2017 Qualifying Examination

Size: px
Start display at page:

Download "2017 Qualifying Examination"

Transcription

1 B1 1 Basic Molecular Genetics Mechanisms Dr. Ueng-Cheng Yang Molecular Genetics Techniques Cellular Energetics 24 2 Dr. Dar-Yi Wang Transcriptional Control of Gene Expression 8 3 Dr. Chuan-Hsiung Chang Molecules, Cells, and Evolution Genes, Genomics, and Chromosomes 4 Dr. Jou, Yuh-Shasn Cancer 8 5 Dr. Jie-Rong Huang Protein structure and function Chemical Foundations 6 Dr. Wailap Victor Ng Singal Transduction and G Protein-Coupled Receptors Singaling Pathways that Control Gene Expression 7 Dr. Chen, Ho-Ming Post-Transcriptional Gene Control 8 8 Dr.Shieh, Sheau-Yann The Eukaryotic Cell Cycle 8 9 Dr. Lin, Jung-Hsin Biomembrance Structure and Transport 8

2 B2 1 Bio Big Data Introduction & Overview Dr. Chuan-Hsiung Chang Integration of Multidimensional Omics Data 2 Dr. Sen-Lin Tang Microbiome Metagenomics 3 Dr. Shih, Arthur Chun-Chieh NGS Analytics 8 4 Dr. Chen, Ho-Ming Transcriptome and RNA-Seq Informatics 8 5 Dr. Ng, Victor Proteomics Informatics 8 6 Dr. Li, Ling-Hui Medical Genomics 8 7 Dr. Wang, John Population Genomics 8 8 Dr. Shen, Chen-Yang Biobank Genotyping 8 9 Dr. Lin, Jung-Hsin Pharmacogenomics 8 10 Dr. Ueng-Cheng Yang Translational Clinical Research Precision medicine and clinical informatics 11 Dr. Tsai, I-Sheng Comparative and Evolutionary Genomics 8

3 C1 1 Dr. Yu-Jung Chang Introduction to Data Structure I 8 Introduction to Data Structure II 8 3 Dr. Ting-Yi Sung Motif Finding 8 Graph Algorithms 8 2 Dr. Hsu, Wen-Lian Analysis of Algorithms 8 Recurrence 8 Algorithm techniques 8 4 Dr. Huai-Kuang Tsai Sequence Alignment I 8 Sequence Alignment II 8 5 Dr. Lin, Hsin-Nan The Analysis of Next Generation Sequencing Data I The Analysis of Next Generation Sequencing Data II 6 Dr. Chen, Ching-Tai Combinatorial Pattern Matching 8 Suffix Trees 8 7 Dr. Shih, Chun-Chieh Fundamentals of Molecular Evolution and Phylogenetic 8 Tree Construction

4 S1 1 Dr. Chen-Hsiang Yeang Descriptive Statistics, Genomic Data Analysis 8 2 Dr. Yang, Hsin-Chou Probability 24 Continuous Distributions, Expectations and Basic Statistics Discrete Distributions and Contingency Tables 3 Dr. Lu, Horng-Shing (Henry) Clustering Classification 4 Dr. Yuan, Shin Sheng Logistic Regression and Statistical Meta Analysis Comparative Study, Two Sample Test 5 Dr. Shieh, Grace Hypothesis Testing, P-value, False Discovery Rate Correlation, Regression Analysis and ANOVA 3 Dr. Chen, Hsuan-Yu Analysis of Categorical Data, Chisq and Multinomial Survival Data Analysis 7 Dr. Liu, Wei-Chung Nonparametric Statistics (I) 8 Nonparametric Statistics (II) 8

5 C2 Dr. Shen, Chih-Ya 1 Database: An Overview Introduction to Data Mining 2 Dr. Lee, Yuh-Jye Data Classification: Overview 8 Dr. Hwang, Wen-Liang 3 Standard Optimization Algorithms Support Vector Machines and Large Margin Kernel Methods 4 Dr.Huang, Hsuan-Cheng Network Analysis 8 5 Dr. Tsai, Huai-Kuang Nonstandard Optimization Algorithms 8 Dr. Tsao, Yu 6 Dr. Pao, Hsing-Kuo 7 Hidden Markov Models (I) Hidden Markov Models (II) Graphical Models (I) Graphical Models (II) 8 Dr. Tsai, Richard Tzong-Han Conditional Random Field 8 9 Dr. Chang,Yu-Rong MapReduce in Cloud Computing 8 24

6 S2 1 Dr. Chen, Hsuan-Yu Analysis of NGS data I Analysis of NGS data II 2 Dr. Yang, Hsin-Chou Statistics in Human Genetics II Statistics in Human Genetics I 3 Dr. Lu, Horng-Shing Maximum likelihood estimates and the EM algorithm I (Henry) Maximum likelihood estimates and the EM algorithm II Maximum likelihood estimates and the EM algorithm III Bayesian methods with Monte Carlo Markov Chains I Bayesian methods with Monte Carlo Markov Chains II 4 Dr. Shieh, Grace Non-parametric methods by permutation and bootstrap methods I Non-parametric methods by permutation and bootstrap methods II 5 Dr. Wu, Hank Clustering, classification and data visualization I Clustering, classification and data visualization II 6 Dr. Yuan, Shin Sheng Advanced regression and dimension reduction I Advanced regression and dimension reduction II 40

IAM2016W Program. January 27, 2016 (Wednesday) 15:00-16:30 Registration (Lobby) January 29, 2016 (Friday) 09:30-15:00 Registration

IAM2016W Program. January 27, 2016 (Wednesday) 15:00-16:30 Registration (Lobby) January 29, 2016 (Friday) 09:30-15:00 Registration IAM2016W Program January 27, 2016 (Wednesday) 15:00-16:30 Registration (Lobby) January 28, 2016 (Thursday) 09:30-15:00 Registration 10:00-12:00 Session A 13:30-15:30 Session B January 29, 2016 (Friday)

More information

IAM2018W Program. Jan. 30, 2018 (Tuesday) 15:30-16:30 Registration (Lobby, 1F) Jan. 31, 2018 (Wednesday) 07:30-17:00 Registration

IAM2018W Program. Jan. 30, 2018 (Tuesday) 15:30-16:30 Registration (Lobby, 1F) Jan. 31, 2018 (Wednesday) 07:30-17:00 Registration IAM2018W Program Jan. 30, 2018 (Tuesday) 15:30-16:30 Registration (Lobby, 1F) Room Jan. 31, 2018 (Wednesday) 07:30-17:00 Registration Olive Ⅰ (3F) 08:05-09:50 Session A 09:50-10:10 Social Time (Refreshments)

More information

IAM2017W Program. Feb. 8, 2017 (Wednesday) 08:00-16:00 Registration HATSUNE 初音 (5F) Feb. 9, 2017 (Thursday) 08:00-16:00 Registration

IAM2017W Program. Feb. 8, 2017 (Wednesday) 08:00-16:00 Registration HATSUNE 初音 (5F) Feb. 9, 2017 (Thursday) 08:00-16:00 Registration IAM2017W Program Feb. 7, 2017 (Tuesday) 15:00-16:30 Registration (HATSUNE 初音, 5F) Room 08:30-10:10 Session A Feb. 8, 2017 (Wednesday) 08:00-16:00 Registration HATSUNE 初音 (5F) 10:10-10:30 Social Time (Refreshment)

More information

COUNTRY SECTION. Taiwan Fishery products. Validity date from 17/04/2018 Date of publication 04/04/2018. List in force

COUNTRY SECTION. Taiwan Fishery products. Validity date from 17/04/2018 Date of publication 04/04/2018. List in force COUNTRY SECTION Taiwan Fishery products Validity date from 17/04/2018 Date of publication 04/04/2018 00345 List in force 2F30017 I-Mei Frozen Foods Company Limited Su-Ao Township Yilan County 2F30036 Hsien-Pin

More information

Genomics Research Center: Current Status & Future Development

Genomics Research Center: Current Status & Future Development Genomics Research Center: Current Status & Future Development Introduction Research in the life sciences has entered a new era after completion of the human genome project and the sequencing of the genomes

More information

Syllabus for BIOS 101, SPRING 2013

Syllabus for BIOS 101, SPRING 2013 Page 1 Syllabus for BIOS 101, SPRING 2013 Name: BIOSTATISTICS 101 for Cancer Researchers Time: March 20 -- May 29 4-5pm in Wednesdays, [except 4/15 (Mon) and 5/7 (Tue)] Location: SRB Auditorium Background

More information

Oral Presentation Session

Oral Presentation Session Oral Presentation Session 2016 International Conference on ICHTL May 6 th Session NO Title Aurthor 0002 Promoting hospitality students career decision making self-efficacy based on intern experiences Chung-Jen

More information

The Analysis of Chinese Authors Papers in Library and Information Science. Chen Yuecong1, a

The Analysis of Chinese Authors Papers in Library and Information Science. Chen Yuecong1, a 2nd International Conference on Economy, Management and Education Technology (ICEMET 2016) The Analysis of Chinese Authors Papers in Library and Information Science Chen Yuecong1, a 1 Library of North

More information

4. Hsueh-Chuan Hsu, Shih-Ching Wu, Shih-Kuang Hsu, Chih-Cheng Hsu, Wen-Fu Ho (2016)

4. Hsueh-Chuan Hsu, Shih-Ching Wu, Shih-Kuang Hsu, Chih-Cheng Hsu, Wen-Fu Ho (2016) Name:Shih-Kuang Hsu Education: Ph. D., Institute of molecular biology, National Chung-Hsing University M. D., Institute of molecular biology, National Chung-Hsing University B. D., Department of Botany,

More information

國際期刊 SCI 論文 Wei-Lung Chou* Accepted in October, 2009 (SCI, IF=1.155, 2008) (Corresponding author) Wei-Lung Chou* Accepted in September, 2009

國際期刊 SCI 論文 Wei-Lung Chou* Accepted in October, 2009 (SCI, IF=1.155, 2008) (Corresponding author) Wei-Lung Chou* Accepted in September, 2009 SCI 1. Wei-Lung Chou*, Chih-Ta Wang, Kai-Yu Huang, Investigation of process parameters for the removal of polyvinyl alcohol from aqueous solution by iron electrocoagulation, Desalination, Accepted in October,

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

Dissecting the Human Protein-Protein Interaction Network via Phylogenetic Decomposition

Dissecting the Human Protein-Protein Interaction Network via Phylogenetic Decomposition Dissecting the Human Protein-Protein Interaction Network via Phylogenetic Decomposition Cho-Yi Chen 1, Andy Ho 2, Hsin-Yuan Huang 3, Hsueh-Fen Juan 1,2,*, Hsuan-Cheng Huang 4,* 1 Genome and Systems Biology

More information

No. Name College Major Email 1 Ke Yang Chuan College of Science Chemistry key@cup.edu.cn 2 Wang Li Qun College of Science Mathematics wliqunhmily@gmail.com 3 Xu Tao College of Science Mathematics xutao@cup.edu.cn

More information

Shyh-Ming Huang ( 黃識銘 )

Shyh-Ming Huang ( 黃識銘 ) Shyh-Ming Huang ( 黃識銘 ) Department of Marketing and Logistics Management Southern Taiwan University of Science Technology No. 1, Nan-Tai Street, Yongkang Dist., Tainan City 71005, Taiwan Office: T1128

More information

CoTri: extracting chemical-disease relations with co-reference resolution and common trigger words

CoTri: extracting chemical-disease relations with co-reference resolution and common trigger words CoTri: extracting chemical-disease relations with co-reference resolution and common trigger words Yu-De Chen1, Juin-Huang Ju2, Ming-Yu Chien3, Yu-Cheng Sheng4, Tsung-Lu Lee5, Jung-Hsien Chiang*6 12346Department

More information

Study on the Application of Data Mining in Bioinformatics. Mingyang Yuan

Study on the Application of Data Mining in Bioinformatics. Mingyang Yuan International Conference on Mechatronics Engineering and Information Technology (ICMEIT 2016) Study on the Application of Mining in Bioinformatics Mingyang Yuan School of Science and Liberal Arts, New

More information

Poster Session 1. Room: 4F, Building B

Poster Session 1. Room: 4F, Building B Poster Session 1 Time:13:30-15:00 Guoqing Ma, Yantai University, China Jieh-Shian Young, National Changhua University of Education, Taiwan 1005 ESTABLISHING A SMART HOME BASED ON NI MYRIO Kai-chao Yao,

More information

JOURNAL PAPERS [SCI IF=2.788, 29/122, RADIOLOGY, NUCLEAR MEDICINE & MEDICAL IMAGING] 共 5 頁, 第 1 頁

JOURNAL PAPERS [SCI IF=2.788, 29/122, RADIOLOGY, NUCLEAR MEDICINE & MEDICAL IMAGING] 共 5 頁, 第 1 頁 JOURNAL PAPERS [SCI IF=4.338, 13/122, RADIOLOGY, NUCLEAR MEDICINE & MEDICAL IMAGING] 1. Jui-Hsun Fu, Tzu-Chao Chuang, Hsiao-Wen Chung, Hing-Chiu Chang, Huey-Shyan Lin, Shu-Shong Hsu, Po-Chin Wang, Shuo-Hsiu

More information

Department of Business Administration, National Central University, Taiwan. Industrial Engineering and Management Sciences,

Department of Business Administration, National Central University, Taiwan. Industrial Engineering and Management Sciences, Chien-wen Shen Experience Associate Professor 2014/08 Present Department of Business Administration, National Central University, Taiwan Director 2015/03 Present Yunus Social Business Centre, National

More information

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Session A1. Room: College of Management Bldg.104 Chair: Prof. B.Y. Leu. Time No. Author(s) Title Page

Session A1. Room: College of Management Bldg.104 Chair: Prof. B.Y. Leu. Time No. Author(s) Title Page Session A1 Room: College of Management Bldg.104 Chair: Prof. B.Y. Leu 1 Shih-Wei Lan, Chung Yeh Machine tool plant implementing TPM to improve Overall Equipment Efficiency (OEE) 28 13 Jhao- Yu Meng, Ji-Cyuan

More information

Results of Applications for the 2016 Integrated Thematic Projects at Academia Sinica Announced

Results of Applications for the 2016 Integrated Thematic Projects at Academia Sinica Announced Results of Applications for the 2016 Integrated Thematic Projects at Academia Announced There is a total of 23 applications for the 2016 Thematic Projects (7 from Division of Mathematics and Physical Sciences;

More information

Data Mining for Biological Data Analysis

Data Mining for Biological Data Analysis Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han

More information

DEPARTMENT OF HYDRAULIC & OCEAN ENGINEERING

DEPARTMENT OF HYDRAULIC & OCEAN ENGINEERING DEPARTMENT OF HYDRAULIC & OCEAN ENGINEERING TEL: +886-6-275-7575 EXT. 63200 FAX: +886-6-2741463 E-MAIL: em63200@email.ncku.edu.tw BRIEF INTRODUCTION The Department of Hydraulic and Ocean Engineering was

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Finding Regularity in Protein Secondary Structures using a Cluster-based Genetic Algorithm

Finding Regularity in Protein Secondary Structures using a Cluster-based Genetic Algorithm Finding Regularity in Protein Secondary Structures using a Cluster-based Genetic Algorithm Yen-Wei Chu 1,3, Chuen-Tsai Sun 3, Chung-Yuan Huang 2,3 1) Department of Information Management 2) Department

More information

Conference Proceedings (EQC 2012)

Conference Proceedings (EQC 2012) Conference Proceedings (EQC 2012) Oral Presentation: Session I-A (13: 00 14: 40) Session Chair: Prof. Min-Der Lin, National Chung Hsing University Session Chair: Prof. Zeng-Yei Hseu, National Pingtung

More information

Rm 209, Rm 210 (till 12:30) W3: Graphing causality: Digging the directed acyclic (Chin-Chi Joseph Kuo) Rm 211

Rm 209, Rm 210 (till 12:30) W3: Graphing causality: Digging the directed acyclic (Chin-Chi Joseph Kuo) Rm 211 Thursday, June 21 09:00-15:30 Workshops W1: Recent methodologies for looking at the health impact of Climate and Air Pollution (Joel Schwartz) W2: Application of micro-sensors and exposure modeling in

More information

Masters in Quantitative and Systems Biology (QSB) Program offered by The Department of Molecular Biosciences, Northwestern University

Masters in Quantitative and Systems Biology (QSB) Program offered by The Department of Molecular Biosciences, Northwestern University Masters in Quantitative and Systems Biology (QSB) Program offered by The Department of Molecular Biosciences, Northwestern University Syllabus for 2018-2019 (version 2018-11-20) Note: Syllabus is subject

More information

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG

ALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG Chapman & Hall/CRC Mathematical and Computational Biology Series ALGORITHMS IN BIO INFORMATICS A PRACTICAL INTRODUCTION WING-KIN SUNG CRC Press Taylor & Francis Group Boca Raton London New York CRC Press

More information

Supplementary Information

Supplementary Information Supplementary Information Two new susceptibility loci for Kawasaki disease identified through genome-wide association analysis Yi-Ching Lee 1,2, Ho-Chang Kuo 3,4, Jeng-Sheng Chang,Luan-Yin Chang 6,1, Li-Min

More information

CURRICULUM VITAE. Editor-in-Chief, Maritime Business Review (Emerald Group Publishing)

CURRICULUM VITAE. Editor-in-Chief, Maritime Business Review (Emerald Group Publishing) CURRICULUM VITAE Professor Chin-Shan Lu ( 呂錦山 ), Ph.D. Address: Department of Logistics and Maritime Studies, Director, C.Y. Tung International Centre for Maritime Studies, The Hong Kong Polytechnic University,

More information

Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018

Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party

More information

A. Positions and Honors

A. Positions and Honors BIOGRAPHICAL SKETCH NAME in English Chao-Sung Lai NAME in Chinese 賴朝松 POSITION TITLE Professor, Department of Electronic Engineering EDUCATION/TRAINING INSTITUTION AND LOCATION DEGREE (if applicable) MM/YY

More information

3. Department of Biomedical Engineering, Chung Yuan Christian University, Taiwan

3. Department of Biomedical Engineering, Chung Yuan Christian University, Taiwan Chun-Hsu Yao, Ph.D. Professor, Department of Biological Imaging and Radiological Science, School of Chinese Medicine, China Medical University, Taichung, Taiwan Tel:886-4-22053366 ext.7806;3325 e-mail:chyao@mail.cmu.edu.tw

More information

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What

More information

The 3 rd Asian Hygiene of Occupational Network Conference List of Poster Presentations

The 3 rd Asian Hygiene of Occupational Network Conference List of Poster Presentations P1: Chemical Exposure and Control P101 Filtration characteristics of filtering facepieces Yu-Lin Tseng P102 Using silicone wristbands as a personal sampler to monitor the exposures of airborne terpenes

More information

BIOINFORMATICS THE MACHINE LEARNING APPROACH

BIOINFORMATICS THE MACHINE LEARNING APPROACH 88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and

More information

advanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA

advanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents

More information

Smart India Hackathon

Smart India Hackathon TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential

More information

Date Time Venue Speaker Title Moderator. Division of Mathematics and Physical Sciences. Dr. Tse-Ming Chen (Nat'l Cheng Kung Univ.)

Date Time Venue Speaker Title Moderator. Division of Mathematics and Physical Sciences. Dr. Tse-Ming Chen (Nat'l Cheng Kung Univ.) LECTURES Division of Mathematics and Physical Sciences Auditorium, 1F, Inst. of Physics Dr. Tse-Ming (Nat'l g Kung Univ.) What Quantum Point Contacts Can Do to Advance Spintronics Dr. Wei-Li Lee A108 Conference

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

University of Michigan, Ann Arbor

University of Michigan, Ann Arbor Zing Tsung-Yeh Tsai is a bioinformatics research fellow in the University of Michigan, focusing on functional genomics, in particular interested in understanding gene regulation and evolutionary mechanism

More information

AUTO 2018 PROGRAM SCHEDULE

AUTO 2018 PROGRAM SCHEDULE AUTO 2018 PROGRAM SCHEDULE Session Title: Artificial Intelligence Room:Chung Kang Room Time:09:00-10:20 Dec. 07, 2018 Prof. Feng-Chang Gu TP1-1 #1078 Low Cost Eye Tracking and Gaze Estimation Techniques

More information

BIOSTATISTICS AND MEDICAL INFORMATICS (B M I)

BIOSTATISTICS AND MEDICAL INFORMATICS (B M I) Biostatistics and Medical Informatics (B M I) 1 BIOSTATISTICS AND MEDICAL INFORMATICS (B M I) B M I/POP HLTH 451 INTRODUCTION TO SAS PROGRAMMING FOR 2 credits. Use of the SAS programming language for the

More information

Office: No.1, Shih-Chuan 1st Road, Kaohsiung 807, Taiwan, ROC. Tel: ext.2677,

Office: No.1, Shih-Chuan 1st Road, Kaohsiung 807, Taiwan, ROC. Tel: ext.2677, 王志光教授 Chih-Kuang Wang, Ph.D. Office: No.1, Shih-Chuan 1st Road, Kaohsiung 807, Taiwan, ROC. Tel: +886-7-3121101 ext.2677, 2553 Email: ckwang@kmu.edu.tw Affiliation Division of Industry and University Cooperation,

More information

CSC 2427: Algorithms in Molecular Biology Lecture #14

CSC 2427: Algorithms in Molecular Biology Lecture #14 CSC 2427: Algorithms in Molecular Biology Lecture #14 Lecturer: Michael Brudno Scribe Note: Hyonho Lee Department of Computer Science University of Toronto 03 March 2006 Microarrays Revisited In the last

More information

CURRICULUM VITAE. Editor-in-Chief, Maritime Business Review (Emerald Group Publishing)

CURRICULUM VITAE. Editor-in-Chief, Maritime Business Review (Emerald Group Publishing) CURRICULUM VITAE Professor Chin-Shan Lu ( 呂錦山 ), Ph.D. Address: Department of Logistics and Maritime Studies, Director, C.Y. Tung International Centre for Maritime Studies, The Hong Kong Polytechnic University,

More information

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

Where innovations are shaping a new era of intelligent healthcare

Where innovations are shaping a new era of intelligent healthcare EXPO 11.29-12.02 TAIWAN Where innovations are shaping a new era of intelligent healthcare World-class medical centers and advanced medical specialties Most influential IT, ICT & Electronics industry in

More information

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D. Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range

More information

Applying IPA Model to Analyze Real Estate Marketing Strategy - Taking Green Building as an Example

Applying IPA Model to Analyze Real Estate Marketing Strategy - Taking Green Building as an Example Applying IPA Model to Analyze Real Estate Marketing Strategy - Taking Green Building as an Example SEAN TE-HSUN LIN, ANDREW YI-HUNG LIANG Department of Finance National Changhua University of Education

More information

Our website:

Our website: Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate

More information

The Application of RFID in Emergency Medicine

The Application of RFID in Emergency Medicine The Fourth International Conference on Electronic Business (ICEB2004) / Beijing 1201 The Application of RFID in Emergency Medicine Tsai W.C. 1, Frank Kuo 2, Yuehching Lee 2, F. Wu 2 1 Institute of Health

More information

6 B-P B-P B-P C-P C-P C-P C-P C-P B-P C-P C-P C-P-08 Yung-Lan Yeh

6 B-P B-P B-P C-P C-P C-P C-P C-P B-P C-P C-P C-P-08 Yung-Lan Yeh Poster Presentation 2 (Session B& C) Present Time and Duration: 13:00-14:30, October 19 Location: E-13 Lobby Poster dimensions :100 cm high x 80 cm wide.(maximum) Easychair No. ISNST2017 ID Authors Title

More information

Recommendations from the BCB Graduate Curriculum Committee 1

Recommendations from the BCB Graduate Curriculum Committee 1 Recommendations from the BCB Graduate Curriculum Committee 1 Vasant Honavar, Volker Brendel, Karin Dorman, Scott Emrich, David Fernandez-Baca, and Steve Willson April 10, 2006 Background The current BCB

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not

More information

AUTO 2018 PROGRAM SCHEDULE

AUTO 2018 PROGRAM SCHEDULE AUTO 2018 PROGRAM SCHEDULE Session Name: Artificial Intelligence Room:Chung Kang Room Time:09:00-10:20 Dec. 07, 2018 Prof. Feng-Chang Gu TP1-1 #1078 Low Cost Eye Tracking and Gaze Estimation Techniques

More information

Gene Expression Data Analysis

Gene Expression Data Analysis Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based

More information

Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart

Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart Hospital, Norfolk, VA Disclosure Consulting: Livanova,

More information

VALLIAMMAI ENGINEERING COLLEGE

VALLIAMMAI ENGINEERING COLLEGE VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

LAND SECTIE. Taiwan Visserijproducten. Van kracht sinds 02/09/2018 Datum van publicatie 28/09/2018. Lijst van kracht.

LAND SECTIE. Taiwan Visserijproducten. Van kracht sinds 02/09/2018 Datum van publicatie 28/09/2018. Lijst van kracht. LAND SECTIE Taiwan Visseijpoducten Van kacht sinds 02/09/2018 Datum van publicatie 28/09/2018 00362 Lijst van kacht Ekenningsnumme Naam Stad Regio's Activiteiten Voetnoot Aanvaagdatum 2F30017 I-Mei Fozen

More information

Global Entrepreneurship and Innovation in Management (GEIM) Conference

Global Entrepreneurship and Innovation in Management (GEIM) Conference 2014 Global Entrepreneurship and Innovation in Management (GEIM) Conference in partnership with Journal of Business Research Special Issue, May 14-15, 2014, Taichung, Taiwan College of Management National

More information

In silico prediction of novel therapeutic targets using gene disease association data

In silico prediction of novel therapeutic targets using gene disease association data In silico prediction of novel therapeutic targets using gene disease association data, PhD, Associate GSK Fellow Scientific Leader, Computational Biology and Stats, Target Sciences GSK Big Data in Medicine

More information

The Benefits Analysis of Environmental Management Investment in Taiwan s Industries

The Benefits Analysis of Environmental Management Investment in Taiwan s Industries The Benefits Analysis of Environmental Management Investment in Taiwan s Industries 1 Shiaw-Wen Tien, 2 Yi-Chan Chung, 3 Chih-Hung Tsai, and 4 Wen-Chuan Su 1,4 Graduate School of Technology Management

More information

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics

More information

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)

More information

Inferring Cellular Networks Using Probabilis6c Graphical Models. Jianlin Cheng, PhD University of Missouri 2010

Inferring Cellular Networks Using Probabilis6c Graphical Models. Jianlin Cheng, PhD University of Missouri 2010 Inferring Cellular Networks Using Probabilis6c Graphical Models Jianlin Cheng, PhD University of Missouri 2010 Bayesian Network So@ware hap://www.cs.ubc.ca/~murphyk/so@ware/ BNT/bnso@.html Demo References

More information

Mitigative Capacities of Plant Disposition Types and Space Types on. Urban Heat Island Effect. LU & Bo WANG b

Mitigative Capacities of Plant Disposition Types and Space Types on. Urban Heat Island Effect. LU & Bo WANG b Mitigative Capacities of Plant Disposition Types and Space Types on Urban Heat Island Effect Ying-ying LIUa & Yu-chen GUO & Xiang-dong XIAO & Sai WANG & Xiao-ping LU & Bo WANG b Department of horticulture,

More information

Suberoylanilide Hydroxamic Acid Treatment Reveals. Crosstalks among Proteome, Ubiquitylome and Acetylome

Suberoylanilide Hydroxamic Acid Treatment Reveals. Crosstalks among Proteome, Ubiquitylome and Acetylome Suberoylanilide Hydroxamic Acid Treatment Reveals Crosstalks among Proteome, Ubiquitylome and Acetylome in Non-Small Cell Lung Cancer A549 Cell Line Quan Wu 1, Zhongyi Cheng 2, Jun Zhu 3, Weiqing Xu 1,

More information

李志偉著作目錄 ( ) SCI/EI 期刊論文

李志偉著作目錄 ( ) SCI/EI 期刊論文 SCI/EI 期刊論文 李志偉著作目錄 (2009-2014) 1. Yueh-Chien Lee, Sheng-Yao Hu, Walter Water, Kwong-Kau Tiong, Zhe-Chuan Feng, Yen-Ting Chen, Jen-Ching Huang, Jyh-Wei Lee, Chia-Chih Huang, Jyi-Lai Shen, Mou-Hong Cheng,

More information

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH

More information

Biomedical Big Data and Precision Medicine

Biomedical Big Data and Precision Medicine Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types

More information

National Pingtung University of Science and Technology

National Pingtung University of Science and Technology Department :Department of Environmental Science and Engineering Program Grade : 1 Class : A Freshman English(1) R 2 2 7 8 English Listening & Speaking R 1 2 5 6 Practice 101 Courses of General Education

More information

Knowledge-Guided Analysis with KnowEnG Lab

Knowledge-Guided Analysis with KnowEnG Lab Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing

More information

Network System Inference

Network System Inference Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What

More information

7, No. 1, Vol. face of uncertainty. condition. 1. Evaluation of. rainfalls. reclamation. 4. A case record. areas

7, No. 1, Vol. face of uncertainty. condition. 1. Evaluation of. rainfalls. reclamation. 4. A case record. areas Journal of GeoEngineering Paper List (2012-2008) 7, No. 3, 2012 1. Reliability-based robust and optimal design of shallow foundations in cohesionless soil in the face of uncertainty Hsein Juang, Lei Wang,

More information

Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017

Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017 New Tools for Personalized Medicine *Tools = Assays, Devices, Software Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017 http://epigenomics.cemm.oeaw.ac.at http://biomedical-sequencing.at

More information

Bioinformatics. Lecturer: Antinisca Di Marco Tutor: Francesco Gallo

Bioinformatics. Lecturer: Antinisca Di Marco Tutor: Francesco Gallo Bioinformatics Lecturer: Antinisca Di Marco Tutor: Francesco Gallo E mails: nome.cognome@univaq.it For appointment Di Marco: Tuersday 3.30 4:30 p.m. Friday 10:00-11:00 a.m. please ask appointment via email

More information

ICSA 2013 EXECUTIVES AND MEMBERS OF THE COMMITTEES

ICSA 2013 EXECUTIVES AND MEMBERS OF THE COMMITTEES ICSA 2013 EXECUTIVES AND MEMBERS OF THE COMMITTEES EXECUTIVES President: Ming-Hui Chen (2013) Past President: Ivan S.F. Chan (2013), President-elect: Ying Lu (2013), Executive Director: Shu-Yen Ho (2011-2013),

More information

1. The Subject and Aims of Research Silicon nanowires-based solar cells: Si-based solar cells Pyramid Silicon nanowire (SiNW) SiNW/pyramid

1. The Subject and Aims of Research Silicon nanowires-based solar cells: Si-based solar cells Pyramid Silicon nanowire (SiNW) SiNW/pyramid Optoelectronics and Semiconductor Group Professor Bohr-Ran Huang Ph.D., Michigan State University, U.S.A. Field of study: nanomaterials and devices, optoelectronic thin films devices, biophotonics and

More information

TREE CODE PRODUCT BROCHURE

TREE CODE PRODUCT BROCHURE TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for

More information

Statistical Methods for Network Analysis of Biological Data

Statistical Methods for Network Analysis of Biological Data The Protein Interaction Workshop, 8 12 June 2015, IMS Statistical Methods for Network Analysis of Biological Data Minghua Deng, dengmh@pku.edu.cn School of Mathematical Sciences Center for Quantitative

More information

Predictive and Causal Modeling in the Health Sciences. Sisi Ma MS, MS, PhD. New York University, Center for Health Informatics and Bioinformatics

Predictive and Causal Modeling in the Health Sciences. Sisi Ma MS, MS, PhD. New York University, Center for Health Informatics and Bioinformatics Predictive and Causal Modeling in the Health Sciences Sisi Ma MS, MS, PhD. New York University, Center for Health Informatics and Bioinformatics 1 Exponentially Rapid Data Accumulation Protein Sequencing

More information

Results of Applications for the 2013 Integrated Thematic Projects at Academia Sinica Announced

Results of Applications for the 2013 Integrated Thematic Projects at Academia Sinica Announced Results of Applications for the 2013 Integrated Thematic Projects at Academia Announced There is a total of 34 applications for the 2013 Thematic Projects (11 from Division of Mathematics and Physical

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 8 th 2016 Info and documentation http://tbb.bio.uu.nl/bda/ http://www.google.com/

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

More information