PCR-based Markers and Cut Flower Longevity in Carnation

Size: px
Start display at page:

Download "PCR-based Markers and Cut Flower Longevity in Carnation"

Transcription

1 PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso Inglesi 508, Sanremo (IM), Italy * Istituto Sperimentale per la Floricoltura, Pescia (PT), Italy Keywords: Dianthus caryophyllus, postharvest, RAPD analysis, ethylene, polymorphism, assisted selection Abstract In carnation, the identification of molecular markers linked to flower vase life character could be an important tool to improve the efficiency of breeding programs, considering that this is one of the most important traits selected by breeders. Longevity is probably a complex quantitative trait, involving several genes showing predominantly additive effects. A previous study carried out on cv. Roland, cv. Milady, and their progenies showed that some RAPD bands significantly discriminated a population with longer vase life. With the aim to verify the general use of these markers for assisted selection, 12 commercial varieties of carnation were collected and analyzed with the RAPD technique. The 23 fragments produced with ten decamers were not able to discriminate the genotypes with greater vase life. In order to identify more effective markers, preliminary analyses were also conducted on four genotypes, using 30 primer sets designed to amplify internal sequences from ethylene biosynthesis and response pathway genespcr products were obtained with 22 primer pairs, and some polymorphic fragments were observed even in the agarose gels. INTRODUCTION The postharvest longevity of flowers is of crucial importance in determining the value of an ornamental crop. Carnation (Dianthus caryophyllus L.) is one of the leading commodities in the ornamental industry worldwide. In this species, vase life is one of the most important traits considered by breeders. Research on postharvest physiology in carnation has been carried out in our Institute since 1992: the role of ethylene in flower senescence was investigated and several genotypes with different postharvest life and climateric behaviours, were identified (Burchi et al., 1993). Analysis of the segregation of flower vase life indicated that this character is probably a complex quantitative trait, involving more than a single gene or mechanism, and that these genes show predominantly additive effects (Burchi et al., 1999). Molecular markers associated with this character were previously identified in the progenies of a cross between two cultivars with different longevity ( Roland and Milady ), using the RAPD technique (De Benedetti et al., 2003). The aim of this study was to evaluate if these markers, tested on other collected genotypes, could be proposed as a general model for the assisted selection of vase life in carnation. Another approach, in order to identify other useful and effective markers, was the use of specific primers to obtain amplification of ethylene biosynthesis and response pathway genes. MATERIALS AND METHODS Plant Material and DNA Extraction Twelve Dianthus caryophyllus genotypes, obtained from the private breeder Hybrida, SanremoItaly, and 2 cultivars ( Roland and Milady ), belonging to the Experimental Institute of Floriculture collections, were analysed. Roland had the longest vase life with late and very low ethylene production in comparison with other cultivars, Proc. V th IS on New Flor. Crops Eds.: A.F.C. Tombolato and G.M. DiasTagliacozzo Acta Hort. 683, ISHS

2 such as Milady, in which ethylene released by the flower promoted and accelerated senescence (Burchi et al. 1999). The commercial varieties included standard and spray Mediterranean ecotypes. Six varieties ( , , , 98076, and ) were characterized by extended longevity (>16 days; trials conducted in March 2003, at 23 C with 75% relativity humidity); the remaining individuals ( 99109, 96118, , 92027, and ) showed lower values ( 12 days). DNA was extracted from 100 mg of young leaves using a commercial kit (DNAeasy Plant Mini Kit, Qiagen), according to the manufacturer s instructions. RAPD Analysis RAPD markers previously identified were analyzed in all genotypes using ten random decamers (De Benedetti et al., 2003). Conditions for PCR (Polymerase Chain Reaction) and electrophoresis separation were previously described (De Benedetti et al., 2001). Specific Primer Amplifications Sequences of carnation ethylene biosynthesis and regulation genes were downloaded from the NCBI database. Nine different accessions were selected and used for designing primers using the PRIMER 3 software. Primers were designed to be between 1824 bases long and to amplify internal regions of base pairs. Thirty primer sets were tested on four individuals ( Roland, Milady, and ). PCR was carried out in 50 μl reaction mixture containing 100 ng of template DNA, 1X buffer, 1.5 mm MgCl 2, 200 μm each of dctp, dgtp, datp and dttp, 10 picomoles of each primer, and 1.5 units of Taqpolymerase (Gibco B.R.L.) A thermal cycler PCR Express (Hybaid) was programmed for 30 cycles with the denaturation temperature at 94 C for 1 min and the extension temperature at 72 C for 1 min. The annealing temperature was calculated for each primer pairs using PRIMER 3. Amplification products were separated by electrophoresis on 1.2% agarose gels using TAE buffer (40 mm Trisacetate, 1mM EDTA) and visualized by ethidium bromide staining. RESULTS AND DISCUSSION A previous study carried out on Roland, Milady and their progenies showed that some RAPD bands significantly discriminated a population with greater flower longevity (De Benedetti et al., 2003). The amplification patterns of the commercial varieties were compared to Roland and Milady fragments (Table 1). A score was calculated based on the similarity of each of 23 bands analyzed with Roland (1) or Milady (0). The individuals with longer vase life did not show higher scores compared to the genotypes with shorter longevity. These RAPD bands were not able to discriminate the two groups. This could be explained by the high genetic similarity of this material, coming from the same breeder and selected since 1950 for longevity. More effective markers should be identified for the assisted selection of vase life characters in carnation genotypes. Molecular markers for candidate gene analysis can be identified, looking for polymorphisms in the genes involved in the expression of the character of interest and analyzing their cosegregation with the trait in a set of individuals with different phenotypes (Arus, 2000). With this aim, we started to analyze ethylene biosynthesis and regulation gene sequences using specific primer sets. Amplification products were obtained in four individuals using 22 primer pairs (Table 2). For three primer pairs (n. 8, 11 and 19) the agarose gel separation showed polymorphic fragments in cv. Roland (data not shown). The amplification of all individuals with these primers sets, showed polymorphic fragments for one combination in one of the varieties ( ) with greater vase life (Fig. 1). Further analyses, such as restriction site and SSCP (Single Stranded Conformation Polymorphism) analyses, will be performed on all samples to detect more polymorphism 438

3 and to find a possible correlation between different alleles and the cut flower longevity. The identification of markers linked to longevity could allow the early screening of a population with a long flower vase life and could make the selection procedure more effective. ACKNOWLEDGEMENTS Thanks to Dr. Flavio Sapia (Hybrida, Sanremo, Italy) for providing plant material. Literature Cited Arus, P Molecular Markers for Ornamental Breeding. Acta Hort. 508:9197. Burchi, G., MensualiSodi, A., Panizza, M. and Bianchini, C Preliminary results of molecular studies on senescence in carnation flowers ageing on plant or in vase: 1. Role of ethylene. Proc. XVIIth EUCARPIA Symposium, Sanremo, Italy, 15 March, p Burchi, G., Bianchini, C., Mercuri, A., Foglia, G., Rosellini, D. and Schiva, T Analysis of postharvest flower life in a cross between carnation cultivars with different ethylene responses. Journal of Genetics and Breeding 53: De Benedetti, L., Mercuri A., Bruna, S., Burchi, G. and Schiva, T Genotype Identification of Ornamental Species by RAPD Analysis. Acta Hort. 546: De Benedetti, L., Burchi, G., Bruna, S., Mercuri A. and Schiva, T Molecular Markers and Cut Flower Longevity in Carnation. Acta Hort. 624:

4 Tables Table 1. RAPD markers obtained in 14 genotypes with different vase life. RAPD Marker More Longeve Roland Less Longeve Milady Score / : presence or absence of an RAPD band. 440

5 Table 2. Primer pairs used to amplify carnation ethylene biosynthesis and regulation genes. Primer set Primer sequences (5 3 ) Gene Accession 1 ttc agg gag caa aag ttc aaa cgg tgc atc aca ctc ttg ta cct ggg cct tca ttt tga aa gtg ctc tcc caa tca atg tca t aac aat tat tcc gca gtt atg a ata caa ata ctg cgg gtg gg act ccg aaa tta gaa gcc gc ttg taa ttt gaa tga ata ctc cg DCACO1 (ACC oxidase) AB ttc agg gag caa aag ttc aaa cgt tat tta tag ttc att tga tta g atg atg gcg acc ttt gtg tt ttt gaa ctt ttg ctc cct gaa Similar to DCACO1 AB caa acc cgt caa atc cct ta taa ggt cgc att gtc cat gt CARACC (ACC synthase) M aat taa cga aca tgg caa aca aca atg gag tgt ttc atg gga cag ctc ctc aag gat ggt ca att gta att tga atg aat act ccg t Senescence related protein M gct ttt tga aac ttg att ttt ctt tt ttt cgg ctt att gca gct aaa ttc aac tcc aac aaa tcc acc ttt gtt cac gct tca ttt cg tct tga tat tgt tgt aga acc gtc tt cca gtc atg cac att tcc ag gcsdc 9 (SAM decarboxylase) U

6 Table 2. (Continued) Primer set 13 gaa atg gca cgt tta ctc gg gaa aca atc aat tat tcc aaa cca Primer sequences (5 3 ) Gene Accession gcsdc 9 (SAM decarboxylase) U cgc aaa ctt ctg aag ctg ct cca acc gat aag ctg cca a CTR1 (Putative proteine kinase) AF aaa ctg cta agc tgc ttc tgc ctt tta att tgg cat cac tac gac CTR2 (Putative proteine kinase) AF gat ttg gct tag aac gct gc tcg agg gtg ctt ctg atc tt aac aga acg aca tgt aag aat gc ata act gac aag aat tcg tta cga g cac aat gtc gct tta gat tta gca ttg agc tca caa acc tgc ac ccg tct taa gcg atg gct att cag ggg aac ctt caa aaa gt DCERS (putative ethylene receptor) U tca tca tca tct atg atc acc gt gca ctt tct ttg gca gtc atc gta cgt cag tca aag tgc ttg c cct ggt tat tgt ttt tcc cg tcg cag ttt caa atc gac aa tgc ata ctg ttt act aac gga ttt EIL1(ethyleneinsensitive3like protein 1) AF

7 Figures Fig. 1. Amplification of an internal region of the senescence related protein gene. (primer pair number 8). M: PCR marker (SigmaAldrich). 443

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

II 0.95 DM2 (RPP1) DM3 (At3g61540) b Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111

More information

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko

More information

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic

More information

Supporting Online Information

Supporting Online Information Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information. Construction of Lasso Peptide Fusion Proteins Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

Lecture 11: Gene Prediction

Lecture 11: Gene Prediction Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are

More information

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores. 1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction

More information

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA

More information

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa

More information

Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy

Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic

More information

The B1 Protein Guides the Biosynthesis of a Lasso Peptide

The B1 Protein Guides the Biosynthesis of a Lasso Peptide The B1 Protein Guides the Biosynthesis of a Lasso Peptide Shaozhou Zhu 1,2, Christopher D. Fage 1, Julian D. Hegemann 1, Andreas Mielcarek 1, Dushan Yan 1, Uwe Linne 1 & Mohamed A. Marahiel*,1 1 Department

More information

Codon Bias with PRISM. 2IM24/25, Fall 2007

Codon Bias with PRISM. 2IM24/25, Fall 2007 Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide

More information

Supplementary Information

Supplementary Information Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials

More information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary

More information

Supplemental Data. Distinct Pathways for snorna and mrna Termination

Supplemental Data. Distinct Pathways for snorna and mrna Termination Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A

More information

A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ

A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ Electronic Supplementary Material A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ Xiaoli Zhu 1, Hai Shi 1, Yalan Shen 1,

More information

Supplementary Material and Methods

Supplementary Material and Methods Supplementary Material and Methods Synaptosomes preparation and RT-PCR analysis. Synaptoneurosome fractions were prepared as previously described in 1. Briefly, rat total brain was homogenized in ice-cold

More information

Supporting Information

Supporting Information Supporting Information CLOSTRIDIOLYSIN S: A POST-TRANSLATIONALLY MODIFIED BIOTOXIN FROM CLOSTRIDIUM BOTULINUM David J. Gonzalez 1, Shaun W. Lee 9, Mary E. Hensler 6, Andrew L. Markley 1, Samira Dahesh

More information

Wet Lab Tutorial: Genelet Circuits

Wet Lab Tutorial: Genelet Circuits Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic

More information

Supporting Information. Table of Contents

Supporting Information. Table of Contents Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2015 Supporting Information Spatial Regulation of a Common Precursor from Two Distinct Genes

More information

Engineering Escherichia coli for production of functionalized terpenoids using plant P450s

Engineering Escherichia coli for production of functionalized terpenoids using plant P450s Supplementary Information for Engineering Escherichia coli for production of functionalized terpenoids using plant P450s Michelle C. Y. Chang, Rachel A. Eachus, William Trieu, Dae-Kyun Ro, and Jay D. Keasling*

More information

A netlike rolling circle nucleic acid amplification technique

A netlike rolling circle nucleic acid amplification technique Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2014 Supplementary Information A netlike rolling circle nucleic acid amplification technique Xiaoli Zhu,

More information

Chapter 13 Chromatin Structure and its Effects on Transcription

Chapter 13 Chromatin Structure and its Effects on Transcription Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.

More information

FROM DNA TO GENETIC GENEALOGY Stephen P. Morse

FROM DNA TO GENETIC GENEALOGY Stephen P. Morse 1. GENES, CHROMOSOMES, AND DNA Chromosomes FROM DNA TO GENETIC GENEALOGY Stephen P. Morse (steve@stevemorse.org) Every human cell = 46 chromosomes (1 to 22 in pairs, 2 sex chromosomes) Male: sex chromosomes

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum

More information

MCB421 FALL2005 EXAM#3 ANSWERS Page 1 of 12. ANSWER: Both transposon types form small duplications of adjacent host DNA sequences.

MCB421 FALL2005 EXAM#3 ANSWERS Page 1 of 12. ANSWER: Both transposon types form small duplications of adjacent host DNA sequences. Page 1 of 12 (10pts) 1. There are two mechanisms for transposition used by bacterial transposable elements: replicative (Tn3) and non-replicative (Tn5 and Tn10). Compare and contrast the two mechanisms

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany Site-Specific Control of Distances between Gold Nanoparticles using Phosphorothioate Anchors on DNA and a Short Bifunctional Molecular Fastener

More information

PROTEIN SYNTHESIS Study Guide

PROTEIN SYNTHESIS Study Guide PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the

More information

Chapter 3: Information Storage and Transfer in Life

Chapter 3: Information Storage and Transfer in Life Chapter 3: Information Storage and Transfer in Life The trapped scientist examples are great for conceptual purposes, but they do not accurately model how information in life changes because they do not

More information

1.) Draw the structure of guanine. Indicate where the hydrogen bonds form with cytosine. (4pts)

1.) Draw the structure of guanine. Indicate where the hydrogen bonds form with cytosine. (4pts) Name Student ID# p 1.) Draw the structure of guanine. Indicate where the hydrogen bonds form with cytosine. (4pts) hydrogen bonds form at these sites O HN HN H N N R Microbial Genetics BIO 410/510 Fall

More information

PILRα Is a Herpes Simplex Virus-1 Entry Coreceptor That Associates with Glycoprotein B

PILRα Is a Herpes Simplex Virus-1 Entry Coreceptor That Associates with Glycoprotein B Satoh et al. Page S1 Cell, Volume 132 PILRα Is a Herpes Simplex Virus-1 Entry Coreceptor That Associates with Glycoprotein B Takeshi Satoh, Jun Arii, Tadahiro Suenaga, Jing Wang, Amane Kogure, Junji Uehori,

More information

Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires

Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Supporting information for the paper: Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Fuan Wang, Johann Elbaz, Ron Orbach, Nimrod Magen and Itamar Willner*

More information

Lezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi

Lezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins

More information

Sadaf Haghiri PhD student at Environmental engineering faculty Middle East Technical University. Supervisor: Assoc. Prof. Dr.

Sadaf Haghiri PhD student at Environmental engineering faculty Middle East Technical University. Supervisor: Assoc. Prof. Dr. Sadaf Haghiri PhD student at Environmental engineering faculty Middle East Technical University Supervisor: Assoc. Prof. Dr. Bülent İçgen October 2016 2 Outline Intoduction Motivation for this research

More information

Circular bivalent aptamers enable in vivo stability and recognition

Circular bivalent aptamers enable in vivo stability and recognition Supporting Information Circular bivalent aptamers enable in vivo stability and recognition Hailan Kuai,, Zilong Zhao,, Liuting Mo, Hui Liu, Xiaoxiao Hu, Ting Fu, Xiaobing Zhang, Weihong Tan*,, Molecular

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Xie YL, Chakravorty S, Armstrong DT, et al. Evaluation of a

More information

Supplemental Data. Lin28 Mediates the Terminal Uridylation. of let-7 Precursor MicroRNA. Molecular Cell, Volume 32

Supplemental Data. Lin28 Mediates the Terminal Uridylation. of let-7 Precursor MicroRNA. Molecular Cell, Volume 32 Molecular Cell, Volume 32 Supplemental Data Lin28 Mediates the Terminal Uridylation of let-7 Precursor MicroRNA Inha Heo, Chirlmin Joo, Jun Cho, Minju Ha, Jinju Han, and V. Narry Kim Figure S1. Endogenous

More information

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was

More information

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010 Engineering D66N mutant using quick change site directed mutagenesis Harkewal Singh 09/01/2010 1 1- What is quick change site directed mutagenesis? 2- An overview of the kit contents. 3- A brief information

More information

Sequence Design for DNA Computing

Sequence Design for DNA Computing Sequence Design for DNA Computing 2004. 10. 16 Advanced AI Soo-Yong Shin and Byoung-Tak Zhang Biointelligence Laboratory DNA Hydrogen bonds Hybridization Watson-Crick Complement A single-stranded DNA molecule

More information

Interpretation of sequence results

Interpretation of sequence results Interpretation of sequence results An overview on DNA sequencing: DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It use a modified PCR reaction where both

More information

DNA extraction. ITS amplication and sequencing. ACT, CAL, COI, TEF or TUB2 required for species level. ITS identifies to species level

DNA extraction. ITS amplication and sequencing. ACT, CAL, COI, TEF or TUB2 required for species level. ITS identifies to species level DNA extraction ITS amplication and sequencing ITS identifies to species level Ceratocystis fagacearum Ceratocystis virescens Melampsora medusae (only to species) Mycosphaerella laricis-leptolepidis Phaeoramularia

More information

A high efficient electrochemiluminescence resonance energy. transfer system in one nanostructure: its application for

A high efficient electrochemiluminescence resonance energy. transfer system in one nanostructure: its application for Supporting Information for A high efficient electrochemiluminescence resonance energy transfer system in one nanostructure: its application for ultrasensitive detection of microrna in cancer cells Zhaoyang

More information

Best practices for Variant Calling with Pacific Biosciences data

Best practices for Variant Calling with Pacific Biosciences data Best practices for Variant Calling with Pacific Biosciences data Mauricio Carneiro, Ph.D. Mark DePristo, Ph.D. Genome Sequence and Analysis Medical and Population Genetics carneiro@broadinstitute.org 1

More information

Int J Clin Exp Med 2014;7(9): /ISSN: /IJCEM Jin Ah Ryuk *, Young Seon Kim *, Hye Won Lee, Byoung Seob Ko

Int J Clin Exp Med 2014;7(9): /ISSN: /IJCEM Jin Ah Ryuk *, Young Seon Kim *, Hye Won Lee, Byoung Seob Ko Int J Clin Exp Med 2014;7(9):2488-2496 www.ijcem.com /ISSN:1940-5901/IJCEM0001438 Original Article Identification of Acorus gramineus, A. calamus, and A. tatarinowii using sequence characterized amplified

More information

Meixia Li, Chao Cai, Juan Chen, Changwei Cheng, Guofu Cheng, Xueying Hu and Cuiping Liu

Meixia Li, Chao Cai, Juan Chen, Changwei Cheng, Guofu Cheng, Xueying Hu and Cuiping Liu S1 of S6 Supplementary Materials: Inducible Expression of both ermb and ermt Conferred High Macrolide Resistance in Streptococcus gallolyticus subsp. pasteurianus Isolates in China Meixia Li, Chao Cai,

More information

Cloning and characterization of a cdna encoding phytoene synthase (PSY) in tea

Cloning and characterization of a cdna encoding phytoene synthase (PSY) in tea African Journal of Biotechnology Vol. 7 (20), pp. 3577-3581, 20 October, 2008 Available online at http://www.academicjournals.org/ajb ISSN 1684 5315 2008 Academic Journals Full Length Research Paper Cloning

More information

MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46

MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46 MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46 INTRODUCTION The mammalian MPR 46 (human, mouse, bovine) sequences show extensive homologies. Among the non-mammalian vertebrates, only a partial sequence

More information

High-throughput cloning and expression in recalcitrant bacteria

High-throughput cloning and expression in recalcitrant bacteria High-throughput cloning and expression in recalcitrant bacteria Eric R Geertsma & Bert Poolman Supplementary text and figures: Supplementary Figure 1 Frequency of SfiI sites yielding identical 3 extensions

More information

Nucleic Acids Research

Nucleic Acids Research Volume 10 Number 1 1982 VoLume 10 Number 11982 Nucleic Acids Research Nucleic Acids Research A convenient and adaptable package of DNA sequence analysis programs for microcomputers James Pustell and Fotis

More information

Supplemental Data. Polymorphic Members of the lag Gene. Family Mediate Kin Discrimination. in Dictyostelium. Current Biology, Volume 19

Supplemental Data. Polymorphic Members of the lag Gene. Family Mediate Kin Discrimination. in Dictyostelium. Current Biology, Volume 19 Supplemental Data Polymorphic Members of the lag Gene Family Mediate Kin Discrimination in Dictyostelium Rocio Benabentos, Shigenori Hirose, Richard Sucgang, Tomaz Curk, Mariko Katoh, Elizabeth A. Ostrowski,

More information

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

More information

Supplemental Data. Short Article. Transcriptional Regulation of Adipogenesis by KLF4. Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman

Supplemental Data. Short Article. Transcriptional Regulation of Adipogenesis by KLF4. Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman Cell Metabolism, Volume 7 Supplemental Data Short Article Transcriptional Regulation of Adipogenesis by KLF4 Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman Supplemental Experimental Procedures Plasmids

More information

The HLA system. The Application of NGS to HLA Typing. Challenges in Data Interpretation

The HLA system. The Application of NGS to HLA Typing. Challenges in Data Interpretation The Application of NGS to HLA Typing Challenges in Data Interpretation Marcelo A. Fernández Viña, Ph.D. Department of Pathology Medical School Stanford University The HLA system High degree of polymorphism

More information

SUPPLEMENTARY INFORMATION. doi: /nature08559

SUPPLEMENTARY INFORMATION. doi: /nature08559 Supplementary Materials and methods Genetic constructs: Construction of prophoa-his, prophoa(l8q)-his, prophoa(l14r)-his, PhoA(Δ2-22)-His and prophoa(1-62)-his for purification purposes: prophoa-his 6

More information

Codon bias and gene expression of mitochondrial ND2 gene in chordates

Codon bias and gene expression of mitochondrial ND2 gene in chordates www.bioinformation.net Hypothesis Volume 11(8) Codon bias and gene expression of mitochondrial ND2 gene in chordates Arif Uddin, Tarikul Huda Mazumder, Monisha Nath Choudhury & Supriyo Chakraborty* Department

More information

(10) Patent No.: US 7,070,959 B1

(10) Patent No.: US 7,070,959 B1 US007070959B1 (12) United States Patent Papadopoulos et al. (54) (75) (73) (*) (21) (22) (86) (87) (60) (51) (52) (58) (56) MODIFIED CHMERC POLYPEPTDES WITH IMPROVED PHARMACOKINETIC PROPERTIES Inventors:

More information

Supplemental Data. Sheerin et al. (2015). Plant Cell /tpc h FR lifetime (ns)

Supplemental Data. Sheerin et al. (2015). Plant Cell /tpc h FR lifetime (ns) A CFP YFP Merge phya-cfp YFP-SPA1 D phya-cfp YFP-SPA1 6 h FR phya-nls-cfp YFP-SPA3 phya-nls-cfp YFP-SPA4 B n P value phya-nls-cfp 31 - phya-nls-cfp YFP-SPA3 8 0.02 phya-nls-cfp YFP-SPA4 9 0.48 1.6 1.8

More information

Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.

Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates. Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after

More information

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information Ultrasensitive and Selective DNA Detection Based on Nicking Endonuclease Assisted Signal Amplification and Its Application in Cancer Cells Detection Sai Bi, Jilei Zhang,

More information

CHAPTER II MATERIALS AND METHODS. Cell Culture and Plasmids. Cos-7 cells were maintained in Dulbecco s modified Eagle medium (DMEM,

CHAPTER II MATERIALS AND METHODS. Cell Culture and Plasmids. Cos-7 cells were maintained in Dulbecco s modified Eagle medium (DMEM, CHAPTER II MATERIALS AND METHODS Cell Culture and Plasmids Cos-7 cells were maintained in Dulbecco s modified Eagle medium (DMEM, BioWhittaker Inc,Walkersville, MD) containing 10% fetal bovine serum, 50

More information

Catalog nos , , , ,

Catalog nos , , , , Instruction Manual Gateway pentr Vectors Catalog nos. 11813-011, 11816-014, 11817-012, 11818-010, 11819-018 Version B 23 November 2004 25-0521 A Limited Label License covers this product (see Purchaser

More information

Supplemental Data. The Survival Advantage of Olfaction. in a Competitive Environment. Supplemental Experimental Procedures

Supplemental Data. The Survival Advantage of Olfaction. in a Competitive Environment. Supplemental Experimental Procedures Supplemental Data The Survival Advantage of Olfaction in a Competitive Environment Kenta Asahina, Viktoryia Pavlenkovich, and Leslie B. Vosshall Supplemental Experimental Procedures Experimental animals

More information

Protocol T45 Community Reference Laboratory for GM Food and Feed

Protocol T45 Community Reference Laboratory for GM Food and Feed EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification

More information

2.1 Calculate basic statistics

2.1 Calculate basic statistics 2.1 Calculate basic statistics The next part is an analysis performed on a FASTA formatted file containing complete genomic DNA (*.dna), not genes or proteins. Calculate the AT content (Per.AT), number

More information

Thr Gly Tyr. Gly Lys Asn

Thr Gly Tyr. Gly Lys Asn Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human

More information

Programmable RNA microstructures for coordinated delivery of sirnas

Programmable RNA microstructures for coordinated delivery of sirnas Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Programmable RNA microstructures for coordinated delivery of sirnas Jaimie Marie Stewart, Mathias

More information

Olerup SSP KIR Genotyping

Olerup SSP KIR Genotyping KIR Genotyping Product Insert Page 1 of 16 Olerup SSP KIR Genotyping Product number: Lot number: 98V Expiry date: 2016-December-01 Number of tests: 12 Number of wells per test: 23 + 1 Storage - pre-aliquoted

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Blanken MO, Rovers MM, Molenaar JM, et al. Respiratory syncytial

More information

Modular Design of Ultrahigh-Intensity Nanoparticle Probe for Cancer Cell Imaging and Rapid Visual Detection of Nucleic Acid

Modular Design of Ultrahigh-Intensity Nanoparticle Probe for Cancer Cell Imaging and Rapid Visual Detection of Nucleic Acid Supporting Information for Modular Design of Ultrahigh-Intensity Nanoparticle Probe for Cancer Cell Imaging and Rapid Visual Detection of Nucleic Acid Hua Zhong, Rumin Zhang, Hui Zhang, Shusheng Zhang*

More information

2.5. Equipment and materials supplied by user Template preparation by cloning into plexsy_invitro-2 vector 4. 6.

2.5. Equipment and materials supplied by user Template preparation by cloning into plexsy_invitro-2 vector 4. 6. Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae contains the vector plexsy_invitro-2 Cat. No. EGE-2002-15 FOR RESEARCH USE ONLY. NOT INTENDED

More information

Universal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation

Universal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting materials Universal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation

More information

Research Note. Evaluation of PCR-based approach for serotype determination of Streptococcus pneumoniae

Research Note. Evaluation of PCR-based approach for serotype determination of Streptococcus pneumoniae Tropical Biomedicine 30(2): 338 344 (2013) Research Note Evaluation of PCR-based approach for serotype determination of Streptococcus pneumoniae Shakrin, N.N.S.M. 1, Balasubramaniam, S.D. 2, Yusof, H.A.

More information

Antigenic Variation of Ehrlichia chaffeensis Resulting from Differential Expression of the 28-Kilodalton Protein Gene Family

Antigenic Variation of Ehrlichia chaffeensis Resulting from Differential Expression of the 28-Kilodalton Protein Gene Family INFECTION AND IMMUNITY, Apr. 2002, p. 1824 1831 Vol. 70, No. 4 0019-9567/02/$04.00 0 DOI: 10.1128/IAI.70.4.1824 1831.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Antigenic

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/319/5867/1241/dc1 Supporting Online Material for Local Positive Feedback Regulation Determines Cell Shape in Root Hair Cells Seiji Takeda, Catherine Gapper, Hidetaka

More information

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol Event-specific Method for the Quantification of Soybean Line A2704-12 Using Real-time PCR Protocol 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer Protection Biotechnology

More information

Sexing Bovine Preimplantation Embryos by PCR

Sexing Bovine Preimplantation Embryos by PCR Sexing Bovine Preimplantation Embryos by PCR Katherine E.M. Hendricks 1, Leydson F. Martins 2, Justin M. Fear 1 and Peter J. Hansen 1 1 Dept. of Animal Sciences, University of Florida and Department of

More information

US 7,074,904 B2. Wong et al. Jul. 11, (45) Date of Patent: (10) Patent No.: (12) United States Patent (54) (75)

US 7,074,904 B2. Wong et al. Jul. 11, (45) Date of Patent: (10) Patent No.: (12) United States Patent (54) (75) US007074904B2 (12) United States Patent Wong et al. (10) Patent No.: (45) Date of Patent: US 7,074,904 B2 Jul. 11, 2006 (54) (75) (73) (*) (21) (22) (65) (63) (51) (52) (58) (56) WO WO WO WO WO WO WO MHC

More information

DRACULA2 is a dynamic nucleoporin with a role in regulating the shade. Marçal Gallemí, Anahit Galstyan, Sandi Paulišić, Christiane Then, Almudena

DRACULA2 is a dynamic nucleoporin with a role in regulating the shade. Marçal Gallemí, Anahit Galstyan, Sandi Paulišić, Christiane Then, Almudena DRACULA2 is a dynamic nucleoporin with a role in regulating the shade avoidance syndrome in Arabidopsis. Marçal Gallemí, Anahit Galstyan, Sandi Paulišić, Christiane Then, Almudena Ferrández-Ayela, Laura

More information

Application of DNA machine in amplified DNA detection

Application of DNA machine in amplified DNA detection Electronic Supplementary Information Application of DNA machine in amplified DNA detection Hailong Li, Jiangtao Ren, Yaqing Liu,* and Erkang Wang* State Key Lab of Electroanalytical Chemistry, Changchun

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/10/e1501164/dc1 Supplementary Materials for Cellular defense against latent colonization foiled by human cytomegalovirus UL138 protein Song Hee Lee, Emily R.

More information

In-Fusion Advantage PCR Cloning Kit

In-Fusion Advantage PCR Cloning Kit User Manual In-Fusion Advantage PCR Cloning Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Supplementary Information. A chloroplast envelope bound PHD transcription factor mediates. chloroplast signals to the nucleus

Supplementary Information. A chloroplast envelope bound PHD transcription factor mediates. chloroplast signals to the nucleus Supplementary Information A chloroplast envelope bound PHD transcription factor mediates chloroplast signals to the nucleus Xuwu Sun, Peiqiang Feng, Xiumei Xu, Hailong Guo, Jinfang Ma, Wei Chi, Rongchen

More information

Supplementary information. USE1 is a bispecific conjugating enzyme for ubiquitin and FAT10. which FAT10ylates itself in cis

Supplementary information. USE1 is a bispecific conjugating enzyme for ubiquitin and FAT10. which FAT10ylates itself in cis Supplementary information USE1 is a bispecific conjugating enzyme for ubiquitin and FAT10 which FAT10ylates itself in cis Annette Aichem 1, Christiane Pelzer 2, Sebastian Lukasiak 2, Birte Kalveram 2,

More information

Supporting Information

Supporting Information Gorin et al. Supporting Information page S1 Supporting Information Reactivity-Dependent PCR: Direct, Solution-Phase In Vitro Selection for Bond Formation David J. Gorin, Adam S. Kamlet, and David R. Liu*

More information

Mutations in the Human ATP-Binding Cassette Transporters ABCG5 and ABCG8 in Sitosterolemia

Mutations in the Human ATP-Binding Cassette Transporters ABCG5 and ABCG8 in Sitosterolemia HUMAN MUTATION Mutation in Brief #518 (2002) Online MUTATION IN BRIEF Mutations in the Human ATP-Binding Cassette Transporters ABCG5 and ABCG8 in Sitosterolemia Susanne Heimerl 1, Thomas Langmann 1, Christoph

More information