein production must start. This codon also codes for an amino acid (Methionine)

21 The Code Start codon For ALL life! strongest support for a common origin for all life Code is redundant AUG methionine Stop codons UGA, UAA, UAG several codons for each amino acid

22 How do amino acids get to the ribosome? trna transports all the amino acids to the ribosome. Each trna molecule attaches to only one type of amino acid because of it s structure. This is done through base pairing. trna carries only the amino acid that it s Anticodon specifies.

23 trna Structure clover leaf structure Anticodon - three bases on trna that pair with codon of mrna on clover leaf end amino acid on opposite end

24

25 Ribosomes Structure Made up of rrna P site holds trna carrying growing polypeptide chain A site holds trna carrying next amino acid to be added to chain E site (exit site) discharged trna leaves ribosome from exit site

26 Steps of Translation 1. Ribosome reads mrna codons AUG codes start 2. trna brings correct amino acids 3. trna matches anticodon to codon 4. Amino Acids assembled into polypeptide chain Peptide bonds! 5. Protein synthesis is terminated by stop codon.

27

28 Translation Example DNA mrna TACGCACATTTACGTACGCGG! AUGCGUGUAAAUGCAUGCGCC! protein Met Arg Val Asn Ala Cys Ala! Use the Genetic Code chart and mrna codons to figure out each amino acid in the sequence.

29 Genetic Code Chart

30 Step 3: Protein Folding protein trait Amino acid chains become active Proteins when they are freed from the ribosome and twist and curl into complex 3-D shapes. Each protein chain forms the same shape every time it is produced. These proteins become enzymes, cells, and tissue structures.

31 From gene to protein DNA transcription mrna leaves nucleus through nuclear pores mrna translation a a ribosome a a a a a a a a a a a a a a protein nucleus cytoplasm proteins synthesized by ribosomes using instructions on mrna

32 The Big Picture

33

34 Gene Mutations

35 Reading Codons Codons are read by the ribosome three bases at a time WHYDIDTHEREDBATEATTHEFATRAT! But, what happens if there is a change in the DNA base sequence? WHYDIDTHEREDCATEATTHEFATRAT! WHYDIDTHEREDBATATTHEFATRAT! WHYDIDTHEREDBATEATATHEFATRAT!

36 Gene Mutations A mutation is a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can alter the amino acid sequence of the protein encoded by the gene. How does this happen? Error during DNA replication Error during transcription Exposure to chemical, UV Radiation, carcinogen, etc.

37 Point Mutations Single base change 3 Outcomes 1. Silent mutation no amino acid change 2. missense Changes the amino acid 3. nonsense changes to a stop codon When do mutations affect the next generation?

38 Point mutation leads to Sickle cell anemia What does the mutation cause? Missense!

39 Frameshift Mutations Shifts reading frame changes everything downstream 2 Kinds Frameshift Insertion adding base(s) Frameshift Deletion losing base(s) Outcomes: nonsense or missense

40 Cystic Fibrosis

41 Is there any value in mutations?