Supporting Information. for. Angew. Chem. Int. Ed. Z Wiley-VCH 2004
|
|
- Augustus Clarke
- 5 years ago
- Views:
Transcription
1 Supporting Information for Angew. Chem. Int. Ed. Z53445 Wiley-VC Weinheim, Germany
2 Small Interfering RNA Expression in Cells Based on an Efficiently Constructed Dumbbell-shaped DNA Masumi Taki, Yoshio Kato, Makoto Miyagishi, Yasuomi Takagi, Kazunari Taira Experimental Section: General: All solvents and reagents were commercially available and used without further purification. Assays in this study were repeated at least three times. Plasmid construction: pu6i-egfp and pu6i-lamin plasmids, encoding the U6 promoter and hairpin-type sirna expression sequence against enhanced green fluorescent protein (EGFP) and against lamin, respectively, were constructed as follows. First, we prepared sirna expression vectors using the pu6icassette vector (igene Therapeutics, Tsukuba, Japan), 10 which contains a human U6 promoter and two BspMI sites. For construction of the sirna-expression vectors, we synthesized
3 oligonucleotides with hairpin, terminator, and overhanging sequences. Then we annealed the fragments and inserted them into the BspMI sites of the pu6icassette vector. Sequences inserted immediately downstream of the U6 promoter were as follows : in pu6i-egfp; 5 -GGC TAT GTC TAG GAG TGT ACC TAG AAT TAC ATC AAG GGA GAT GGT GCG CTC CTG GAC GTA GCC-3, in pu6i-lamin; 5 -GGG TAA TTG GTA GAT TAA GCG GTG TGC TGT CCC GCT TGA TCT GCC AAT TGC CC-3, respectively. Conventional method to create dumbbell-shaped DNA vector using intermolecular ligation between three independent oligonucleotides; (a) PCR amplification of U6 promoter-driven sirna coding linear DNA: Five hundred pmol of each synthetic DNA primer was mixed with the vector pu6i-lamin, then a PCR reaction was carried out with Ex Taq TM DNA polymerase (TaKaRa, Shiga, Japan). The sequence of the sense and antisense universal primers for the PCR were, 5'-pGGG AAT TCA CCT GCC GGC GAG GGT TTT CCC AGT CAC GAC GTT G-3' and 5'-pGGC TGC AGA CCT GCC GGC CAC CGA GCG GAT AAC AAT TTC ACA CAG G-3', respectively. Both primers contain BspMI recognition sequence (underlined), and 5 -ends were phosphorylated. The PCR product was isolated using the Wizard (R) SV Gel and PCR
4 Clean-Up System (Promega, Madison, WI, USA) and digested with BspMI. After 7 hours incubation at 37 C, the digested product was isolated using Wizard (R) SV Gel and PCR Clean-Up System (Promega). (b) Conversion of the sirna-expressing linear DNA to dumbbell-shaped DNA: The uncapped PCR product was then reacted with a 10-fold excess of oligonucleotide-caps by T4 DNA ligase (DNA ligation kit; TaKaRa). Before ligation, the hairpin form of the oligonucleotide-caps presenting a sticky 5 end was obtained by boiling for 1 minute at 95 C, and subsequently cooling the sample to room temperature within 1 hour. The sequences of the oligonucleotide-caps were, 5'-pGGT GTG TCC GCG TTG GCT TTT GCC AAC GCG GAC A-3'; 5'-pCCT CGG CCT ATA GTG AGT CGT ATT AGG CGG GAA CCG CCT AAT ACG ACT CAC TAT AGG CC-3', respectively. The reaction mixture was incubated at 16 C, overnight, and the ligated product was purified by phenol/chloroform extraction, and precipitated with ethanol. Evaluation of vector stabilities in vitro by exonuclease digestion: The stabilities of linear- and dumbbell vectors were evaluated by digestion with exonuclease III (1500 U/µg of DNA, TaKaRa) at 37 C for 1 hour. An equivalent aliquot of each fraction
5 was electrophoresed on 8% polyacrylamide before and after the digestion reaction. After the electrophoresis, the gels were analyzed using a FluorImager 595 (Molecular Dynamics, Uppsala, Sweden), equipped with an argon laser (488 nm) as an excitation source and an emission filter (around 530 nm), to detect fluorescein s fluorescence (λ max = 492 nm). Then, ethydium bromide staining was performed with the same gels as described above. The amount of DNA and attached fluorescein was quantified by analyzing densitometry of bands using NI Image and ImageQuant programs (Molecular Dynamics), respectively. 11 Each band intensity was evaluated quantitatively from a standard curve, to quantify conversion yields from linear DNAs to dumbbell DNAs. Site-specific modification of dumbbell vector by fluorescein: For the chemical modification of dumbbell vectors, we used the Fluorescein Amine Labeling Kit (Panvera, Madison, WI) according to the instruction manual. Briefly, a 67 nm dumbbell vector in 30 µl of 100 mm phosphate buffer (p 7.0) solution containing 4 mm succinimide ester of fluorescein was incubated at 37 C for 1 hour. After incubation, the reaction was stopped by adding 100 mm Tris/Cl buffer (p 8.0) and the resulting
6 solution then incubated at room temperature for an additional 30 minutes. DNA was isolated using the Wizard (R) SV Gel and PCR Clean-Up System (Promega). Cells, cell culture, transfection, and GFP fluorescence assay: ela S3/EGFP cells were generated as follows. ela/s3 cells were transfected with linearized pygegfp (Clontech, East Meadow Circle, PA), and hygromycin-resistant clones were selected in Dulbeco's modified Eagle's medium (DMEM; Sigma, St. Louis, M) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS; GIBC-BRL, Gaithersburg, MD), hygromycin (100 µg/ml; Sigma) and an antibiotic-antimycotic mixture (GIBC-BRL). ne of the clones, ela S3/EGFP clone 3 was used for the experiments in this report, and was maintained in the above medium at 37 C, 5% C 2 in a moist atmosphere. These cells were grown to approximately 40-50% confluence in each 8-well chambered glass slide (Nalge Nunc International, Naperville, IL). Then, transfections of the DNAs were carried out using PTI-MEM medium (Invitrogen, Carlsbad, CA) and Trans-It LT-1 reagent (PanVera, Madison, WI) according to the manufacturer's protocol. They were independently transfected with 100 ng of dumbbell-shaped vector, linear PCR product vector, or pu6i-egfp plasmid vector encoding sirna targeted against the EGFP gene. As a negative control, they were
7 also transfected with 100 ng of dumbbell-shaped vector targeted against the lamin gene. Mock transfection was carried out without using any DNA. Incubation was performed for 48 hours. At 24 hours post-induction, the medium was replaced by fresh growth medium containing hygromycin and the antibiotic-antimycotic mixture. Living cells on the glass coverslips were observed after 48 hours using a conventional fluorescence microscope (LSM-510, Carl Zeiss, berkochen, Germany). Inhibition of nuclear envelope proteins (lamin A/C): ela S3 cells were transfected with 100 ng of dumbbell-shaped vector encoding sirna targeted against lamin gene, according to the above procedure. The transfected cells grown on glass coverslips were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 minutes at room temperature. The slides were rinsed twice in PBS and drained. The cells were immersed in PBS buffer with 0.1% Triton X-100, and incubated for 30 minutes. The slides were rinsed twice in PBS and drained. The cells were blocked with 1% BSA and 0.1% Triton X-100 in PBS and then incubated with a 1:1000 dilution of monoclonal 636 lamin A/C specific antibody (Santa Cruz Biotechnology) for 1 hour at room temperature. The antibody was drained, and the slides were rinsed in the BSA/Triton X-100/PBS solution and then incubated with a 1:1000 dilution of
8 Alexa-568-conjugated anti-mouse IgG (A11031; Molecular Probes) for 1 hour at room temperature. The antibody was drained and slides were rinsed. The coverslips were inverted and mounted with Prolong antifade (Molecular Probes). The cells on the coverslips were observed using a conventional fluorescence microscope (Zeiss).
9 A: Dumbbell vector targeted against lamin B: No vector Phase contrast lamin A/C Superposed Figure S1. Inhibition of nuclear envelope proteins (lamin A/C) expression using dumbbell vector in ela S3 cells.
10 R N N ptnaggagtt P TCTCCTNAGC... - R 1a : C 3 1b : N N 2 1c : N N N C Figure S2. Detailed structures of the sense primers 1a-c.
11 e.g. sirna coding region A B 1. PCR A promoter gene to be transcribed B cdna A 2. Digestion using restriction enzyme(s). 3. Purification B A B 4. Intermolecular ligation airpin DNA in the loop region 5. Purification Scheme S1. Previously published conventional dumbbell-cloning method. 6,9
12 Scheme S1. Previously published conventional dumbbell-cloning method. 6,9 Intramolecular ligation between three different molecules lowers the conversion yield from linear DNA to dumbbell DNA. Excess amounts of hairpin DNAs in the loop region must be required, and almost all hairpin DNA molecules remain unreacted.
Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationMaterials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More informationAn engineered tryptophan zipper-type peptide as a molecular recognition scaffold
SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening
More informationElectronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Multiplexed Detection of Lung Cancer Cells at the Single-Molecule
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationSupplementary Information
Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials
More informationNongenetic Reprogramming of the Ligand Specificity. of Growth Factor Receptors by Bispecific DNA Aptamers
Supporting Information For Nongenetic Reprogramming of the Ligand Specificity of Growth Factor Receptors by Bispecific DNA Aptamers Ryosuke Ueki,* Saki Atsuta, Ayaka Ueki and Shinsuke Sando* Department
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationSupplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.
qrt-pcr RT-PCR Relative pri-mir-8 level 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) BR-C E74 mtl rrna Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) Supplementary Figure 1.
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More information11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11
11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationSupplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the
Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was
More informationSUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide
SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide former/ working Description a designation Plasmids pes213a b pes213-tn5
More informationExpansion of the sortase-mediated labeling method for site-specific. N-terminal labeling of cell surface proteins on living cells
Supplementary Information for Expansion of the sortase-mediated labeling method for site-specific N-terminal labeling of cell surface proteins on living cells Teruyasu Yamamoto a and Teruyuki Nagamune*,a,b,c
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationSupplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB
Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationSequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps
Supporting information Sequencing of DNA lesions facilitated by site-specific excision via base excision repair DNA glycosylases yielding ligatable gaps Jan Riedl, Aaron M. Fleming, and Cynthia J. Burrows*
More informationHigh-throughput cloning and expression in recalcitrant bacteria
High-throughput cloning and expression in recalcitrant bacteria Eric R Geertsma & Bert Poolman Supplementary text and figures: Supplementary Figure 1 Frequency of SfiI sites yielding identical 3 extensions
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationPrimer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria
Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells
More informationA green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ
Electronic Supplementary Material A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ Xiaoli Zhu 1, Hai Shi 1, Yalan Shen 1,
More informationI. Things to keep in mind before you start this protocol
Inverse PCR and Sequencing Protocol on 5 Fly Preps For recovery of sequences flanking piggybac elements This protocol is an adaptation of "Inverse PCR and Cycle Sequencing Protocols" by E. Jay Rehm Berkeley
More informationSUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)
SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is
More informationPCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive and Selective DNA Detection Based on Nicking Endonuclease Assisted Signal Amplification and Its Application in Cancer Cells Detection Sai Bi, Jilei Zhang,
More informationA netlike rolling circle nucleic acid amplification technique
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2014 Supplementary Information A netlike rolling circle nucleic acid amplification technique Xiaoli Zhu,
More informationA Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion,
TITLE A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion, Survival, and Cancer Cell Behaviors AUTHORS Carolyn R. Shurer *, Marshall J. Colville *, Vivek K. Gupta,
More informationElectronic Supplementary Information. Transcription Monitoring Using Fused RNA with a Dye-Binding Light-Up Aptamer as a Tag: A Blue Fluorescent RNA
Electronic Supplementary Information for Transcription Monitoring Using Fused RNA with a Dye-Binding Light-Up Aptamer as a Tag: A Blue Fluorescent RNA Shinsuke Sando,* Atsushi Narita, Masayoshi Hayami,
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationSupporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy
Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic
More informationChapter 13 Chromatin Structure and its Effects on Transcription
Chapter 13 Chromatin Structure and its Effects on Transcription Students must be positive that they understand standard PCR. There is a resource on the web for this purpose. Warn them before this class.
More informationExpression of Recombinant Proteins
Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationInhibition of Hepatitis C Virus Replication by GS-6620, A Potent C-Nucleoside Monophosphate Prodrug
Inhibition of Hepatitis C Virus Replication by, A Potent C-Nucleoside Monophosphate Prodrug Running Title: In Vitro Pharmacology of Authors: Joy Y. Feng et al. Supplementary Information Table S1. RNA primer
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationSupplementary Figure 1 Tmod3 expression and phosphorylation. (a) Expression of Tmod3 in 3T3-L1 preadipocytes and differentiated adipocytes.
1 2 3 1 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Supplementary Figure 1 Tmod3 expression and phosphorylation. (a) Expression of Tmod3 in 3T3-L1 preadipocytes and differentiated
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationPhosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP- Driven Ribonuclease
Supplemental Information Molecular Cell, Volume 42 hosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an AT- Driven Ribonuclease Elif Sarinay Cenik, Ryuya Fukunaga, Gang Lu, Robert Dutcher,
More informationYeast BioBrick Assembly (YBA)
Yeast BioBrick Assembly (YBA) Standardized method for vector assembly of BioBrick devices via homologous recombination in Saccharomyces cerevisiae Martin Schneider, Leonard Fresenborg, Virginia Schadeweg
More informationLuo et al. Supplemental Figures and Materials and Methods
Luo et al. Supplemental Figures and Materials and Methods The supplemental figures demonstrate that nuclear NFAT is situated at PODs, overexpressed PML does not increase NFAT nuclear localization, and
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationSUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
More informationS4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
More informationWet Lab Tutorial: Genelet Circuits
Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic
More informationSupporting Information
Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany Site-Specific Control of Distances between Gold Nanoparticles using Phosphorothioate Anchors on DNA and a Short Bifunctional Molecular Fastener
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationDNA Tetrahedron-Based Molecular Beacon for Tumor-Related
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supporting Information (ESI) DNA Tetrahedron-Based Molecular Beacon for Tumor-Related
More informationGlutathione (GSH)-Decorated Magnetic Nanoparticles for Binding Glutathione-S-transferase (GST) Fusion Protein and Manipulating Live Cells
Glutathione (GSH)-Decorated Magnetic Nanoparticles for Binding Glutathione-S-transferase (GST) Fusion Protein and Manipulating Live Cells Yue Pan, Marcus J. C. Long, Xinming Li, Junfeng Shi, Lizbeth Hedstrom,
More informationAn enzyme-free DNA walker that moves on the surface of. functionalized magnetic microparticles and its biosensing analysis
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry
More information