Percent survival. Supplementary fig. S3 A.

Size: px

Start display at page:

Download "Percent survival. Supplementary fig. S3 A."

Brian Mitchell
6 years ago
Views:

3 Supplementary fig. S3 A. B. 100 Percent survival Ml C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice A cohort of 18 chimaeras was generated from blastocyst injection of triple targeted ES cells (carrying loxp sites in MLL and ENL genes and a Cre knock in of LMO2). The rate of leukaemia incidence is plotted (A) in comparison to the rate of incidence in a previously published cohort of translocator mice (B) made by breeding germline carriers of the three alleles (reference 9, main text). The level of chimaerism (C) was estimated from coat colour (the ES line was of 129/Sv mouse origin and injected into C57/Bl6 mouse blastocysts). No correlation between chimaeric level and tumour rate was possible; in our original paper using the MLL-AF9 knock-in mouse (reference 10, main text), the time to leukaemia incidencedid not correlate with coat colour chimaerism.

4 A. LH homology Venus-Luciferase P1 EF-BOS promoter P2 RH homology arm of Mll Stop ATG frt arm of Enl B. } TATGCAGTTGCTCTCCAGCGGTTCCATCTTCCAGCGGATAGAATGGCGCC ATACGTCAACGAGAGGTCGCCAAGGTAGAAGGTCGCCTATCTTACCGCGG H L Q E G A T G D E L P Y F P A GGGCCTTTCTTTATGTTTTTGGCGTCTTCCATGGATCCACTAGGGCCGCT CCCGGAAAGAAATACAAAAACCGCAGAAGGTACCTAGGTGATCCCGGCGA P G K K I N K A D E M Luciferase coding < < frt site CTAGAACTAGTGGATCTGAGAAGTTCCTATACTTTCTAGAGAATAGGAAC GATCTTGATCACCTAGACTCTTCAAGGATATGAAAGATCTCTTATCCTTG end of EF-BOS promoter < > TTCAGATCCCCCGGGCTGCAGGAATTAATTCCTCACGACACCTGAAATGG AAGTCTAGGGGGCCCGACGTCCTTAATTAAGGAGTGCTGTGGACTTTACC Supplementary Fig. 4. Sequence of the genomic PCR product after FLP-mediated deletion CHO cells were transfected with cassettes 1 and 2 (Fig. 7) plus PGK-Cre. DNA was prepared after 48 hours and PCR amplification was carried out using primers at the 5 end of luciferase (P1) and within the EF-BOS promoter (P2). The DNA sequence shown in B. shows DNA fusion after the FLP-mediated deletion of between the frt sites. LH and RH = left and right hand

5 Supplementary figure 5 Analysis of mrna levels in chimaera-derived tumour cells A. QPCR Ct values for Mll and Mll-Enl transcripts Primer Set Average Ct Conditions of QPCR cdna source MEK 1 Mll-Mll Full QPCR reaction Mll-Enl Full QPCR reaction Actin Full QPCR reaction MEK 5 Mll-Mll Full QPCR reaction Mll-Enl Full QPCR reaction Actin Full QPCR reaction MEK 1 Mll-Mll no reverse transcriptase Mll-Enl no reverse transcriptase Actin no reverse transcriptase MEK 5 Mll-Mll no reverse transcriptase Mll-Enl no reverse transcriptase Actin no reverse transcriptase // Mll-Mll No cdna template Mll-Enl No cdna template Actin No cdna template Table legend RT-PCR was carried out on cdna prepared from MEK1 and MEK5 cells (see Fig. 3 legend) and three sets of QPCR primers were used to assess Ct values for Mll, Mll-Enl and actin mrna. Control reactions were conducted with no reverse transcriptase enzyme and no cdna template as indicated. B. Sequence of Mll-Enl fusion cdna RT-PCR products were cloned and sequenced determined to verify the QPCR data. 1. Mll TGTGCTTTCTCTGTGCCAGCAGTGGGCATGTAGAGTTTGTGTATTGCCAAGTGTGTTGTGAACCCTTCC 2. Mll-Enl TGTGCTTTCTCTGTGCCAGCAGTGGGCATGTAGAGTGCACTGTCCAGGTGAAGTTAGAGCTGGGGCACC The black sequences Mll and blue Enl. Methods RNA was prepared from MEK 1 and MEK 5 spleen cells using the mirvana PARIS kit (Ambion) following the manufacturer s protocol. The RNA was DNaseI digested using a Turbo DNA-Free kit (Ambion) and reverse transcribed into cdna using SuperScript III First-Strand Synthesis System (Invitrogen) and the oligodt primers. QPCR primers were designed across the wild-type and fusion cdnas to produce amplicons of approx. 180bp. All four primers were chosen to have identical length and base-pair composition. The primers were the checked for homology to other regions of the Mouse genome using the UCSC Genome browser. Reference gene primers were designed in the same manner on β-actin cdna. All primers were tested for amplification efficiencies by using a fixed concentration of primer pair combinations (1uM each final concentration) across serial 5-fold dilutions of cdna, each in triplicate. The QPCR reactions were performed using Fast SYBR Green Master Mix (Applied Biosystems) and run on the Quick Start program for comparative expression (ddct) on the ABI 7500 Fast Real-Time PCR System cycler. Primer efficiencies were determined to be between 82 and 110%. Quantitative PCR was performed using a 1/10 dilution of cdna (and RT control cdna reaction), each reaction in triplicate. dct values were calculated by subtracting the average Ct value of the RT samples from the cdna samples. The ddct values were generated by subtracting the dct of the β-actin reference samples from the dct of the test reactions. Relative expression of the wild-type cdnas versus the fusion cdnas was calculated by converting the ddct into inverse log 2 values (2^-ddCT). The wildtype cdnas were assigned nominal values of 100% expression, and the reciprocal fusions % expression were determined relative to 100%. The identity of the Mll-Enl fusion RT-PCR product was verified by performing PCR on the MEK 5 cdna, using the cycling conditions as used for the QPCR (initial denaturation at 95 0 C x 20sec, then 40 cycles of 95 0 C x 3sec, 60 0 C x 30sec, with a final extension

6 at 72 0 C x 5minutes). PCR products were cloned into pgem T-Easy vector (Promega) and sequenced using using the T7 promoter forward primer.

Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping

Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as