NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known

ORFs and genes. Please sit in row K or forward

ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms

Lecture 11: Gene Prediction

Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are

Homework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity

Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction

Lecture 19A. DNA computing

Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria

Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells

Protein Structure Analysis

BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS

Codon Bias with PRISM. 2IM24/25, Fall 2007

Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines

Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013

Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

Electronic Supplementary Information

Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides

Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis

Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells

Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute

National PHL TB DST Reference Center PSQ Reporting Language Table of Contents

PSQ Reporting Language Table of Contents Document Page Number PSQ for Rifampin 2-6 Comparison table for rpob Codon Numbering 2 rpob mutation list (new numbering system) 3-5 rpob interpretations 6 PSQ for

Hes6. PPARα. PPARγ HNF4 CD36

SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table

PROTEIN SYNTHESIS Study Guide

PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

Genomic Sequence Analysis using Electron-Ion Interaction

University of Aizu, Graduation Thesis. March, 25 s1985 1 Genomic Sequence Analysis using Electron-Ion Interaction Potential Masumi Kobayashi s1985 Supervised by Hiroshi Toyoizumi Abstract This paper proposes

Lezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi

Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins

Supporting Information

Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT

Creation of A Caspese-3 Sensing System Using A Combination of Split- GFP and Split-Intein

Supplementary Information Creation of A Caspese-3 Sensing System Using A Combination of Split- GFP and Split-Intein Seiji Sakamoto,* Mika Terauchi, Anna Hugo, Tanner Kim, Yasuyuki Araki and Takehiko Wada*

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

FROM DNA TO GENETIC GENEALOGY Stephen P. Morse

1. GENES, CHROMOSOMES, AND DNA Chromosomes FROM DNA TO GENETIC GENEALOGY Stephen P. Morse (steve@stevemorse.org) Every human cell = 46 chromosomes (1 to 22 in pairs, 2 sex chromosomes) Male: sex chromosomes

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

Y-chromosomal haplogroup typing Using SBE reaction

Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc

BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB

Multiplexing Genome-scale Engineering

Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt

Introduction to Bioinformatics Dr. Robert Moss

Introduction to Bioinformatics Dr. Robert Moss Bioinformatics is about searching biological databases, comparing sequences, looking at protein structures, and more generally, asking biological questions

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

Expression of Recombinant Proteins

Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

Sampling Random Bioinformatics Puzzles using Adaptive Probability Distributions

Sampling Random Bioinformatics Puzzles using Adaptive Probability Distributions Christian Theil Have 1, Emil Vincent Appel 1, Jette Bork-Jensen 1, and Ole Torp Lassen 2 1 Novo Nordisk Foundation Center

A Circular Code in the Protein Coding Genes of Mitochondria

J. theor. Biol. (1997) 189, 273 290 A Circular Code in the Protein Coding Genes of Mitochondria DIDIER G. ARQUE` S* AND CHRISTIAN J. MICHEL *Equipe de Biologie The orique, Universite de Marne la Valle

Thr Gly Tyr. Gly Lys Asn

Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

Supplemental material

Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,

Nucleic Acids Research

Volume 10 Number 1 1982 VoLume 10 Number 11982 Nucleic Acids Research Nucleic Acids Research A convenient and adaptable package of DNA sequence analysis programs for microcomputers James Pustell and Fotis

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111

Supporting Online Information

Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical

SUPPORTING INFORMATION

SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.

RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian

Supporting Information

Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the

Evolution of protein coding sequences

Evolution of protein coding sequences Kinds of nucleo-de subs-tu-ons Given 2 nucleo-de sequences, how their similari-es and differences arose from a common ancestor? We assume A the common ancestor: Single

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+

ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

evaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the

Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure

2

1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene

Gene synthesis by circular assembly amplification

Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary

Supporting Information

Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription

Legends for supplementary figures 1-3

High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik

Additional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name

1 2 3 Additional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name Scientific name Accession number Accession number (introns) Codons

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE

The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc

S4B fluorescence (AU)

A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11

11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko

Supplemental Table 1. Primers used for PCR.

Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT

BIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks

Rationale of Genetic Studies Some goals of genetic studies include: to identify the genetic causes of phenotypic variation develop genetic tests o benefits to individuals and to society are still uncertain

MacBlunt PCR Cloning Kit Manual

MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).

BioInformatics and Computational Molecular Biology. Course Website

BioInformatics and Computational Molecular Biology Course Website http://bioinformatics.uchc.edu What is Bioinformatics Bioinformatics upgrades the information content of biological measurements. Discovery

FAT10 and NUB1L bind the VWA domain of Rpn10 and Rpn1 to enable proteasome-mediated proteolysis

SUPPLEMENTARY INFORMATION FAT10 and NUB1L bind the VWA domain of Rpn10 and Rpn1 to enable proteasome-mediated proteolysis Neha Rani, Annette Aichem, Gunter Schmidtke, Stefan Kreft, and Marcus Groettrup

SUPPLEMENTARY INFORMATION

doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp

Level 2 Biology, 2017

91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with

Supplemental Data. Distinct Pathways for snorna and mrna Termination

Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A

Table S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes

Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,

Supplementary Figures

Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,

ISOLATION OF A cdna CODING FOR HUMAN GALACTOSYLTRANSFERASE

August 29, 1986 Pages 1 63-1 68 ISOLATION OF A cdna CODING FOR HUMAN GALACTOSYLTRANSFERASE Hubert E. Appert*l, Thomas J. Rutherford1, 2, George E. Tarr 3, Jon S. Wiest 2, Neil R. Thomford I and D. James

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information

Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary

PCR-based Markers and Cut Flower Longevity in Carnation

PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso

Supporting Information

Supporting Information CLOSTRIDIOLYSIN S: A POST-TRANSLATIONALLY MODIFIED BIOTOXIN FROM CLOSTRIDIUM BOTULINUM David J. Gonzalez 1, Shaun W. Lee 9, Mary E. Hensler 6, Andrew L. Markley 1, Samira Dahesh

Fishy Amino Acid Codon. UUU Phe UCU Ser UAU Tyr UGU Cys. UUC Phe UCC Ser UAC Tyr UGC Cys. UUA Leu UCA Ser UAA Stop UGA Stop

Fishy Code Slips Fish 1 GGTTATAGAGGTACTACC Fish 2 GGCTTCAGAGGTACTACC Fish 3 CATAGCAGAGGTACTACC Fish 4 GGTTATTCTGTCTTATTG Fish 5 GGCTTCTCTGTCTTATTG Fish 6 CATAGCGCTGCAACTACC Fishy Amino Acid Codon UUU Phe

Chapter 13 Chromatin Structure and its Effects on Transcription

Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.

Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP- Driven Ribonuclease

Supplemental Information Molecular Cell, Volume 42 hosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an AT- Driven Ribonuclease Elif Sarinay Cenik, Ryuya Fukunaga, Gang Lu, Robert Dutcher,

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated

SUPPORTING INFORMATION FILE

Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of

Codon bias and gene expression of mitochondrial ND2 gene in chordates

www.bioinformation.net Hypothesis Volume 11(8) Codon bias and gene expression of mitochondrial ND2 gene in chordates Arif Uddin, Tarikul Huda Mazumder, Monisha Nath Choudhury & Supriyo Chakraborty* Department