CH 17 :From Gene to Protein

Transcription

1 CH 17 :From Gene to Protein

2 Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications. RNA polypeptide 1 polypeptide 2 polypeptide 3 Elizabeth Pennisi, Science 2003 It s hard to hunt for wabbits, if you don t know what a wabbit looks like. AP Biology

3 The Central Dogma How do we move information from DNA to proteins? transcription translation DNA RNA protein replication For simplicity sake, let s go back to genes that code for proteins AP Biology

4 Figure 17.4 DNA template strand 3 A C C A A A C C G A G T 5 DNA molecule 5 T G G T T T G G C T C A 3 Gene 1 TRANSCRIPTION mrna 5 U G G U U U G G C U C A 3 Gene 2 TRANSLATION Codon Protein Trp Phe Gly Amino acid Ser Gene 3

5 From nucleus to cytoplasm Where are the genes? genes are on chromosomes in nucleus Where are proteins synthesized? proteins made in cytoplasm by ribosomes How does the information get from nucleus to cytoplasm? messenger RNA nucleus AP Biology

6 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded mrna, rrna, trna, sirna. DNA transcription RNA AP Biology

7 Direction of RNA Transcription Antisense strand of DNA (3 5 ) is used as a template to build RNA in 5 3 direction AP Biology

8 Downstream and upstream both refer to a relative position in DNA or RNA. Relative to the position on the strand, downstream is the region towards the 3' end of the strand. Since DNA strands run in opposite directions, downstream on one strand is upstream on the other strand. Transcription and translation of DNA and mrna, respectively, have their direction defined by the newly synthesized strand, that is, in downstream direction 5' 3'( moving from upstream 5 to downstream 3 end)

9 Synthesis of an RNA Transcript The three stages of transcription Initiation Elongation Termination AP Biology 2011 Pearson Education, Inc.

10 Molecular Components of Transcription The RNA is complementary to the DNA template strand RNA synthesis follows the same base-pairing rules as DNA, except that uracil substitutes for thymine RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides 2011 Pearson Education, Inc.

11 The DNA sequence where RNA polymerase attaches is called the promoter; the sequence signaling the end of transcription is called the terminator The stretch of DNA that is transcribed is called a transcription unit 2011 Pearson Education, Inc.

12 Transcription in Prokaryotes Initiation RNA polymerase binds to promoter sequence on antisense DNA strand (3 5 ) Role of promoter 1. Starting point for reading DNA 2. Reads sequence of template strand 3. Always reads DNA from 3' 5 direction

13 Figure A eukaryotic promoter 5 3 DNA T A T A A A A A T A T T T T TATA box Promoter Start point Nontemplate strand 3 5 Template strand Transcription factors 2 Several transcription factors bind to DNA Transcription initiation complex forms RNA polymerase II Transcription factors RNA transcript Transcription initiation complex

14 RNA Polymerase Binding and Initiation of Transcription Promoters signal the transcriptional start point and usually extend several dozen nucleotide pairs upstream of the start point A sequence called a TATA box is crucial in forming the initiation complex in eukaryotes.

15 RNA Polymerase Binding and Initiation of Transcription Transcription factors mediate the binding of RNA polymerase and the initiation of transcription The completed assembly of transcription factors and RNA polymerase II bound to a promoter is called a transcription initiation complex

16 Elongation of the RNA Strand As RNA polymerase moves along the DNA, it untwists the double helix, 10 to 20 bases at a time Nucleotides are added to the 3 end of the growing RNA molecule. Direction of transcription is downstream ( 5 to 3 )

17 TERMINATION RNA polymerase stops after termination sequence and transcribes the polyadenylation signal sequence (AAUAAA). The polyadenylation signal has following two functions: 1. Termination - It signals enzymatic cleavage ~10 35 nucleotides away leading to removal of mrna transcript from DNA. 2. Polyadenylation - It is the non-templated addition of a 50 to 200 nucleotide chain of multiple adenosine monophosphates to 3 end (polya tail).

18 Post-transcriptional RNA processing Happens in nucleus to protect mrna from RNase enzymes in cytoplasm The 5 end receives a modified nucleotide 5 cap The 3 end gets a poly-a tail AP Biology UTR untranslated regions

19 RNA splicing in nucleus Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides (introns) that lie between coding regions (exons). RNA splicing removes introns and joins exons, creating an mrna molecule with a continuous coding sequence eukaryotic DNA primary mrna transcript intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mature mrna transcript pre-mrna AP Biology spliced mrna

20 Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons eukaryotic DNA intron = noncoding (in-between) sequence exon = coding (expressed) sequence AP Biology

21 Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mrna editing needed AP Biology

22 5 Protein snrna Exon 1 RNA transcript (pre-mrna) snrnps Intron Exon 2 Spliceosome Other proteins 5 RNA splicing is carried out by spliceosomes. SnRNPs consist of protein and small nuclear RNA. They combine with other proteins to form Spliceosomes. They recognize the splice sites on RNA and excise introns.

23 ALTERNATIVE RNA SPLICING Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during splicing (alternative RNA splicing) Consequently, the number of different proteins an organism can produce is much greater than its number of genes AP Biology

24 Ribozymes Ribozymes are catalytic RNA molecules that function as enzymes and can splice RNA The discovery of ribozymes rendered obsolete the belief that all biological catalysts were proteins Properties of RNA that enable it to function as an enzyme It can form a three-dimensional structure because of its ability to base-pair with itself RNA may hydrogen-bond with other nucleic acid molecules 2011 Pearson Education, Inc.

25 Translation Codons blocks of 3 nucleotides decoded into the sequence of amino acids AP Biology

26 trna - Clover leaf structure anticodon on clover leaf end, anticodons are three base nucleotides complimentary to mrna codons. amino acid attached on 3' end

27 How are the codons matched to amino acids? DNA mrna 3' 5' TACGCACATTTACGTACGCGG 5' 3' AUGCGUGUAAAUGCAUGCGCC codon trna amino acid 3' 5' UAC Met GCA Arg CAU Val anti-codon AP Biology

28 Reading Frame Reading frame starts with AUG and continues in triplets to a termination codon.

29 Genetic code For ALL life! Genetic code is universal strongest support for a common origin for all life Code is redundant several codons for each amino acid 64 codons and 20 amino acids Start codon AUG methionine Stop codons UGA, UAA, UAG AP Biology

30 Accurate translation requires two steps First: a correct match between a trna and an amino acid, done by the enzyme aminoacyl-trna synthetase Second: a correct match between the trna anticodon and an mrna codon 2011 Pearson Education, Inc.

31 Wobbling Flexible pairing at the third base of a codon is called wobble and allows some trnas to bind to more than one codon Anticodon base G C A U Codon bases U or C G U A or G

32 Wobbling flexible pairing at third base

33 Ribosomes Facilitate coupling of trna anticodon to mrna codon Structure ribosomal RNA (rrna) & proteins 2 subunits large Small Prokaryotic:70S (30S+50S) Eukaryotic:80S (40S+60S) Used to support endosymbiosis Chloroplast and mitochondria has 70S ribosomes AP Biology

34 Ribosomes Smaller subunit and larger subunit of eukaryotic ribosomes are described as 40S and 60S respectively, and the whole ribosome is 80S. Prokaryotic Ribosomes (70 S) consist of two subunits, and these two subunits are called 30S and 50S

35 Ribosomes A site (aminoacyl-trna site) holds trna carrying next amino acid to be added to chain P site (peptidyl-trna site) holds trna carrying growing polypeptide chain E site (exit site) empty trna leaves ribosome from exit site AP Biology

36 Building a Polypeptide The three stages of translation Initiation Elongation Termination All three stages require protein factors that aid in the translation process AP Biology 2011 Pearson Education, Inc.

37 INITIATION requires protein factors called Initiation Factors (IF)

38 Initiation Initiation factors are released after hydrolysis of GTP to GDP and Pi Large ribosomal subunit 50S can attach to 30S completing the translational initiation complex.

39 3. mrna moves along with its bound trnas translocating empty trna from P to E site and the trna on A is moved to P. Now, the next mrna codon to be translated is on A site. The empty trna on E site exit. Elongation 1. The incoming trna anticodon bonds with matching mrna on A site 2. RNA in large subunit catalyzes formation of peptide bond bet amino group of new incoming amino acid on A site and carboxyl end of growing polypeptide on P site, displacing polypeptide from trna on P site to A site

40 Termination: release polypeptide Termination occurs when a stop codon in the mrna reaches the A site of the ribosome release factor a protein bonds to A site bonds water molecule to polypeptide chain releasing it. AP Biology

41 DNA RNA polymerase Can you tell the story? exon intron amino acids pre-mrna 5' cap trna large subunit mature mrna polya tail polypeptide aminoacyl trna synthetase 3' ribosome 5' small subunit E P A trna AP Biology

42 Point Mutations Point mutations single base change silent mutation no amino acid change redundancy in code missense change amino acid nonsense Change a codon to stop codon AP Biology

43 Substitutions A nucleotide-pair substitution replaces one nucleotide and its partner with another pair of nucleotides Silent mutations have no effect on the amino acid produced by a codon because of redundancy in the genetic code Missense mutations still code for an amino acid, but not the correct amino acid Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein 2011 Pearson Education, Inc.

44 Types of Point mutations based on cause 1. Substitution Base from sequence changed to different base 2. Insertion additional base is inserted 3. Deletion a base from sequence is deleted

45 Sickle cell anemia AP Biology

46 Point mutation leads to Sickle cell anemia What kind of mutation? AP Biology

47 Mutations Frameshift shift in the reading frame changes everything downstream Caused by insertions (adding base(s)) or deletions (losing base(s)) AP Biology

48 In summary, a gene can be defined as a region of DNA that can be expressed to produce a final functional product, either a polypeptide or an RNA molecule 2011 Pearson Education, Inc.