Supplementary Fig.1 Luton

Size: px
Start display at page:

Download "Supplementary Fig.1 Luton"

Transcription

1 Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 # IB: anti-efa6b #B Lysates IP: anti-efa6b SB Occludin Claudin 1 E-Cadherin ß-catenin 83 IB: anti-efa6b #B1 Arf IB: anti-efa6b #B2 Actin

2 1 1 Supplementary Fig.2 Luton a TER (ohm.cm 2 ) EFA6A-E242K Dox - Dox sicontrol +Dox - Dox % Total TRITC-Dextran Dox EFA6A-E242K Time (h) sicontrol TER (ohm.cm 2 ) EFA6A- Cter Dox - Dox sicontrol +Dox - Dox % Total TRITC-Dextran Dox EFA6A- Cter Time (h) sicontrol b A. U. Densitometry EFA6B Occludin Tfn-R Time (min) % of Total Time (min) EFA6B Occludin Tfn-R c MG-132 IP vsvg GST GST-S5a GST-Eps IB: vsvg

3 Supplementary Fig.3 Luton a MDCK GFP-EFA6A GFP-PH ZO-1 b sicontrol siusp7 #1118 siusp9x #182 siusp9x # hr USP9x GFP USP7 Actin ZO-1 1 hr GFP ZO-1 2 hr GFP c siusp7 NC LC siusp9x NC LC Afadin E-cadherin ß-catenin Occludin Claudin 1

4 Supplementary Fig.4 Luton USP9x a Phalloidin Merge USP9x GFP-EFA6A Merge h anti-n1 i b j anti-n1 + peptide c anti-n1 + sirna E-cadherin k d Abcam l e Abcam + sirna f anti-n1 + muusp9x g Abcam + muusp9x USP9x Merge

5 Supplementary Legends Figure 1 (a) Two independent anti-sera (#B1 and #B2) raised in guinea-pig and immunopurified with the antigenic N-terminal domain (1-308 amino-acids) of human EFA6B were analyzed by immunoblot against lysates from the indicated murine tissues. A doublet at about 175kD was detected in the thymus and spleen while a single band or doublet at about 65kD was detected in all tissues. In the brain in addition to the band at 65kD, two bands were detected at about 110kD and kd. (b) The rabbit antiserum anti-efa6b raised against the Sec7 domain of EFA6B was used to immunoprecipitate EFA6B from MDCK lysate. The IP was resolved on SDS-PAGE along with murine lung and kidney lysates. After transfer the membrane was immuno-blotted with the anti-efa6b #B1 antiserum which recognized a band at 66kD in the IP and the lysates. In addition the doublet at about 175kD was detected in the lung. (c) Specificity of EFA6B RNA interference. 24 h after nucleofection of the following sirnas: sirna control, sirna mismatch or EFA6B targeted sirnas #637, #1564 and #1770, the expression of the indicated proteins was analyzed by immunoblotting. All three EFA6B-targeted sirna decreased EFA6B levels, whereas the control sirnas had no effect. In addition, neither Arf6 nor any of the AJ and TJ protein levels were affected by the EFA6Btargeted sirnas. Figure 2 (a) Both its catalytic activity and its C-terminal remodeling actin domain are required for EFA6 to stimulate TJ formation. Two mutants of EFA6A expressed under the control of the tetracycline-repressible promoter were analyzed for their capacity to rescue the formation of functional TJ in EFA6B-knockdown cells (sirna #637). EFA6A-E242K contains a point mutation of the conserved glutamic acid within the Sec7 domain essential for the nucleotide exchange activity and EFA6A- C lacks the C-terminal actin remodeling domain. The gain of TJ barrier function was analyzed in a calcium switch assay by measuring the TER (n=4) over time and the paracellular diffusion of TRITC-dextran (n=3) at 2 h after calcium repletion. For TER measurement with EFA6A-E2K2K: sicontrol cells +/- Dox p>0.35 at all times, for cells +/- Dox p>0.34 at all times, for +Dox cells +/- p<0.003 after 30 min, for Dox cells +/- p< after 30 min. For the paracellular diffusion of the TRITC-Dextran with EFA6A-E242K: sicontrol cells +/- Dox p=0.35, for cells +/- Dox p=0.30, for +Dox cells +/- p=0.0027, for Dox cells +/- p= For TER measurement with EFA6A- C: sicontrol cells +/- Dox p>0.15 at all times, for cells +/- Dox p>0.42 at all times, for +Dox cells +/-

6 p<0.001 at all times, for Dox cells +/- p<0.004 at all times. For the paracellular diffusion of the TRITC-Dextran with EFA6A- C: sicontrol cells +/- Dox p=0.48, for cells +/- Dox p=0.44, for +Dox cells +/- p=0.0066, for Dox cells +/- p= Error bars represent the SEM. (b) EFA6B has a rapid rate of protein synthesis and a short half-life. The rates of synthesis (right panel) and the half-life (left panel) of EFA6B, occludin and transferrin receptor (Tfn-R) were determined after incorporation of 35 S-methionine and 35 S-cysteine. To measure the rate of protein synthesis MDCK cells were subjected to radioactive pulses of different durations and to measure the half-life MDCK cells were subjected to a 10 min pulse followed by a chase over a 2 h period (See Supplementary Methods). In both cases, the numbers represent the amount of radioactivity incorporated in each protein measured after immunoprecipitation, SDS-PAGE, fluorography and corrected for the number of cysteine and methionine residues in each protein. (c) BHK cells transfected with vsvg-efa6a (97kD) were treated or not with MG-132 (50 µm) for 4 h and lysed in SDS lysis buffer. The lysate was subjected to immunoprecipitation with an anti-vsvg antibody or incubated with GST, GST-S5a or GST-Eps15 (UIM1/2) beads for 2 h. The precipitates were resolved by SDS-PAGE and the immunoblot probed with an anti-vsvg antibody. Figure 3 (a) GFP-PH from EFA6A hampers TJ assembly. MDCK GFP-EFA6A and GFP-PH #1 cells grown on 12-mm filters were subjected to a calcium switch and fixed 0.5, 1 or 2 h after calcium repletion. The samples were prepared for immunofluorescence analysis and costained for ZO-1. (b) Specificity of USP9x RNA interference. The following sirnas: sirna control, USP7-targeted sirna #1118 or USP9x-targeted sirnas #182 and #3432 were transfected by nucleofection. 24 h post-transfection USP7 and USP9x levels were analyzed by immunoblotting. Actin was used as a loading control. Both USP9x sirnas decreased USP9x levels without affecting USP7. Conversely the USP7 sirna knocked down USP7 without affecting USP9x. (c) The lysates described in Fig. 4b were immunoblotted for the indicated proteins. Knocking down USP9x decreased afadin levels but did not affect any of the other AJ and TJ proteins. Figure 4 Characterization of the rabbit polyclonal (anti-n1) and mouse monoclonal (Abcam) USP9x antibodies. USP9x localization (green) was visualized in cells labeled for filamentous actin with fluorescent phalloidin (red). (a) The anti-n1 gave a strong intracellular staining as described earlier (Murray et al., 04). However, no staining was detected at cell-cell contacts. The anti-n1 staining was decreased by pre-incubation with the immunizing peptide

7 (b) or by the USP9x-specific sirna #182 (c). The same staining was observed with the Abcam antibody (d) and similarly repressed after USP9x knockdown (e). Finally, the exogenously expressed murine USP9x was recognized by the anti-n1 (f) and Abcam antibodies (g). Staining for murine USP9x detected by both antibodies was cytoplasmic and absent from cell-cell contacts as seen for endogenous USP9x, that is intracellular and absent from cell-cell contacts. In (h) and (i), are shown the co-localization of GFP-EFA6A and USP9x at the periphery of a membrane ruffle or the extremity of a long plasma membrane extension, respectively. In (j) is shown a more mature contact where GFP-EFA6A is still present but from which USP9x is already excluded. The panels in (k) show the localization of USP9x in mature contacts established within a cluster of MDCK cells. USP9x is totally excluded from the cell-cell adhesion marked by E-cadherin. In (l), USP9x co-localizes with E- cadherin in a newly-formed contact. Scale bars, 25 µm.

8 Supplementary Methods Measure of protein synthesis and half-life. MDCK cells grown on 12 mm filters were rinsed and starved in MEM, 5% dialyzed FCS, without cysteine or methionine (MEM-Cys- Met) for min at 37 C. The cells were then labeled on a 30 µl drop of MEM-Cys-Met containing a mix of 35 S-Cys/Met (66 µci / filter at 1175 Ci / mmol). To measure the rate of protein synthesis the cells were pulsed for 2 min, 5 min and 10 min. At the end of the pulse, the cells were quickly rinsed in ice-cold PBS and solubilized in Triton X-100 lysis buffer (1% Triton-X100, mm Hepes ph 7.4, EDTA 2 mm, NaCl 125 mm, 0.2 mm PMSF and protease inhibitors) for min at 4 C. To measure half-life, the cells were pulsed for 15 min, quickly washed 4 times in MEM-BSA (MEM, 0.6% BSA, mm Hepes ph 7.4, penicilline/streptomycine), and further incubated in MEM-BSA containing an excess of nonradioactive cysteine (2 mm) and methionine (1 mm) for the indicated times before solubilization in Tx-100 lysis buffer. For both experiments, the lysates were spun 30 min at 16,000 g in a microfuge and the supernatants pre-cleared. The indicated proteins were immunoprecipitated using specific antibodies coupled to protein A sepharose beads, the immunoprecipitates washed 5 times in lysis buffer, resolved on SDS-PAGE, then revealed and analyzed using a PhosphorImager (Fujifilm BAS-1500, Fuji Film, France).

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

SUPPLEMENTARY INFORMATION FIGURE 1 - 1

SUPPLEMENTARY INFORMATION FIGURE 1 - 1 SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant

More information

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17 Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,

More information

ab G alpha i Activation Assay Kit

ab G alpha i Activation Assay Kit ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela

More information

Immunoprecipitation Protocol

Immunoprecipitation Protocol Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

Supplementary information. Supplementary Figures

Supplementary information. Supplementary Figures Supplementary information Supplementary Figures Supplementary Figure 1. A. i. HA-JMY expressing U2OS cells were treated with SAHA (6h). DAPI was used to visualise nuclei. ii. U2OS cells stably expressing

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Journal of Cell Science Supplementary Material

Journal of Cell Science Supplementary Material 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

More information

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

More information

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently

More information

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a

More information

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)

More information

Thermo Scientific GTPase Research Tools

Thermo Scientific GTPase Research Tools Thermo Scientific Research Tools Active Pull-Down Assays We offer two different tools to study biology, one for active monitoring and one for global profiling. The Thermo Scientific Pierce Active Pull-Down

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental

More information

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information

More information

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358 CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.

More information

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching

More information

Supplementary Material - Methods

Supplementary Material - Methods Novel Protein-Protein Interactions in the Schizophrenia interactome Supplementary Material - Methods Experimental validations of predicted interactions Table S1-1: Protein pairs that were validated by

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Ral Activation Assay Kit

Ral Activation Assay Kit Product Manual Ral Activation Assay Kit Catalog Number STA-408 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family of

More information

Supporting Information

Supporting Information Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS,

More information

Supplemental Information. Lysine-5 Acetylation Negatively Regulates. Lactate Dehydrogenase A and Is Decreased. in Pancreatic Cancer

Supplemental Information. Lysine-5 Acetylation Negatively Regulates. Lactate Dehydrogenase A and Is Decreased. in Pancreatic Cancer Cancer Cell, Volume 23 Supplemental Information Lysine-5 Acetylation Negatively Regulates Lactate Dehydrogenase A and Is Decreased in Pancreatic Cancer Di Zhao, Shao-Wu Zou, Ying Liu, Xin Zhou, Yan Mo,

More information

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic

More information

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Chi Wai Lee, Jianzhong Han, James R. Bamburg, Liang Han, Rachel Lynn, and James Q. Zheng Supplementary Figures

More information

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

Supporting Information

Supporting Information Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized

More information

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of

More information

Kinase Reaction and Alkylation Protocol

Kinase Reaction and Alkylation Protocol Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic

More information

A General Protocol for GST Pull-down Lili Jing *

A General Protocol for GST Pull-down Lili Jing * A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

SUPPLEMENTARY MATERIALS AND METHODS

SUPPLEMENTARY MATERIALS AND METHODS SUPPLEMENTARY MATERIALS AND METHODS Chemicals. All chemicals used in supplementary experiments were the same as in the manuscript except the following. Methyl-methanesulfonate (MMS) was from Fluka. NU1025

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo *

Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * INSERM U1009, Gustave Roussy, Villejuif, France *For correspondence: isabelle.plo@gustaveroussy.fr [Abstract]

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

Supplemental information

Supplemental information Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry

More information

Histone H3 Acetylation Antibody Panel Pack II Base Catalog # C K23A Histone H3K23ac (Acetyl H3K23) Polyclonal Antibody 25 µg 4 C 20 C

Histone H3 Acetylation Antibody Panel Pack II Base Catalog # C K23A Histone H3K23ac (Acetyl H3K23) Polyclonal Antibody 25 µg 4 C 20 C Histone H3 Acetylation Antibody Panel Pack II Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K23A Histone H3K23ac (Acetyl H3K23) Polyclonal Antibody 25 µg 4 C

More information

mcherry Polyclonal Antibody Catalog Number PA Product data sheet

mcherry Polyclonal Antibody Catalog Number PA Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

2 mg/ml solution in PBS, ph 7.2, 5 mm azide. 2 mg/ml solution in PBS, ph 7.2, 5 mm azide

2 mg/ml solution in PBS, ph 7.2, 5 mm azide. 2 mg/ml solution in PBS, ph 7.2, 5 mm azide Anti-GFP Antibodies Table 1. Contents and storage information. Material Amount Concentration Storage Stability Anti-GFP rabbit polyclonal serum (A6455) 100 μl, with 0.01% thimerosal Not applicable When

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

One-Step Western TM Kit using TMB

One-Step Western TM Kit using TMB Technical Manual No. 0203 Version 03272008 I Description.. 1 II Kit Contents.. 2 III Applications 3 IV Key Features.. 3 V Storage.. 3 VI One-Step Western TM Protocol. 3 VII Examples. 3 VIII Troubleshooting..

More information

Rho activation kit. Catalog Number: ADI-EKS-465. Table of Contents

Rho activation kit. Catalog Number: ADI-EKS-465. Table of Contents Rho activation kit Catalog Number: ADI-EKS-465 Table of Contents Assay Design Page 1 Scientific Overview 2 Precautions 2 Materials Provided 3 Storage of Materials 3 Materials Required but Not Provided

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Feng et al., http://www.jcb.org/cgi/content/full/jcb.201408079/dc1 Figure S1. A modest elevation of disulfide-bonded K14 in primary mouse

More information

Product Data Sheet - TRUEMAB

Product Data Sheet - TRUEMAB 888.267.4436 techsupport@origene.com www.origene.com Name:F13A1 (Factor XIIIa) mouse monoclonal antibody, clone OTI1H2 (formerly 1H2) Product Data Sheet - TRUEMAB Catalog: TA800305 Components: F13A1 (Factor

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

Supplemental Material

Supplemental Material Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36

More information

Supplementary Figure legends. Supplementary Methods

Supplementary Figure legends. Supplementary Methods Supplementary Methods Transmission electron microscopy. For transmission electron microscopy (TEM), the cell populations were rinsed with 0.1 Sorensen s buffer (ph 7.5), fixed in 2.5% glutaraldehyde for

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1 Effect of ROCK inhibition on lumen abnormality in MDCK cysts. (A) MDCK cells as indicated cultured in Matrigel were treated with and without Y27632 (10

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Luciferase ctivity (%) 5 4 3 2 1 HeLa E2 OHT Figure S1. SENP2 represses estradiol-dependent transcriptional activity in HeLa cells. HeLa cells were transiently transfected with

More information

MEK1/2 (MAPK Kinase) Activity Assay Kit

MEK1/2 (MAPK Kinase) Activity Assay Kit MEK1/2 (MAPK Kinase) Activity Assay Kit For 96 tests Cat. No. SGT440 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0)

More information

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled

More information

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted

More information

3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors

3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors 3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids

More information

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al., Supplemental material JCB Paul et al., http://www.jcb.org/cgi/content/full/jcb.201502040/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Mutant p53-expressing cells display limited retrograde actin flow at

More information

Supplemental Information

Supplemental Information Molecular Cell, Volume 54 Supplemental Information BRD7, a Tumor Suppressor, Interacts with p85 and Regulates PI3K Activity Yu-Hsin Chiu, Jennifer Y. Lee, and Lewis C. Cantley Supplemental Materials Supplemental

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Supplementary Figures and Legends

Supplementary Figures and Legends Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing

More information

A guide to selecting control, diluent and blocking reagents

A guide to selecting control, diluent and blocking reagents Specializing in Secondary Antibodies and Conjugates A guide to selecting control, diluent and blocking reagents Optimize your experimental protocols with Jackson ImmunoResearch Secondary antibodies and

More information

METHODS IN CELL BIOLOGY EXAM II, MARCH 26, 2008

METHODS IN CELL BIOLOGY EXAM II, MARCH 26, 2008 NAME KEY METHODS IN CELL BIOLOGY EXAM II, MARCH 26, 2008 1. DEFINITIONS (30 points). Briefly (1-3 sentences, phrases, word, etc.) define the following terms or answer question. A. depot effect refers to

More information

ab Ubiquitylation Assay Kit (HeLa lysate-based)

ab Ubiquitylation Assay Kit (HeLa lysate-based) ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

Arf6 Activation Assay Kit

Arf6 Activation Assay Kit Product Manual Arf6 Activation Assay Kit Catalog Number STA- 407-6 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family

More information

Antibodies to Animal Cells and Serum Proteins

Antibodies to Animal Cells and Serum Proteins ANTIBODIES TO ANIMAL CELLS AND SERUM PROTEINS Antibodies to Animal Cells and Serum Proteins Antibodies to Animal Cellular Antigens Antibodies to Mouse Brain Antibodies to Animal Serum Proteins INTERNATIONAL

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 0.038/ncb35 Supplementary Figure Effect of Merlin depletion on velocity correlation function and correlations lengths. (a) Representative images showing the sheet migration of MDCK monolayer at the

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran

More information

Supplementary Information

Supplementary Information Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,

More information