Genes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes?
|
|
- Bryce Francis
- 6 years ago
- Views:
Transcription
1 Midterm Q Genes found in the genome include protein-coding genes and non-coding RNA genes Which nucleotide is not normally found in non-coding RNA genes? G T 3 A 4 C 5 U 00% Midterm Q Which of the following is false concerning eukaryotic DNA replication? Okazaki fragments contain both RNA and DNA template is read 3' to 5' during DNA polymerization 3 leading-strand DNA polymerization does not require a primer 00% 4 each replication bubble is composed of two replication forks 5 two of the above
2 3 Midterm Q3 Which of the following DNA repair mechanisms can remove chemical adducts that distort the normal shape of DNA? nucleotide excision repair 00% error-prone double-strand DNA repair 3 base excision repair 4 double-strand DNA repair by homologous recombination 5 mismatch excision repair 4 Midterm Q4 In addition to a DNA polymerase activity, DNA polymerase alpha has which other enzymatic activity? endonuclease RNA polymerase 3 3 to 5 exonuclease 4 5 to 3 exonuclease
3 5 none of the above 00% 5 Midterm Q5 Acetylated, phosphorylated, methylated and ubiquinated amino-acids of protruding histone tails from the nucleosome protein core are formed posttranslationally 00% are directly incorporated during translation 3 are directly incorporated during transcription 4 are formed posttranscriptionally 5 have no effect on the regulation of chromatin structure 6 Midterm Q6 The function of polypeptides are defined by the presence of domains Which of the following is true concerning domains? stabilized by long-range interactions
4 can contain motifs of secondary structure 3 can contain betasheets 4 similar domains can be found in different polypeptides 5 all of the above 00% 7 Midterm Q7 Which of the following is false concerning DNA denaturation? is important in dideoxy DNA sequencing occurs more readily in AT-rich regions 3 is important in PCR 4 involves the breaking of hydrogen bonds between bases in base pairs 5 is irreversible 00% 8 Midterm Q8
5 SINEs are derived from non-coding RNA genes 00% LINEs 3 simple sequence repeats 4 nucleosomes 5 protein-coding genes 9 Midterm Q9 Which of the following is the initial primer used during reverse transcription as part of LTRretrotransposon mobility? DNA transposons oligonucleotides produced by primase 3 rrna 4 trna 00% 5 oligonucleotides produced by DNA polymerase alpha 0 Midterm Q0
6 In eukaryotes, most actively transcribed genes are found in heterochromatin transposon-rich regions 3 simple-sequence repeats 4 euchromatin 00% 5 SARs and MARs Midterm Q The control region (ie, promoter) of retroviral protein-coded genes is located in the PBS in the U5 region of LTRs 3 between the LTRs 4 in the U3 region of LTRs 00% 5 in the R region of LTRs Midterm Q Which of the following are wobble base pairs that occur during translation?
7 G-U C-I 3 A-I 4 U-I 5 all of the above 00% 3 Midterm Q3 DNA- and RNA-binding proteins usually contain which of the following? zinc-finger motif 00% helix-loop-helix motif 3 coiled-coil motif 4 all of the above 5 none of the above 4 Midterm Q4 How many products will be produced in the following DNA sequencing reaction? Reaction tube contains DNA polymerase, dntps (00 mm), ddatp ( mm), primer (see below) and template (see below) NOTE: the concentration of DNA polymerase, primer and template are NOT rate limiting Primer = 5 -CTTGGCTACTGCC-3
8 Template = 5 -TTTCGGAAGCAATGGACTAAGGCAGTAGCCAAGCTGCT % Midterm Q5 The base excision repair of base pairs formed between G and deaminated methyl-c involves specific DNA glycosylases that hydrolyze the covalent bonds between G and U bases and the sugar-phosphate backbones a specific apyrimidinic endonuclease that hydrolyze the covalent bonds between G and T bases and the sugar-phosphate backbones 3 a specific DNA glycosylase that hydrolyzes the 00%
9 covalent bond between a T base and the sugarphosphate backbone 4 a specific DNA glycosylase that hydrolyzes the covalent bond between a G base and the sugarphosphate backbone 5 a specific apurinic endonuclease that hydrolyze the covalent bonds between G and T bases and the sugar-phosphate backbones 6 Midterm Q6 In a criminal case involving an assault of a teenager, blood found at the crime scene had an exact DNA barcode (from CO) sequence as a suspect under arrest This means that the suspect was definitely not at the scene of the crime not much as DNA barcoding is the wrong tool for this investigation However, the result does imply 00%
10 that the blood at the scene is human 3 that the suspect and the victim are definitely the same person 4 that the suspect and victim are definitely cousins 5 that the suspect was at the scene of the crime 7 Midterm Q7 Which enzyme is responsible for the integration, ie "paste", of DNA transposons? integrase LINE ORF 3 RNA polymerase 4 transposase 00% 5 reverse transcriptase 8 Midterm Q8 During normal DNA replication, which is true concerning the rate of DNA polymerization by the pol delta/rfc/pcna complexes at the replication fork?
11 lagging strand DNA synthesis is slower than leading strand DNA synthesis lagging strand DNA synthesis is faster than leading strand DNA synthesis 3 lagging strand DNA synthesis proceeds at the same rate as leading strand DNA synthesis 4 the rate of both leading strand and lagging DNA synthesis is limited by DNA helicase 5 two of the above 00% 9 Midterm Q9 Using the codon usage table below, which codon(s) can base pair with the anticodon 5 -IGG- 3? SER LYS
12 3 ALA 4 PRO 00% 5 LEU 0 Midterm Q0 Through the action of reverse transcriptase, the proviral or DNA form the retroviral genome is formed In step 5 (see diagram), a short piece of RNA (large red arrow) persists long enough to act as a primer This is because the sequence is more difficult to degrade by ribonuclease (RNase) 00% the sequence corresponds to a trna sequence 3 the sequence corresponds to a region within the LTR 4 the sequence is protected by integrase 5 the sequence is protected by reverse transcriptase Midterm Q v
13 The terminal sequences (that is, at the very ends) of DNA transposons are composed of direct repeats SINEs 3 inverted repeats 00% 4 LTRs 5 integrase Midterm Q Both standard PCR and in vivo DNA replication involve RNA polymerase integrase 3 primer(s) 00% 4 ribonucleotides (rntps) 5 DNA ligase 3 Midterm Q3 Which is true for microsatellites? repeat units are
14 approx 4 to 00 bp in length arrays are composed of tandem repeat units 3 expansion of repeat units can occur by backward slippage during DNA replication 4 are often found in telomeres and centromeres 5 two of the above 00% 4 Midterm Q4 Organellar genomes have no genes are typically larger than eukaryotic nuclear genomes 3 were originally derived from an endosymbiont 00% 4 have only pseudogenes 5 contain genes the resemble the structure of
15 typical eukaryotic nuclear genes (eg, have introns) 5 Midterm Q5 Which of the following are features of complex transcription units? have control regions can have introns 3 have exons 4 diversity of mrna transcripts increased through alternative splicing 5 all of the above 00%
DNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More information5 -GAC-3 5 -GTC-3 5 -CAG Which of these are NOT important for RNA Polymerase interacting with DNA?
Name This exam is schedule for 75 minutes and I anticipate it to take the full time allotted. You are free to leave if you finish. The exam is split into two sections. Part 1 is multiple choice select
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationAlpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words).
1 Quiz1 Q1 2011 Alpha-helices, beta-sheets and U-turns within a protein are stabilized by (hint: two words) Value Correct Answer 1 noncovalent interactions 100% Equals hydrogen bonds (100%) Equals H-bonds
More informationDNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures
More informationExam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationDNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationBiology Lecture 2 Genes
Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationFig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationAP2013-DNAPacket-II. Use the list of choices below for the following questions:
Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationChapter 30. Replication. Meselson Stahl Experiment. BCH 4054 Chapter 30 Lecture Notes. Slide 1. Slide 2 Conceptual Mechanism of.
BCH 4054 Chapter 30 Lecture Notes 1 Chapter 30 DNA Replication and Repair 2 Conceptual Mechanism of Replication Strand separation, with copying of each strand by Watson-Crick base pairing Fig 30.2 Three
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationThe replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationCovalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence.
Unit 14: DNA Replication Study Guide U7.1.1: DNA structure suggested a mechanism for DNA replication (Oxford Biology Course Companion page 347). 1. Outline the features of DNA structure that suggested
More informationLECTURE 26. a) A light-independent repair mechanism that involves three steps:
LECTURE 26 DNA REPAIR A. The capability for repair of damaged DNA is found in one form or another in all organisms. Prokaryotes (e.g., E. coli) have five repair systems, whereas higher organisms (e.g.,
More informationThe structure, type and functions of a cell are all determined by chromosomes:
DNA Basics The structure, type and functions of a cell are all determined by chromosomes: They are found in the nucleus of a cell. These chromosomes are composed of DNA, the acronym for deoxyribonucleic
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationReplication. Obaidur Rahman
Replication Obaidur Rahman DIRCTION OF DNA SYNTHESIS How many reactions can a DNA polymerase catalyze? So how many reactions can it catalyze? So 4 is one answer, right, 1 for each nucleotide. But what
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationNUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationProposed Models of DNA Replication. Conservative Model. Semi-Conservative Model. Dispersive model
5.2 DNA Replication Cell Cycle Life cycle of a cell Cells can reproduce Daughter cells receive an exact copy of DNA from parent cell DNA replication happens during the S phase Proposed Models of DNA Replication
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationDNA metabolism. DNA Replication DNA Repair DNA Recombination
DNA metabolism DNA Replication DNA Repair DNA Recombination Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Central Dogma or Flow of genetic information
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More information36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-
36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic
More informationBCMB Chapters 34 & 35 DNA Replication and Repair
BCMB 3100 - Chapters 34 & 35 DNA Replication and Repair Semi-conservative DNA replication DNA polymerase DNA replication Replication fork; Okazaki fragments Sanger method for DNA sequencing DNA repair
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationDepartment. Zoology & Biotechnology QUESTION BANK BIOTECHNOLOGY SEMESTER-V
Department of Zoology & Biotechnology QUESTION BANK BIOTECHNOLOGY SEMESTER-V Unit-1 Genetic Material Different forms of DNA(DNA topology):- B-form, Z-form, D-form; Gene structure-introns,exaons and pseudogenes:
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationEUKARYOTIC GENE CONTROL
EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationBIOB111 - Tutorial activity for Session 13
BIOB111 - Tutorial activity for Session 13 General topics for week 7 Session 13: Types of nucleic acids, DNA replication Useful links: 1. Visit this website and use its menu to locate information and practice
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationWilkins Franklin s photo below proved model on left to be correct for DNA
Watson Crick Franklin Wilkins Franklin s photo below proved model on left to be correct for DNA Pauling Most important scientific paper in Biology in last 100 years First time DNA double helix seen in
More informationDNA Replication semiconservative replication conservative replication dispersive replication DNA polymerase
DNA Replication DNA Strands are templates for DNA synthesis: Watson and Crick suggested that the existing strands of DNA served as a template for the producing of new strands, with bases being added to
More information2012 GENERAL [5 points]
GENERAL [5 points] 2012 Mark all processes that are part of the 'standard dogma of molecular' [ ] DNA replication [ ] transcription [ ] translation [ ] reverse transposition [ ] DNA restriction [ ] DNA
More informationPlant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter
Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationDNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationThe DNA Molecule: The Molecular Basis of Inheritance
Slide hapter 6 he DN Molecule: he Molecular Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil ampbell and Jane Reece Lectures by hris Romero, updated by Erin Barley
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationDNA Replication. The Organization of DNA. Recall:
Recall: The Organization of DNA DNA Replication Chromosomal form appears only during mitosis, and is used in karyotypes. folded back upon itself (chromosomes) coiled around itself (chromatin) wrapped around
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationLecture #18 10/17/01 Dr. Wormington
Lecture #18 10/17/01 Dr. Wormington DNA Replication The Story So Far Semiconservative Hydrolysis of 5' dntp 3' HO N 4 pn 3 pn 2 pn 1 p5'... + PP i 2P i Provides Energy for Phosphodiester Bond Formation
More informationLABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS
LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS OBJECTIVE 1. OBJECTIVE 2. OBJECTIVE 3. OBJECTIVE 4. Describe the structure of DNA. Explain how DNA replicates. Understand the structure
More informationChapter 2 - DNA MC [37 marks]
Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order
More informationThe information provided below may be useful in answering some questions.
Molecular Exam 1 More Tutorial at www.dumblittledoctor.com The information provided below may be useful in answering some questions. INFORMATION ON COMPONENTS OF RIBOSOMES I. Prokaryotes (e.g. E. coli)
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationDNA Replication AP Biology
DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.
More informationHow can something so small cause problems so large?
How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationMIDTERM I NAME: Student ID Number: I 32 II 33 III 24 IV 30 V
MIDTERM I NAME: Student ID Number: Question Maximum Points Your Points I 32 II 33 III 24 IV 30 V 31 150 Please write your name/student ID number on each of the following five pages. This exam must be written
More informationDNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationCHAPTER 16 MOLECULAR BASIS OF INHERITANCE
CHAPTER 16 MOLECULAR BASIS OF INHERITANCE DNA as genetic material? Deducted that DNA is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths
More informationAP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET
AP Biology TEST #4 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of heat-killed
More informationDNA Replication. Packet #17 Chapter #16
DNA Replication Packet #17 Chapter #16 1 HISTORICAL FACTS ABOUT DNA 2 Historical DNA Discoveries 1928 Frederick Griffith finds a substance in heat-killed bacteria that transforms living bacteria 1944 Oswald
More information