2017 Qualifying Examination
|
|
- Gavin Oliver
- 5 years ago
- Views:
Transcription
1 B1 1 Basic Molecular Genetics Mechanisms Dr. Ueng-Cheng Yang Molecular Genetics Techniques Cellular Energetics 24 2 Dr. Dar-Yi Wang Transcriptional Control of Gene Expression 8 3 Dr. Chuan-Hsiung Chang Molecules, Cells, and Evolution Genes, Genomics, and Chromosomes 4 Dr. Jou, Yuh-Shasn Cancer 8 5 Dr. Jie-Rong Huang Protein structure and function Chemical Foundations 6 Dr. Wailap Victor Ng Singal Transduction and G Protein-Coupled Receptors Singaling Pathways that Control Gene Expression 7 Dr. Chen, Ho-Ming Post-Transcriptional Gene Control 8 8 Dr.Shieh, Sheau-Yann The Eukaryotic Cell Cycle 8 9 Dr. Lin, Jung-Hsin Biomembrance Structure and Transport 8
2 B2 1 Bio Big Data Introduction & Overview Dr. Chuan-Hsiung Chang Integration of Multidimensional Omics Data 2 Dr. Sen-Lin Tang Microbiome Metagenomics 3 Dr. Shih, Arthur Chun-Chieh NGS Analytics 8 4 Dr. Chen, Ho-Ming Transcriptome and RNA-Seq Informatics 8 5 Dr. Ng, Victor Proteomics Informatics 8 6 Dr. Li, Ling-Hui Medical Genomics 8 7 Dr. Wang, John Population Genomics 8 8 Dr. Shen, Chen-Yang Biobank Genotyping 8 9 Dr. Lin, Jung-Hsin Pharmacogenomics 8 10 Dr. Ueng-Cheng Yang Translational Clinical Research Precision medicine and clinical informatics 11 Dr. Tsai, I-Sheng Comparative and Evolutionary Genomics 8
3 C1 1 Dr. Yu-Jung Chang Introduction to Data Structure I 8 Introduction to Data Structure II 8 3 Dr. Ting-Yi Sung Motif Finding 8 Graph Algorithms 8 2 Dr. Hsu, Wen-Lian Analysis of Algorithms 8 Recurrence 8 Algorithm techniques 8 4 Dr. Huai-Kuang Tsai Sequence Alignment I 8 Sequence Alignment II 8 5 Dr. Lin, Hsin-Nan The Analysis of Next Generation Sequencing Data I The Analysis of Next Generation Sequencing Data II 6 Dr. Chen, Ching-Tai Combinatorial Pattern Matching 8 Suffix Trees 8 7 Dr. Shih, Chun-Chieh Fundamentals of Molecular Evolution and Phylogenetic 8 Tree Construction
4 S1 1 Dr. Chen-Hsiang Yeang Descriptive Statistics, Genomic Data Analysis 8 2 Dr. Yang, Hsin-Chou Probability 24 Continuous Distributions, Expectations and Basic Statistics Discrete Distributions and Contingency Tables 3 Dr. Lu, Horng-Shing (Henry) Clustering Classification 4 Dr. Yuan, Shin Sheng Logistic Regression and Statistical Meta Analysis Comparative Study, Two Sample Test 5 Dr. Shieh, Grace Hypothesis Testing, P-value, False Discovery Rate Correlation, Regression Analysis and ANOVA 3 Dr. Chen, Hsuan-Yu Analysis of Categorical Data, Chisq and Multinomial Survival Data Analysis 7 Dr. Liu, Wei-Chung Nonparametric Statistics (I) 8 Nonparametric Statistics (II) 8
5 C2 Dr. Shen, Chih-Ya 1 Database: An Overview Introduction to Data Mining 2 Dr. Lee, Yuh-Jye Data Classification: Overview 8 Dr. Hwang, Wen-Liang 3 Standard Optimization Algorithms Support Vector Machines and Large Margin Kernel Methods 4 Dr.Huang, Hsuan-Cheng Network Analysis 8 5 Dr. Tsai, Huai-Kuang Nonstandard Optimization Algorithms 8 Dr. Tsao, Yu 6 Dr. Pao, Hsing-Kuo 7 Hidden Markov Models (I) Hidden Markov Models (II) Graphical Models (I) Graphical Models (II) 8 Dr. Tsai, Richard Tzong-Han Conditional Random Field 8 9 Dr. Chang,Yu-Rong MapReduce in Cloud Computing 8 24
6 S2 1 Dr. Chen, Hsuan-Yu Analysis of NGS data I Analysis of NGS data II 2 Dr. Yang, Hsin-Chou Statistics in Human Genetics II Statistics in Human Genetics I 3 Dr. Lu, Horng-Shing Maximum likelihood estimates and the EM algorithm I (Henry) Maximum likelihood estimates and the EM algorithm II Maximum likelihood estimates and the EM algorithm III Bayesian methods with Monte Carlo Markov Chains I Bayesian methods with Monte Carlo Markov Chains II 4 Dr. Shieh, Grace Non-parametric methods by permutation and bootstrap methods I Non-parametric methods by permutation and bootstrap methods II 5 Dr. Wu, Hank Clustering, classification and data visualization I Clustering, classification and data visualization II 6 Dr. Yuan, Shin Sheng Advanced regression and dimension reduction I Advanced regression and dimension reduction II 40
IAM2016W Program. January 27, 2016 (Wednesday) 15:00-16:30 Registration (Lobby) January 29, 2016 (Friday) 09:30-15:00 Registration
IAM2016W Program January 27, 2016 (Wednesday) 15:00-16:30 Registration (Lobby) January 28, 2016 (Thursday) 09:30-15:00 Registration 10:00-12:00 Session A 13:30-15:30 Session B January 29, 2016 (Friday)
More informationIAM2018W Program. Jan. 30, 2018 (Tuesday) 15:30-16:30 Registration (Lobby, 1F) Jan. 31, 2018 (Wednesday) 07:30-17:00 Registration
IAM2018W Program Jan. 30, 2018 (Tuesday) 15:30-16:30 Registration (Lobby, 1F) Room Jan. 31, 2018 (Wednesday) 07:30-17:00 Registration Olive Ⅰ (3F) 08:05-09:50 Session A 09:50-10:10 Social Time (Refreshments)
More informationIAM2017W Program. Feb. 8, 2017 (Wednesday) 08:00-16:00 Registration HATSUNE 初音 (5F) Feb. 9, 2017 (Thursday) 08:00-16:00 Registration
IAM2017W Program Feb. 7, 2017 (Tuesday) 15:00-16:30 Registration (HATSUNE 初音, 5F) Room 08:30-10:10 Session A Feb. 8, 2017 (Wednesday) 08:00-16:00 Registration HATSUNE 初音 (5F) 10:10-10:30 Social Time (Refreshment)
More informationCOUNTRY SECTION. Taiwan Fishery products. Validity date from 17/04/2018 Date of publication 04/04/2018. List in force
COUNTRY SECTION Taiwan Fishery products Validity date from 17/04/2018 Date of publication 04/04/2018 00345 List in force 2F30017 I-Mei Frozen Foods Company Limited Su-Ao Township Yilan County 2F30036 Hsien-Pin
More informationGenomics Research Center: Current Status & Future Development
Genomics Research Center: Current Status & Future Development Introduction Research in the life sciences has entered a new era after completion of the human genome project and the sequencing of the genomes
More informationSyllabus for BIOS 101, SPRING 2013
Page 1 Syllabus for BIOS 101, SPRING 2013 Name: BIOSTATISTICS 101 for Cancer Researchers Time: March 20 -- May 29 4-5pm in Wednesdays, [except 4/15 (Mon) and 5/7 (Tue)] Location: SRB Auditorium Background
More informationOral Presentation Session
Oral Presentation Session 2016 International Conference on ICHTL May 6 th Session NO Title Aurthor 0002 Promoting hospitality students career decision making self-efficacy based on intern experiences Chung-Jen
More informationThe Analysis of Chinese Authors Papers in Library and Information Science. Chen Yuecong1, a
2nd International Conference on Economy, Management and Education Technology (ICEMET 2016) The Analysis of Chinese Authors Papers in Library and Information Science Chen Yuecong1, a 1 Library of North
More information4. Hsueh-Chuan Hsu, Shih-Ching Wu, Shih-Kuang Hsu, Chih-Cheng Hsu, Wen-Fu Ho (2016)
Name:Shih-Kuang Hsu Education: Ph. D., Institute of molecular biology, National Chung-Hsing University M. D., Institute of molecular biology, National Chung-Hsing University B. D., Department of Botany,
More information國際期刊 SCI 論文 Wei-Lung Chou* Accepted in October, 2009 (SCI, IF=1.155, 2008) (Corresponding author) Wei-Lung Chou* Accepted in September, 2009
SCI 1. Wei-Lung Chou*, Chih-Ta Wang, Kai-Yu Huang, Investigation of process parameters for the removal of polyvinyl alcohol from aqueous solution by iron electrocoagulation, Desalination, Accepted in October,
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationDissecting the Human Protein-Protein Interaction Network via Phylogenetic Decomposition
Dissecting the Human Protein-Protein Interaction Network via Phylogenetic Decomposition Cho-Yi Chen 1, Andy Ho 2, Hsin-Yuan Huang 3, Hsueh-Fen Juan 1,2,*, Hsuan-Cheng Huang 4,* 1 Genome and Systems Biology
More informationNo. Name College Major Email 1 Ke Yang Chuan College of Science Chemistry key@cup.edu.cn 2 Wang Li Qun College of Science Mathematics wliqunhmily@gmail.com 3 Xu Tao College of Science Mathematics xutao@cup.edu.cn
More informationShyh-Ming Huang ( 黃識銘 )
Shyh-Ming Huang ( 黃識銘 ) Department of Marketing and Logistics Management Southern Taiwan University of Science Technology No. 1, Nan-Tai Street, Yongkang Dist., Tainan City 71005, Taiwan Office: T1128
More informationCoTri: extracting chemical-disease relations with co-reference resolution and common trigger words
CoTri: extracting chemical-disease relations with co-reference resolution and common trigger words Yu-De Chen1, Juin-Huang Ju2, Ming-Yu Chien3, Yu-Cheng Sheng4, Tsung-Lu Lee5, Jung-Hsien Chiang*6 12346Department
More informationStudy on the Application of Data Mining in Bioinformatics. Mingyang Yuan
International Conference on Mechatronics Engineering and Information Technology (ICMEIT 2016) Study on the Application of Mining in Bioinformatics Mingyang Yuan School of Science and Liberal Arts, New
More informationPoster Session 1. Room: 4F, Building B
Poster Session 1 Time:13:30-15:00 Guoqing Ma, Yantai University, China Jieh-Shian Young, National Changhua University of Education, Taiwan 1005 ESTABLISHING A SMART HOME BASED ON NI MYRIO Kai-chao Yao,
More informationJOURNAL PAPERS [SCI IF=2.788, 29/122, RADIOLOGY, NUCLEAR MEDICINE & MEDICAL IMAGING] 共 5 頁, 第 1 頁
JOURNAL PAPERS [SCI IF=4.338, 13/122, RADIOLOGY, NUCLEAR MEDICINE & MEDICAL IMAGING] 1. Jui-Hsun Fu, Tzu-Chao Chuang, Hsiao-Wen Chung, Hing-Chiu Chang, Huey-Shyan Lin, Shu-Shong Hsu, Po-Chin Wang, Shuo-Hsiu
More informationDepartment of Business Administration, National Central University, Taiwan. Industrial Engineering and Management Sciences,
Chien-wen Shen Experience Associate Professor 2014/08 Present Department of Business Administration, National Central University, Taiwan Director 2015/03 Present Yunus Social Business Centre, National
More informationChina National Grid --- BioNode. Jun Wang Beijing Genomics Institute
China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationSession A1. Room: College of Management Bldg.104 Chair: Prof. B.Y. Leu. Time No. Author(s) Title Page
Session A1 Room: College of Management Bldg.104 Chair: Prof. B.Y. Leu 1 Shih-Wei Lan, Chung Yeh Machine tool plant implementing TPM to improve Overall Equipment Efficiency (OEE) 28 13 Jhao- Yu Meng, Ji-Cyuan
More informationResults of Applications for the 2016 Integrated Thematic Projects at Academia Sinica Announced
Results of Applications for the 2016 Integrated Thematic Projects at Academia Announced There is a total of 23 applications for the 2016 Thematic Projects (7 from Division of Mathematics and Physical Sciences;
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationDEPARTMENT OF HYDRAULIC & OCEAN ENGINEERING
DEPARTMENT OF HYDRAULIC & OCEAN ENGINEERING TEL: +886-6-275-7575 EXT. 63200 FAX: +886-6-2741463 E-MAIL: em63200@email.ncku.edu.tw BRIEF INTRODUCTION The Department of Hydraulic and Ocean Engineering was
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationFinding Regularity in Protein Secondary Structures using a Cluster-based Genetic Algorithm
Finding Regularity in Protein Secondary Structures using a Cluster-based Genetic Algorithm Yen-Wei Chu 1,3, Chuen-Tsai Sun 3, Chung-Yuan Huang 2,3 1) Department of Information Management 2) Department
More informationConference Proceedings (EQC 2012)
Conference Proceedings (EQC 2012) Oral Presentation: Session I-A (13: 00 14: 40) Session Chair: Prof. Min-Der Lin, National Chung Hsing University Session Chair: Prof. Zeng-Yei Hseu, National Pingtung
More informationRm 209, Rm 210 (till 12:30) W3: Graphing causality: Digging the directed acyclic (Chin-Chi Joseph Kuo) Rm 211
Thursday, June 21 09:00-15:30 Workshops W1: Recent methodologies for looking at the health impact of Climate and Air Pollution (Joel Schwartz) W2: Application of micro-sensors and exposure modeling in
More informationMasters in Quantitative and Systems Biology (QSB) Program offered by The Department of Molecular Biosciences, Northwestern University
Masters in Quantitative and Systems Biology (QSB) Program offered by The Department of Molecular Biosciences, Northwestern University Syllabus for 2018-2019 (version 2018-11-20) Note: Syllabus is subject
More informationALGORITHMS IN BIO INFORMATICS. Chapman & Hall/CRC Mathematical and Computational Biology Series A PRACTICAL INTRODUCTION. CRC Press WING-KIN SUNG
Chapman & Hall/CRC Mathematical and Computational Biology Series ALGORITHMS IN BIO INFORMATICS A PRACTICAL INTRODUCTION WING-KIN SUNG CRC Press Taylor & Francis Group Boca Raton London New York CRC Press
More informationSupplementary Information
Supplementary Information Two new susceptibility loci for Kawasaki disease identified through genome-wide association analysis Yi-Ching Lee 1,2, Ho-Chang Kuo 3,4, Jeng-Sheng Chang,Luan-Yin Chang 6,1, Li-Min
More informationCURRICULUM VITAE. Editor-in-Chief, Maritime Business Review (Emerald Group Publishing)
CURRICULUM VITAE Professor Chin-Shan Lu ( 呂錦山 ), Ph.D. Address: Department of Logistics and Maritime Studies, Director, C.Y. Tung International Centre for Maritime Studies, The Hong Kong Polytechnic University,
More informationAdvanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018
Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party
More informationA. Positions and Honors
BIOGRAPHICAL SKETCH NAME in English Chao-Sung Lai NAME in Chinese 賴朝松 POSITION TITLE Professor, Department of Electronic Engineering EDUCATION/TRAINING INSTITUTION AND LOCATION DEGREE (if applicable) MM/YY
More information3. Department of Biomedical Engineering, Chung Yuan Christian University, Taiwan
Chun-Hsu Yao, Ph.D. Professor, Department of Biological Imaging and Radiological Science, School of Chinese Medicine, China Medical University, Taichung, Taiwan Tel:886-4-22053366 ext.7806;3325 e-mail:chyao@mail.cmu.edu.tw
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationThe 3 rd Asian Hygiene of Occupational Network Conference List of Poster Presentations
P1: Chemical Exposure and Control P101 Filtration characteristics of filtering facepieces Yu-Lin Tseng P102 Using silicone wristbands as a personal sampler to monitor the exposures of airborne terpenes
More informationBIOINFORMATICS THE MACHINE LEARNING APPROACH
88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and
More informationadvanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA
advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents
More informationSmart India Hackathon
TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential
More informationDate Time Venue Speaker Title Moderator. Division of Mathematics and Physical Sciences. Dr. Tse-Ming Chen (Nat'l Cheng Kung Univ.)
LECTURES Division of Mathematics and Physical Sciences Auditorium, 1F, Inst. of Physics Dr. Tse-Ming (Nat'l g Kung Univ.) What Quantum Point Contacts Can Do to Advance Spintronics Dr. Wei-Li Lee A108 Conference
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationUniversity of Michigan, Ann Arbor
Zing Tsung-Yeh Tsai is a bioinformatics research fellow in the University of Michigan, focusing on functional genomics, in particular interested in understanding gene regulation and evolutionary mechanism
More informationAUTO 2018 PROGRAM SCHEDULE
AUTO 2018 PROGRAM SCHEDULE Session Title: Artificial Intelligence Room:Chung Kang Room Time:09:00-10:20 Dec. 07, 2018 Prof. Feng-Chang Gu TP1-1 #1078 Low Cost Eye Tracking and Gaze Estimation Techniques
More informationBIOSTATISTICS AND MEDICAL INFORMATICS (B M I)
Biostatistics and Medical Informatics (B M I) 1 BIOSTATISTICS AND MEDICAL INFORMATICS (B M I) B M I/POP HLTH 451 INTRODUCTION TO SAS PROGRAMMING FOR 2 credits. Use of the SAS programming language for the
More informationOffice: No.1, Shih-Chuan 1st Road, Kaohsiung 807, Taiwan, ROC. Tel: ext.2677,
王志光教授 Chih-Kuang Wang, Ph.D. Office: No.1, Shih-Chuan 1st Road, Kaohsiung 807, Taiwan, ROC. Tel: +886-7-3121101 ext.2677, 2553 Email: ckwang@kmu.edu.tw Affiliation Division of Industry and University Cooperation,
More informationCSC 2427: Algorithms in Molecular Biology Lecture #14
CSC 2427: Algorithms in Molecular Biology Lecture #14 Lecturer: Michael Brudno Scribe Note: Hyonho Lee Department of Computer Science University of Toronto 03 March 2006 Microarrays Revisited In the last
More informationCURRICULUM VITAE. Editor-in-Chief, Maritime Business Review (Emerald Group Publishing)
CURRICULUM VITAE Professor Chin-Shan Lu ( 呂錦山 ), Ph.D. Address: Department of Logistics and Maritime Studies, Director, C.Y. Tung International Centre for Maritime Studies, The Hong Kong Polytechnic University,
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationWhere innovations are shaping a new era of intelligent healthcare
EXPO 11.29-12.02 TAIWAN Where innovations are shaping a new era of intelligent healthcare World-class medical centers and advanced medical specialties Most influential IT, ICT & Electronics industry in
More informationBIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationCory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.
Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range
More informationApplying IPA Model to Analyze Real Estate Marketing Strategy - Taking Green Building as an Example
Applying IPA Model to Analyze Real Estate Marketing Strategy - Taking Green Building as an Example SEAN TE-HSUN LIN, ANDREW YI-HUNG LIANG Department of Finance National Changhua University of Education
More informationOur website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
More informationThe Application of RFID in Emergency Medicine
The Fourth International Conference on Electronic Business (ICEB2004) / Beijing 1201 The Application of RFID in Emergency Medicine Tsai W.C. 1, Frank Kuo 2, Yuehching Lee 2, F. Wu 2 1 Institute of Health
More information6 B-P B-P B-P C-P C-P C-P C-P C-P B-P C-P C-P C-P-08 Yung-Lan Yeh
Poster Presentation 2 (Session B& C) Present Time and Duration: 13:00-14:30, October 19 Location: E-13 Lobby Poster dimensions :100 cm high x 80 cm wide.(maximum) Easychair No. ISNST2017 ID Authors Title
More informationRecommendations from the BCB Graduate Curriculum Committee 1
Recommendations from the BCB Graduate Curriculum Committee 1 Vasant Honavar, Volker Brendel, Karin Dorman, Scott Emrich, David Fernandez-Baca, and Steve Willson April 10, 2006 Background The current BCB
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not
More informationAUTO 2018 PROGRAM SCHEDULE
AUTO 2018 PROGRAM SCHEDULE Session Name: Artificial Intelligence Room:Chung Kang Room Time:09:00-10:20 Dec. 07, 2018 Prof. Feng-Chang Gu TP1-1 #1078 Low Cost Eye Tracking and Gaze Estimation Techniques
More informationGene Expression Data Analysis
Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based
More informationUsing Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart
Using Genomics to Guide Immunosuppression Therapy David A. Baran, MD, FACC, FSCAI System Director, Advanced HF, Transplant and MCS, Sentara Heart Hospital, Norfolk, VA Disclosure Consulting: Livanova,
More informationVALLIAMMAI ENGINEERING COLLEGE
VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationLAND SECTIE. Taiwan Visserijproducten. Van kracht sinds 02/09/2018 Datum van publicatie 28/09/2018. Lijst van kracht.
LAND SECTIE Taiwan Visseijpoducten Van kacht sinds 02/09/2018 Datum van publicatie 28/09/2018 00362 Lijst van kacht Ekenningsnumme Naam Stad Regio's Activiteiten Voetnoot Aanvaagdatum 2F30017 I-Mei Fozen
More informationGlobal Entrepreneurship and Innovation in Management (GEIM) Conference
2014 Global Entrepreneurship and Innovation in Management (GEIM) Conference in partnership with Journal of Business Research Special Issue, May 14-15, 2014, Taichung, Taiwan College of Management National
More informationIn silico prediction of novel therapeutic targets using gene disease association data
In silico prediction of novel therapeutic targets using gene disease association data, PhD, Associate GSK Fellow Scientific Leader, Computational Biology and Stats, Target Sciences GSK Big Data in Medicine
More informationThe Benefits Analysis of Environmental Management Investment in Taiwan s Industries
The Benefits Analysis of Environmental Management Investment in Taiwan s Industries 1 Shiaw-Wen Tien, 2 Yi-Chan Chung, 3 Chih-Hung Tsai, and 4 Wen-Chuan Su 1,4 Graduate School of Technology Management
More informationIntroduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the
Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics
More informationIntroduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
More informationInferring Cellular Networks Using Probabilis6c Graphical Models. Jianlin Cheng, PhD University of Missouri 2010
Inferring Cellular Networks Using Probabilis6c Graphical Models Jianlin Cheng, PhD University of Missouri 2010 Bayesian Network So@ware hap://www.cs.ubc.ca/~murphyk/so@ware/ BNT/bnso@.html Demo References
More informationMitigative Capacities of Plant Disposition Types and Space Types on. Urban Heat Island Effect. LU & Bo WANG b
Mitigative Capacities of Plant Disposition Types and Space Types on Urban Heat Island Effect Ying-ying LIUa & Yu-chen GUO & Xiang-dong XIAO & Sai WANG & Xiao-ping LU & Bo WANG b Department of horticulture,
More informationSuberoylanilide Hydroxamic Acid Treatment Reveals. Crosstalks among Proteome, Ubiquitylome and Acetylome
Suberoylanilide Hydroxamic Acid Treatment Reveals Crosstalks among Proteome, Ubiquitylome and Acetylome in Non-Small Cell Lung Cancer A549 Cell Line Quan Wu 1, Zhongyi Cheng 2, Jun Zhu 3, Weiqing Xu 1,
More information李志偉著作目錄 ( ) SCI/EI 期刊論文
SCI/EI 期刊論文 李志偉著作目錄 (2009-2014) 1. Yueh-Chien Lee, Sheng-Yao Hu, Walter Water, Kwong-Kau Tiong, Zhe-Chuan Feng, Yen-Ting Chen, Jen-Ching Huang, Jyh-Wei Lee, Chia-Chih Huang, Jyi-Lai Shen, Mou-Hong Cheng,
More informationBioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University
Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH
More informationBiomedical Big Data and Precision Medicine
Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015 1 Explosion of Biomedical Data 2 Types
More informationNational Pingtung University of Science and Technology
Department :Department of Environmental Science and Engineering Program Grade : 1 Class : A Freshman English(1) R 2 2 7 8 English Listening & Speaking R 1 2 5 6 Practice 101 Courses of General Education
More informationKnowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
More informationNetwork System Inference
Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What
More information7, No. 1, Vol. face of uncertainty. condition. 1. Evaluation of. rainfalls. reclamation. 4. A case record. areas
Journal of GeoEngineering Paper List (2012-2008) 7, No. 3, 2012 1. Reliability-based robust and optimal design of shallow foundations in cohesionless soil in the face of uncertainty Hsein Juang, Lei Wang,
More informationChristoph Bock ICPerMed First Research Workshop Milano, 26 June 2017
New Tools for Personalized Medicine *Tools = Assays, Devices, Software Christoph Bock ICPerMed First Research Workshop Milano, 26 June 2017 http://epigenomics.cemm.oeaw.ac.at http://biomedical-sequencing.at
More informationBioinformatics. Lecturer: Antinisca Di Marco Tutor: Francesco Gallo
Bioinformatics Lecturer: Antinisca Di Marco Tutor: Francesco Gallo E mails: nome.cognome@univaq.it For appointment Di Marco: Tuersday 3.30 4:30 p.m. Friday 10:00-11:00 a.m. please ask appointment via email
More informationICSA 2013 EXECUTIVES AND MEMBERS OF THE COMMITTEES
ICSA 2013 EXECUTIVES AND MEMBERS OF THE COMMITTEES EXECUTIVES President: Ming-Hui Chen (2013) Past President: Ivan S.F. Chan (2013), President-elect: Ying Lu (2013), Executive Director: Shu-Yen Ho (2011-2013),
More information1. The Subject and Aims of Research Silicon nanowires-based solar cells: Si-based solar cells Pyramid Silicon nanowire (SiNW) SiNW/pyramid
Optoelectronics and Semiconductor Group Professor Bohr-Ran Huang Ph.D., Michigan State University, U.S.A. Field of study: nanomaterials and devices, optoelectronic thin films devices, biophotonics and
More informationTREE CODE PRODUCT BROCHURE
TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for
More informationStatistical Methods for Network Analysis of Biological Data
The Protein Interaction Workshop, 8 12 June 2015, IMS Statistical Methods for Network Analysis of Biological Data Minghua Deng, dengmh@pku.edu.cn School of Mathematical Sciences Center for Quantitative
More informationPredictive and Causal Modeling in the Health Sciences. Sisi Ma MS, MS, PhD. New York University, Center for Health Informatics and Bioinformatics
Predictive and Causal Modeling in the Health Sciences Sisi Ma MS, MS, PhD. New York University, Center for Health Informatics and Bioinformatics 1 Exponentially Rapid Data Accumulation Protein Sequencing
More informationResults of Applications for the 2013 Integrated Thematic Projects at Academia Sinica Announced
Results of Applications for the 2013 Integrated Thematic Projects at Academia Announced There is a total of 34 applications for the 2013 Thematic Projects (11 from Division of Mathematics and Physical
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 8 th 2016 Info and documentation http://tbb.bio.uu.nl/bda/ http://www.google.com/
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More information