Superior accuracy and speed MicroSEQ Rapid Microbial Identification System
|
|
|
- Amber Hines
- 6 years ago
- Views:
Transcription
1 Superior accuracy and speed MicroSEQ Rapid Microbial Identification System Featuring the 3500 Genetic Analyzer
2 Achieve right-the-fi rst-time microbial identifi cation Next-generation, high-throughput comparative DNA sequencing system for identifi cation of bacteria and fungi The answer is in the DNA Harmful bacteria and fungi can contaminate raw materials, production facilities, and even worse, branded products. A The Applied Biosystems MicroSEQ Rapid Microbial Identifi cation System (Figure 1) uses a highly accurate phylogenetic approach for microbial identifi cation based on the sequencing of the 16S rrna gene for bacteria or the D2 region of the large subunit for fungi, and the comparison of the sequences to those in its validated libraries. B D After sequencing the rrna gene, the MicroSEQ Rapid system automatically compares the results to validated sequences in the Applied Biosystems MicroSEQ microbial libraries. The results are ranked according to genetic distance of the reference sequences to the sample and displayed on the system monitor along with a phylogenetic tree (Figure 2). C Figure 1. The MicroSEQ Rapid Microbial Identification System with Applied Biosystems components. (A) 3500 and 3500xL DNA sequencing instruments; (B) MicroSEQ ID Analysis Software with 3 libraries; (C) Fast MicroSEQ Bacterial S ID Kit, Fast MicroSEQ Fungal D2 ID Kit, MicroSEQ Full Gene 16S ID Kit; (D) Veriti Thermal Cycler. The system includes the largest fully validated bacterial and fungal libraries. The bacterial library includes over 2,000 species, including Staphylococcus spp., Bacillus spp., coryneforms, mycobacteria, and Gram-negative nonfermenters. The library for fungal species includes over 1,100 entries. Both are frequently updated and expanded with new entries. Specimen 1: P. syringae DSM=1856 AAAGGCGGCTTTGCTGTCACTTATA G A T GGATCCG C G C AAAGGCGGC TTTG C T G T C A C TTA T A G A T GGA T CCG C G C Figure 2. MicroSEQ report. Genetic distance from reference sample and phylogenetic tree.
3 DNA-based amplifi cation and sequencing results are faster, more sensitive, more accurate, and more reproducible than current microbiological methods. Dr. Robert Johnson Director, Dialogue (Switzerland) Generate actionable results in less than 5 hours With the MicroSEQ Rapid Microbial ID System, bacteria and fungi can be identifi ed in under 5 hours, using a logical workfl ow that requires minimum hands-on time (Figure 3). A single, standardized procedure is used for identifying both bacterial and fungal isolates. Identification in under 5 hours. NEW With the data collection analysis software (Figure 4), the system delivers a guided setup process and performs the analysis with limited interaction from the user. NEW No Gram staining or ancillary tests are required to achieve the highest level of accuracy in the miminum amount of time. Qualify with ease, use with success To help ensure seamless integration into your laboratory from installation to routine operation, we offer comprehensive installation and operational qualifi cation (IQ/OQ) and validation support services. Figure 3. Easy 5-step workflow. Simple process steps from colony to results. The program includes: Consultation with client to determine needs for training, system installation, and validation timelines and plans System software installation, operation, and security verifi cation Installation Qualifi cation (IQ) protocol and service Operational (OQ) Qualifi cation protocol and service Detailed data analysis and review Consultation on laboratory workfl ow Figure 4. Data analysis. Easy-to-use sample input screens with automated data analysis. Performance qualifi cation (PQ) recommended guidelines
4 Increased throughput with greater ease of use The MicroSEQ Rapid Microbial ID System powered by the 3500 Series Genetic Analyzer simplifi es the user experience and enables faster identifi cations for the laboratory. A Plug-and-play capillary array and consumables (Figure 5) Consumables dashboard monitor (Figure 6) Automated consumable usage tracking B Simple on-screen navigation with automated maintenance tracking Figure Series Genetic Analyzer. (A) Prepacked consumables, and (B) expanded capillary array. Figure 6. Consumables dashboard. Easy-to-understand, real-time information on consumable status. Benefit from worldwide implementation and support Our distribution and service network, composed of highly trained support and application personnel, reaches 150 countries on six continents. In addition to basic service and support, the following additional services are offered for the MicroSEQ Rapid Microbial ID System: On-site workfl ow and data analysis training Validation guidance
5 Top researchers worldwide use the MicroSEQ Rapid Microbial Identification System Ideal for: Environmental monitoring Contamination investigation Root cause analysis Raw material testing Drain-line_3 Pseudomonas aeruginosa ATCC = Pseudomonas aeruginosa ATCC = Pseudomonas citronellolis Pseudomonas stutzeri Pseudomonas nitroreducens Pseudomonas monteilii Pseudomonas oleovorans Pseudomonas pseudoalcaligenes
6 Ordering information Description Cat. No. System MicroSEQ Rapid Microbial ID System with 3500 Genetic Analyzer MicroSEQ Rapid Microbial ID System with 3500xL Genetic Analyzer Software MicroSEQ ID Analysis Software Bundle MicroSEQ ID v Installation and IQ/OQ IQ/OQ, 3500 MSID Service IQ/OQ, 3500xL MSID Service Kits Fast MicroSEQ S rdna PCR Kit, with protocol and quick reference card MicroSEQ S rdna Sequencing Kit, with protocol and quick reference card MicroSEQ Full Gene 16S rdna PCR Kit, with protocol and quick reference card MicroSEQ Full Gene 16S rdna Sequencing Kit, with protocol and quick reference card Fast MicroSEQ D2 rdna Fungal Identification Kit, with protocol and quick reference card MicroSEQ D2 rdna Fungal Sequencing Kit, with protocol and quick reference card Find out more at thermofisher.com/microseq For Research Use Only. Not for use in diagnostic procedures Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. COL
The right answer, every time
MICROSEQ MICROBIAL IDENTIFICATION SYSTEM The right answer, every time Definitive identification of bacterial and fungal isolates. Accuracy adds confidence. When microbial contamination poses problems,
MicroSEQ Rapid Microbial Identification System
MicroSEQ Rapid Microbial Identification System Giving you complete control over microbial identification using the gold-standard genotypic method The MicroSEQ ID microbial identification system, based
A risk based approach to managing environmental excursions
A risk based approach to managing environmental excursions RACI: Monitoring & protecting your GMP facility s Environment 20 th April Ngoc Anh-Thu Phan www.eurofins.com Content Introduction Risk Assessment
Minimise risk. Maximise competitive edge.
Minimise risk. Maximise competitive edge. Innovative food and environmental safety solutions optimised for your unique needs It s time to put your pathogen testing to the test When the world s biggest
Implementation of the VITEK MS and Its Use in Microbial Identification
Implementation of the VITEK MS and Its Use in Microbial Identification K a t a l i n K i s s, P h. D., P M P M a n a g e r, S c i e n t i s t, L a b o r a t o r y Te s t i n g S e r v i c e s, AT C C O
SeCore SBT Sequence Based Typing
MOLECULAR TYPING Product Brochure SeCore SBT Sequence Based Typing Key Benefits SeCore HLA typing kits combine the accuracy of bidirectional sequencing and the power and flexibility of our improved sequence
RiboPrinter microbial characterization system
DuPont Qualicon RiboPrinter microbial characterization system Staphylococcus epidermidis RiboGroup 102-45-3 DEDICATED TO MICROBIOLOGY OK. You found it. Now what? RiboPrinter microbial characterization
Product selection guide Ion S5 and Ion S5 XL Systems
Product selection guide Ion S5 and s Cancer genomics research Molecular profiling Ion AmpliSeq Ready-to-Use Panels Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels
Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
PRECISE AND POWERFUL MOLECULAR PATHOGEN DETECTION
PRECISE AND POWERFUL MOLECULAR PATHOGEN DETECTION RAPID FOOD SAFETY YOU CAN RELY ON Food companies, service labs and government regulators around the world rely on the Hygiena BAX System, which uses the
At Your ServIce. Microbiology Services. The life science business of Merck operates as MilliporeSigma in the U.S. and Canada.
At Your ServIce Microbiology Services The life science business of Merck operates as MilliporeSigma in the U.S. and Canada. Microbiology Services Optimize your QC lab workflow and ensure regulatory compliance
Accessible answers. Targeted sequencing: accelerating and amplifying answers for oncology research
Accessible answers Targeted sequencing: accelerating and amplifying answers for oncology research Help advance precision medicine Accelerate results with Ion Torrent NGS Life without cancer. This is our
cgmp/iso CLIA Experience Unsurpassed Quality
Cert. No. 2254.01 cgmp/iso-17025-2005 CLIA Experience Unsurpassed Quality Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending Microbial Identification
Molecular Diagnostics OEM and Commercial Supply Services. Your partners for success
Molecular Diagnostics OEM and Commercial Supply Services Your partners for success We enable the success of our molecular diagnostics partners in the development and commercialization of integrated solutions
Providing clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting
Providing clear solutions to microbiological challenges TM Cert. No. 2254.01 Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending cgmp/iso-17025-2005 CLIA
AccuSEQ v2.1 Real-Time PCR Detection and Analysis Software
DATA SHEET AccuSEQ Real-Time PCR Detection and Analysis Software AccuSEQ v2.1 Real-Time PCR Detection and Analysis Software Introduction Automated presence or absence calls for Applied Biosystems MycoSEQ
Direct PCR Amplification of Blood Samples on Copan NUCLEIC-CARD TM Systems Using the AmpFlSTR Identifiler Direct PCR Amplification Kit
Technical Focus Direct PCR Amplification of Blood Samples on Copan NUCLEIC-CARD TM Systems Using the AmpFlSTR Identifiler Direct PCR Amplification Kit Nicola Oldroyd, Jennifer Schroeder, Dennis Wang, Alessandro
A*01:02, 68:02 B*15:10, 58:02 DRB1*03:01, 12:01
lifetechnologies.com For In Vitro Diagnostic Use. The 3500 Dx and 3500xL Dx Genetic Analyzers CS2 and system accessories meet the requirements for IVD instrumentation in the United States. 2013 Life Technologies
Ion S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Introducing the Ion S5 and Ion S5 XL systems Now, adopting next-generation sequencing in your lab is simpler than ever. The Ion S5
Relative Fluorescent Quantitation on Capillary Electrophoresis Systems:
Application Note Relative Fluorescent Quantitation on the 3130 Series Systems Relative Fluorescent Quantitation on Capillary Electrophoresis Systems: Screening for Loss of Heterozygosity in Tumor Samples
Rapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform
Rapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform Alec Saitman, PhD, Jane Y. Yang PhD, Sharon Reed, David Pride, Michele
Product selection guide Ion GeneStudio S5 Series
Cancer genomics research Molecular profiling Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels (Customize your own or browse redesigned community panels at ampliseq.com)
Detection of the TMPRSS2:ERG fusion transcript
APPLICATION NOTE QuantStudio 3D Digital PCR System Detection of the :ERG fusion transcript Optimized workfl ow with TaqMan Assays and digital PCR Current biomedical research aims at personalized treatments
Microbial Identification for the Environmental Monitoring Arena Using MALDI-TOF
Microbial Identification for the Environmental Monitoring Arena Using MALDI-TOF Anne M. Russell, Ph.D. Senior Staff Scientist EMD anne.russell@crl.com Presentation Overview 1. Accugenix - History and Market
Thermal Cycling. Benefits. Features. ODTC - On Deck Thermal Cycler for 96 well or 384 well PCR plates
Thermal Cycling ODTC - On Deck Thermal Cycler for 96 well or 384 well PCR plates Benefits Top thermal performance Very fast runs Seamless on deck integration 24/7 automated operation Pipetting during PCR
Reliable. answers, significant savings. Applied Biosystems QuantStudio 5 Real-Time PCR System for Human Identification
Reliable answers, significant savings Applied Biosystems QuantStudio 5 Real-Time PCR System for Human Identification Discover the QuantStudio 5 Real-Time PCR System for Human Identification The modern
Thermo Scientific icap 7000 Series ICP-OES. Low cost ICP-OES analysis high quality data
Thermo Scientific icap 7000 Series ICP-OES Low cost ICP-OES analysis high quality data Thermo Scientific icap 7000 Series ICP-OES The NEW Thermo Scientific icap 7000 Series ICP-OES provides low cost multi-element
TaqPath ProAmp Master Mixes
PRODUCT BULLETIN es es Applied Biosystems TaqPath ProAmp Master Mixes are versatile master mixes developed for high-throughput genotyping and copy number variation (CNV) analysis protocols that require
FAST MicroSEQ S rdna Bacterial Identification Kit. Protocol
FAST MicroSEQ 500 16S rdna Bacterial Identification Kit Protocol For Research Use Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to
Expression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
MLPA assays on the SeqStudio Genetic Analyzer
APPLICATION NOTE MLPA assays on the SeqStudio Genetic Analyzer SeqStudio Genetic Analyzer In this application note, we demonstrate that: The new Applied Biosystems SeqStudio Genetic Analyzer generates
quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E.
quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E. coli, Vero, NS0 Precision counts Integrated real-time qpcr systems for quantitation of
Ion S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
Rapid Methods & Technologies
2013 Laboratory Conference: Unraveling the Mystery of Pharmaceutical Laboratory Science Rapid Methods & Technologies Finding the Guilty Party Faster! James Spedding MT (ASCP) EMD Millipore Lab Solutions
MAXimum results. Minimum effort.
MAXimum results. Minimum effort. MagMAX sample preparation for veterinary diagnostic testing Sometimes purifying nucleic acid from animal samples can be like trying to pull a needle out of a haystack.
What is it? Sherlock knows! Microbial Identification System
What is it? Sherlock knows! Microbial Identification System Sherlock Microbial Identification System Microbial ID 10 Minutes... $2.50 Is it accurate? Established technology with 15 years of clinical and
Technical Focus. Direct PCR Amplification of Buccal Samples on the NUCLEIC-CARD COLOR With the AmpFlSTR Identifiler Direct PCR Amplification Kit
Technical Focus Direct PCR Amplification of Buccal Samples on the COLOR With the AmpFlSTR Identifiler Direct PCR Amplification Kit Forensic News 2013 Alessandro Agostino 1, Annalisa Gervasoni 2, Alice
Precise quantification of Ion Torrent libraries on the QuantStudio 3D Digital PCR System
APPLICATION NOTE QuantStudio 3D Digital PCR System Precise quantification of Ion Torrent libraries on the QuantStudio 3D Digital PCR System Introduction The template preparation step in the next-generation
TaqMan Advanced mirna Assays
PRODUCT BULLETIN TaqMan Advanced mirna Assays TaqMan Advanced mirna Assays Key features Universal reverse transcription (RT) one RT step for all Applied Biosystems TaqMan Advanced mirna Assays Sensitive
PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System
PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,
ATCC Microbiology Best Practices for Stock Maintenance. C a r o l H o r t o n M a r ke t i n g M a n a g e r, AT C C
ATCC Microbiology Best Practices for Stock Maintenance C a r o l H o r t o n M a r ke t i n g M a n a g e r, AT C C About ATCC Founded in 1925, ATCC is a non-profit organization with headquarters in Manassas,
Isolation of Viral RNA, Viral DNA and Bacterial DNA from Animal Samples
Application Note Isolation of Viral RNA, Viral DNA and Bacterial DNA from Animal Samples Denis Flüge, Lillian Krüger, Sandy Leifholz and Holger Engel R&D Department, QIAGEN GmbH, QIAGEN Straße 1, Hilden,
QuantStudio 3D Digital PCR System
PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science
E.Z.N.A. Microorganism Direct PCR Kit
E.Z.N.A. Microorganism Direct PCR Kit TQ3100-00 TQ3100-01 TQ3100-02 20 preps 100 preps 500 preps June 2013 E.Z.N.A. Microorganism Direct PCR Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage
QuantStudio Dx Real-Time PCR Instrument
QuantStudio Dx Real-Time PCR Instrument Behind every diagnosis, there is a promise You believe in molecular medicine. So do we. We are committed to providing you with comprehensive solutions that help
MODULE 2D ENVIRONMENTAL MICROBIOLOGICAL LABORATORY ACCREDITATION PROGRAM (EMLAP) ADDITIONAL REQUIREMENTS
MODULE 2D ENVIRONMENTAL MICROBIOLOGICAL LABORATORY ACCREDITATION PROGRAM (EMLAP) ADDITIONAL REQUIREMENTS 2D.1 SCOPE The AIHA- Laboratory Accreditation Programs (AIHA-LAP), LLC s Environmental Microbiological
SeqStudio Genetic Analyzer
SeqStudio Genetic Analyzer Optimized for Sanger sequencing and fragment analysis Easy to use for all levels of experience From a leader in genetic analysis instrumentation, introducing the new Applied
GenPlex HID Training Class I
Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications
IQ VISION BUILDING MANAGEMENT SUPERVISOR
IQ VISION BUILDING MANAGEMENT SUPERVISOR 2 Introduction Trend is one of the world s leading Building Energy Management Systems manufacturers, with a worldwide distribution and support network covering
Maxwell RSC System. Next Generation Automated Purification and Quantitation
Maxwell RSC System Next Generation Automated Purification and Quantitation INTRODUCTION/OVERVIEW The Maxwell RSC System Your personal purification assistant. It easily integrates into any laboratory workflow,
MAXimum results. Minimum effort.
MAXimum results. Minimum effort. MagMAX sample preparation for veterinary diagnostic testing Sometimes purifying nucleic acid from animal samples can be like trying to pull a needle out of a haystack.
AmpFlSTR Identifiler PCR Amplification Kit
Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable
Simplify your pathogen testing. Amplify your confidence.
Simplify your pathogen testing. Amplify your confidence. 2 One protocol. Fewer steps. Better results. Be confident in the knowledge that your pathogen testing process is accurate and reliable with the
AccuSEQ Real-Time PCR Detection Software
Quick Reference Card AccuSEQ Real-Time PCR Detection Software Mycoplasma SEQ Experiments Note: For safety and biohazard guidelines, refer to the Safety section in the AccuSEQ Real-Time PCR Detection Software
PowerPlex Matrix Standards, 3100/3130
TECHNICAL BULLETIN PowerPlex Matrix Standards, 3100/3130 Instruc ons for use of Product DG4650 Note: The PowerPlex Matrix Standards, 3100/3130, can be used to perform spectral calibra on on the Applied
1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION
1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...
MicroSeq S rdna Bacterial Identification Kits
MicroSeq 500 16S rdna Bacterial Identification Kits Protocol Copyright 2007, 2011 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this
LabChip 90 System with DataViewer Software
Revolutionizing DNA and Protein Gel Electrophoresis LabChip 90 System with DataViewer Software The Proven Alternative to Slab Gels. The massive flow of information emerging from today s genomic and proteomic
icap 7000 Plus Series ICP-OES Streamlined performance and ultra-low ICP-OES detection limits for routine laboratories
icap 7000 Plus Series ICP-OES Streamlined performance and ultra-low ICP-OES detection limits for routine laboratories icap 7000 Plus Series ICP-OES Powerful multi-element performance for routine and research
User Bulletin. Veriti 96-Well Thermal Cycler AmpFlSTR Kit Validation. Overview
User Bulletin Veriti 96-Well Thermal Cycler AmpFlSTR Kit Validation June 2009 SUBJECT: AmpFlSTR PCR Amplification Kit validation on the Veriti 96-Well Thermal Cycler with 0.2 ml sample block format In
Growth Promotion Test Guide for Media Used in Sterility Tests
Growth Promotion Test Guide for Media Used in Sterility Tests The Sterility Test The purpose of the Sterility Test is to determine if a sample of a pharmaceutical product or component is sterile. A satisfactory
Axiom TM 2.0 Automated Target Prep Protocol
Quick Reference Card Axiom TM 2.0 Automated Target Prep Protocol Stage 1. DNA Amplification Introduction Running the Axiom 2.0 Assay requires the following sets of steps: 1. Genomic DNA Prep, described
QIAGEN - Evolution from Tool to System Provider in MDx 3 Levels of QIAGEN Product Offering for Different Customer Types
QIAGEN Molecular Diagnostics Molecular Diagnostics Solutions for Clinical Diagnostic Labs - 1- QIAGEN - Evolution from Tool to System Provider in MDx 3 Levels of QIAGEN Product Offering for Different Customer
Instrument specifications Technology Software Host interfaces Printer interfaces Data Station Physical dimensions Weight Certifications
The evolution of PCR Introducing the COBAS TaqMan 48 Analyzer At the forefront of PCR evolution Since Roche acquired the rights to PCR in 1991, its mission has been to fully realize the potential of this
Development and Validation of the 3500 Series Genetic Analyzer for Human Identification
Development and Validation of the 3500 Series Genetic Analyzer for Human Identification Jeff Sailus Forensic Science Applications Group 1 Development of a Next Generation Genetic Analyzer A Whole System
Bacterial 16S rdna PCR Kit Fast (800)
Cat. # RR182A For Research Use Bacterial 16S rdna PCR Kit Fast (800) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...
qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
All your genetic analyses on a single instrument
GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All on a single instrument Perform your genetic assays on one instrument A
SUBJECT: System Software Patch Provides Support for Fast SYBR Green Master Mix and RNA-to-C T
User Bulletin Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems March 2008 SUBJECT: System Software Patch Provides Support for Fast SYBR Green Master Mix and RNA-to-C T In This User Bulletin
The Evolution of Direct Amplification: From Sample to Result in 2 Hours*
The Evolution of Direct Amplification: From Sample to Result in 2 Hours* Nicola Oldroyd Forensic Applications Consultant Human Identification * Typical workflow for 24 samples Traditional Single Source
Agilent solutions for contract research and manufacturing organizations
Agilent solutions for contract research and manufacturing organizations Cooperation between pharmaceutical companies and contract research organizations A successful approach to increasing efficiency along
Genomic solutions for complex disease
Genomic solutions for complex disease Power your with our genomic solutions Access a breadth of applications. Gain a depth of insights. To enhance their understanding of complex disease, researchers are
Guidelines for Laboratory Verification of Performance of the FilmArray Blood Culture Identification (BCID) Panel
Guidelines for Laboratory Verification of Performance of the FilmArray Blood Culture Identification (BCID) Panel Purpose The Clinical Laboratory Improvement Amendments (CLIA), passed in 1988, establishes
Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand
Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the
High-throughput OpenArray solution for vaginal microbiota profiling using TaqMan Assays
APPLICATION NOTE High-throughput OpenArray solution for vaginal microbiota profiling using TaqMan Assays TaqMan Vaginal Microbiota solution In this report, we show that: Applied Biosystems TaqMan Assays
MagMAX FFPE DNA/RNA Ultra Kit
PPLICTION NOTE MagMX FFPE DN/RN Ultra Kit MagMX FFPE DN/RN Ultra Kit Introduction Rapid and accurate cancer genome analysis is in high demand for research into the detection and therapeutic management
PowerPlex 5-Dye Matrix Standards, 3100/3130
TECHNICAL BULLETIN PowerPlex 5-Dye Matrix Standards, 3100/3130 Instructions for Use of Product DG4700 Note: These matrix fragments are compatible with the ABI PRISM 3100 and 3100-Avant and Applied Biosystems
Dedicated to Molecular Diagnostics
Dedicated to Molecular Diagnostics For Europe Sample & Assay Technologies QIAGEN s growing role in molecular diagnostics At QIAGEN, one of our key goals is to support clinical decision-making and improve
Thermo Scientific icap 7000 Plus Series ICP-OES. Gain more power. experience more performance
Thermo Scientific icap 7000 Plus Series ICP-OES Gain more power experience more performance Thermo Scientific icap 7000 Plus Series ICP-OES Powerful, easy-to-use, solution for multi-element analysis Maximize
Primerdesign TM Ltd. Eubacteria. genesig Easy Kit for use on the genesig q reactions. For general laboratory and research use only
Primerdesign TM Ltd Eubacteria genesig Easy Kit for use on the genesig q16 50 reactions For general laboratory and research use only 1 genesig Easy: at a glance guide For each DNA test Component Volume
Powered by Powered by Actsoft
1 Powered by What is Encore? The Encore platform enables businesses to have an end to end field force solution Connecting people, processes, vehicles and assets Everything a field worker does from start
Fungal rdna (D1/D2) PCR Kit Fast
Cat. # RR184A For Research Use Fungal rdna (D1/D2) PCR Kit Fast Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 4 V.
Secure & Expedited Document Management For Mobile Onboarding
Secure & Expedited Document Management For Mobile Onboarding Overview The demand for self-service automation increases each year. This trend is particularly true for mobile banking services and digital
European Pharmacopoeia Chapter Alternative methods for control of microbiological quality
EDQM Symposium on Microbiology 10-11 October 2017 11/10/2017 European Pharmacopoeia Chapter 5.1.6 Alternative methods for control of microbiological quality Sébastien Jouette, Ph. D. Scientific programme
Reference Guide. Thermo Scientific Solutions. Automated Liquid Handling, Detection and Sample Purification
Reference Guide Thermo Scientific Solutions Automated Liquid Handling, Detection and Sample Purification Reference Guide Thermo Scientific Solutions Automated Liquid Handling, Detection and Sample Purification
PowerPlex ESX 17 Fast System for Use on the Applied Biosystems Genetic Analyzers
TECHNICAL MANUAL PowerPlex ESX 17 Fast System for Use on the Applied Biosystems Genetic Analyzers Instructions for Use of Products DC1710 and DC1711 Revised 8/17 TMD040 PowerPlex ESX 17 Fast System for
Salesforce Lightning Partner Management
Salesforce Lightning Partner Management Salesforce, Winter 17 @salesforcedocs Last updated: November 23, 2016 Copyright 2000 2016 salesforce.com, inc. All rights reserved. Salesforce is a registered trademark
Thermo Scientific icap RQ ICP-MS. Simplicity, productivity and robustness for routine labs
Thermo Scientific icap RQ ICP-MS Simplicity, productivity and robustness for routine labs Thermo Scientific icap RQ ICP-MS The reliability, analytical performance and ease of use needed to More productivity
Agilent 2200 TapeStation System ACCELERATE YOUR SAMPLE QC WITH CONFIDENCE
Agilent 2200 TapeStation System ACCELERATE YOUR SAMPLE QC WITH CONFIDENCE Agilent 2200 TapeStation SYSTEM Accelerate your sample QC Confidence means a QC workflow that delivers reproducible, user-independent
Third Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
High-throughput profiling, confirmation, and screening in a mid-density format. The QuantStudio 12K Flex Real-Time PCR System
PRODUCT BULLETIN OpenArray technology on the QuantStudio 12K Flex system OpenArray technology on the QuantStudio 12K Flex Real-Time PCR System High-throughput profiling, confirmation, and screening in
MALDI-TOF Mass Spectrometry Hype or Revolution? Will Probert, Ph.D. Microbial Diseases Laboratory Branch California Department of Public Health
MALDI-TOF Mass Spectrometry Hype or Revolution? Will Probert, Ph.D. Microbial Diseases Laboratory Branch California Department of Public Health Matrix Assisted Laser Desorption Ionization (MALDI) Sample
BigDye Direct Cycle Sequencing Kit
BigDye Direct Cycle Sequencing Kit QUICK REFERENCE CARD Note: For safety and biohazard guidelines, refer to the Safety section in the BigDye Direct Cycle Sequencing Kit Protocol (PN 4458040). For every
TurboMass GC/MS Software
TurboMass GC/MS Software GAS CHROMATOGRAPHY / MASS SPECTROMETRY P R O D U C T N O T E Today s demanding laboratory requires software that is easy to learn yet offers sophisticated instrument control, robust
Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Fast Real-Time PCR System
7300/7500 Real-Time PCR Systems Introducing a new generation of affordable choices from the leader in real-time PCR. Applied Biosystems 7500 Real-Time PCR System Applied Biosystems 7500 Fast Real-Time
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
CONTENTS. Neogen Corporation
Pathogen Detection Solutions CONTENTS GeneQuence Pathogen Detection... GeneQuence Assays... DNA Hybridization Technology... GeneQuence Protocol Overview Automated... Manual... Low Sample Volume GeneQuence