Biotool DNA library prep kit V2 for Illumina

Transcription

1 Biotool DNA library prep kit V2 for Illumina Description Biotool DNA library prep kit V2 for Illumina is developed specially for the Illumina high-throughput sequencing platform, and generates sequencing-ready DNA libraries. Compared to traditional library construction method, Biotool DNA library prep kit provides a single step transposase reaction in which DNA is simultaneously fragmented, end-repaired and tagged with sequencing adapters. This advanced method reduces the input amount of DNA and shortens the library construction time. The kit provides three sizes as 50 ng, 5 ng, and 1 ng of input DNA amount for your choice according to experimental types. All the reagents included in this kit have been under strict quality control and function validation, guaranteeing the consistency and repeatability of DNA library construction. Components Contents Size Input DNA TTE Mix V5 TTE Mix V1 5 TS Control DNA Cat#:B25201/ Cat#:B25202 Cat#:B25301/ Cat#:B25302 Cat#:B25401/ Cat#:B ng 5 ng 1 ng /96 μl 10/ / /96 μl 10/ / /96 μl 10/ Magnetic Separator PCR thermo cycler Biotool Index Kit V2 for Illumina (B25501) Biotool Dual Index Sequencing Primer Box for Illumina (B25601 or B25602) or TrueSeq Dual Index Sequencing Primer Box (Illumina #FC or #PE ) Application DNA library construction specially for Illumina high-throughput sequencing plantform. Note: The size of DNA sample as PCR product should be more than 500bp. The transposase can not react at DNA terminal, therefore the sequencing coverage of the last 50bp at the end of PCR product will decreases. It is recommended to elongate bp at each end of your PCR product to avoid the decrease of sequencing coverage. Basic Principle of Biotool DNA library prep kit V2 for Illumina Tagment Enzyme Mix Adapter 1 *TTE = Biotool Tagment Enzyme; TTBL = Biotool Tagment Buffer L; TS= Terminate Solution; = PCR Primer Mix; = Biotool Amplify Enzyme; TAB = Biotool Amplify Buffer. *Control DNA, Mouse Genomic DNA, 50 ng/μl. Tagmentation of input DNA Storage B25201/B25202, store all components at 20 C. Expire after one year. B25301/B25302, B25401/B25402, store 5X TS buffer at room temperature and other components at 20 C. Expire after one year. Adapter 2 Strand Displacement and Limited-Cycle PCR P5 N5 Index 1 (i7) N7 P7 Index 2 (i5) Size-Selection and Purification Other Materials Needed Absolute ethyl alcohol Sterile ultrapure water Low absorbance EP tube and PCR tube AMPure XP Beads (Beckman Coulter, Inc. #A63881) i5 index Read Sequencing Strategy Read 1 i7 index Read Read 2 A dapter 1 and Adapter 2, two oligos embedded in Biotool Tagment Enzyme P5 and P7, two universal PCR Primers N5 and N7, two index primers containing index 2 (i5) and index 1 (i7) respectively

2 Tagment Enzyme Mix (TTE Mix) contains transposase and equal molar mass of Adapter1 and Adapter2. Mix TTE and DNA, and incubate for 10 minutes at 55 C, and DNA fragmentation and end adapter ligation will be accomplished after this single step. Then these fragmented product will be amplified with two pairs of primers N5(N5xx)/N7(N7xx) and P5/P7 (PCR Primer Mix, ), and these PCR product will be selected by size and purified, which become the accomplished DNA library ready for sequencing. To 50 μl 50 ng DNA Flow chart B252xx (50 ng DNA Input) B253xx/B254xx (5 ng/1 ng DNA Input) Fragmentation 1. DNA fragmentation (According to different Cat. number) 1-A: For 50 ng DNA Input (B25201/25202) use. Fragmentation To 50 μl 50 ng DNA 5 ng / 1 ng DNA TTE Mix V5 / V1 Incubate for 10 min at AMPure XP Beads Purification Incubate for 10 min at Add 5 TS to terminate reaction PCR Enrichment PCR Enrichment Purified Product 2 Fragmented Product 2 N5XX N5XX N7XX N7XX AMPure XP Beads Purification Size Selection AMPure XP Beads Purification Size Selection Protocol Starting Material: Purified DNA, dissolved in sterile ultrapure water. DNA concentration determination The TTE Mix is extremely sensitive to DNA concentration, thus DNA concentration is of great concern in this experiment and should be determined precisely. It is recommended that DNA concentration be determined by Qubit or fluorescent dye PicoGreen. Do not apply the data from any detection method based on absorption spectrophotometry. e. Purify fragmented product by AMPure XP Beads: 1. Vortex the AMPure XP beads, and abstract 50 µl and add into 50 µl fragmented product in a EP tube, pipette gently for 10 times. Incubate for 5 min at room temperature. 2. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and discard the supernatant carefully. 3. Keep the EP tube attached to the magnetic separator, add 200 µl freshly made 80% ethanol to wash the beads. Incubate for 30 sec at room temperature and discard the supernatant carefully. 4. Repeat step 3, washing for 2 times in total. 5. Keep the EP tube attached to the magnetic separator, open the lid and dry for 10 min in the air. 6. Take the EP tube off the magnetic separator, add 26 µl sterile ultrapure water to elute. Vortex or pipette gently to mix. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and remove the 24 µl supernatant carefully to a new sterile PCR tube. Fragmented PCR products can be purified by other magnetic beads or column kit. f.proceed immediately to step 2. PCR enrichment. 1-B: For 5 ng DNA Input (B25301/25302) use. Confirm that 5x TS buffer is at room temperature and confirm there is no precipitation by flicking the tube wall. If there is precipitation, heat the buffer at 37 C and vortex violently, and the precipitation will resolve. Demand for DNA Purity OD 260 nm / OD 280nm = 1.8 ~ ng DNA TTE Mix V5

3 e. Add 5µL 5x TS to the product immediately, pipette gently to mix well. Incubate for 5 min at room temperature. f. Proceed immediately to step 2. PCR enrichment. 1-c. For 1 ng DNA Input (B25401/25402) use. Confirm that 5x TS buffer is at room temperature and confirm there is no precipitation by flicking the tube wall. If there is precipitation, heat the buffer at 37 C and vortex violently, and the precipitation will resolve. 1 ng DNA TTE Mix V1 e. Add 5µL 5x TS to the product immediately, pipette gently to mix well. Incubate for 5 min at room temperature. f. Proceed immediately to step 2. PCR enrichment. 2. PCR enrichment a. Put the sterile PCR tube on the ice bath, and add the following components successively: Cat#:B25201/ Cat#:B Contents Cat#:B25301/Cat#:B25302 Cat#:B25401/Cat#:B25402 step N5XX* N7XX* Biotool Index Kit V2 for Illumina (B25501) provides 8 N5xx and 12 N7xx primers, choose according to sample number and Index choice strategy. b. Pipette and mix well, put the PCR tube in the PCR thermo cycler, react as following: 72 C* 98 C 5-15 cycles* 72 C 4 C 98 C 60 C 72 C 3 min 30 sec 15 sec 30 sec 3 min 5 min *72 C incubation step is for chain substitution reaction, please do not delete this step. *Amplification cycle numbers should be decided according to specific situation and the common rules are as following: Input DNA amount is 50 ng (B25201/25202): recommended 5-9 cycles Input DNA amount is 5 ng (B25301/25302): recommended 8-12 cycles Input DNA amount is 1 ng (B25401/25402): recommended cycles Note: The less the cycle numbers, the less the amplification duplication situation, but the library production will also decrease. The appendix gives the information of the total amount of library from amplification product of different cycles after being selected by magnetic beads. c. After PCR reaction proceed to step 3. Size Selection and Purification of Amplified product. 3. Size Selection and Purification of Amplified product. It is recommended to use AMP XP beads in size selection and purification. The initiation volume of PCR product should be 50µL. The volume will decrease due to volatilization during PCR reaction, and the total volume should be supplemented to 50µL by sterile ultrapure water, or the selected size will be inconsistent with prediction. During selection, the volume of magnetic beads to be used in round1 and round2 (R1 and R2) are as following: Average total size of library ~ 350 bp ~ 450 bp Average insertion size of library ~ 230 bp ~ 330 bp ~ 430 bp Distribution of total size of library 250 bp bp 300 bp bp 400 bp bp ~ 550 bp Volume of magnetic beads in round1 R1 = 35.0 μl (0.70 ) R1 = 30.0 μl (0.60 ) R1 = 25.0 μl (0.50 ) Volume of magnetic beads in round1 R2 = 7. (0.15 ) R2 = 7. (0.15 ) R2 = 7. (0.15 ) "X" is calculated by PCR product volume, for example, "0.6X" stands for 0.6 X 50 µl = 30.0 µl 1. Vortex and mix well the AMP XP beads, abstract volume R1 and add to 50µL PCR product. Pipette gently for 10 times and incubate for 5 min at room temperature. 2. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and remove the supernatant carefully to a new EP tube, discard the magnetic beads. 3. Vortex and mix well the AMP XP beads, abstract volume R2 and add to the supernatant. Pipette gently for 10 times and incubate for 5 min at room temperature. 4. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and discard the supernatant carefully. 5. Keep the EP tube attached to the magnetic separator, add 200 µl freshly made 80% ethanol to wash the beads. Incubate for 30 sec at room temperature and discard the supernatant carefully. 6. Repeat step 5, washing for 2 times in total. 7. Keep the EP tube attached to the magnetic separator, open the lid and dry for 10 min in the air.

4 8. Take the EP tube off the magnetic separator, add 22 µl sterile ultrapure water to elute. Vortex or pipette gently to mix. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and remove the 20 µl supernatant carefully to a new sterile EP tube. Store at 20 C. And for library with more concentrated size distribution, the amplified product could be selected and purified by gel purification kit. If there is no specific demand for library's size distribution, the selection step could be neglected and the amplification product could be directly purified by magnetic beads or column kit. 4. Library quality control Library concentration determination For high quality sequencing result, the library concentration should be determined precisely. It is recommended to use Realtime PCR to acquire absolute quantification of library concentration. And library concentration could be determined based on fluorescent dye method which specifically identify double strands DNA (like Qubit or PicoGreen ). Do not apply the data from any detection method based on absorption spectrophotometry. It is recommended to use the similar equation as following to calculate library's molar concentration: Average size of library Similar transform equation 350 bp 1 ng/μl = 4.3 nm 450 bp 1 ng/μl = 3.3 nm 550 bp 1 ng/μl = 2.7 nm Library Structure Biotool DNA Library Prep Kit V2 for Illumina Library Structure Index 2 (i5) 5 -AATGATACGGCGACCACCGAGATCTACAC IIIIIIIITCGTCGGCAGCGTCAGATGTGTATAAGAG ACAG-NNN NNN-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC IIIIIIIIATCTCGTATGCCGTC Index 1 (i7) TTCTGCTTG-3 IIIIIIII: Index 2 (i5), 8 bases IIIIIIII: Index 1 (i7), 8 bases -NNNNNN-: Insertion Sequence About Sequencing Library dilution and Pool Refer to Illumina Guide of "Preparing DNA for MiSeq" for Miseq platform. Refer to Illumina HiSeq System User Guide for HiSeq platform. Fill in Sample Information Table Refer to "MiSeq Sample Sheet Quick Reference guide" for Miseq platform Refer to "HiSeq 2500 System User Guide" for Hiseq platform Sequencing Primers Biotool DNA library need to work with Biotool specific sequencing primers kit for sequencing on Illumina platform. The following products could be ordered from Biotool: Single Read Biotool Dual Index Sequencing Primer Box for Illumina, B25601 IX2: Index 2 (i5) Sequencing Primer Library Size Distribution Detection R1: Read 1 Sequencing Primer Detect the size distribution of prepared DNA library on Agilent 2100 Bioanalyzer. Paired End IX1: Index 1 (i7) Sequencing Primer Biotool Dual Index Sequencing Primer Box for Illumina, B25602 R1: Read 1 Sequencing Primer R2: Read 2 Sequencing Primer IX1: Index 1 (i7) Sequencing Primer In sequencing, use R1 for Read1, use R2 for Read2, and use IX1 for Index 1 (i7); for single read sequencing, use IX2 for Index 2 (i5); for Paired End sequencing, use RMX in TruSeq PE Cluster Kit for Index 2 (i5). You can also order from Illumina Single Read TruSeq Dual Index Sequencing Primer Box, Single Read, Illumina #FC HP9, Index 2 (i5) SR Sequencing Primer Mix HP10, Read 1 Sequencing Primer Mix HP12, Index 1 (i7) Sequencing Primer Mix Paired End TruSeq Dual Index Sequencing Primer Box, Paired End, Illumina #PE HP10, Read 1 Sequencing Primer Mix Human genomic DNA library constructed by Biotool DNA Library Prep Kit V2 for HP11, Read 2 Sequencing Primer Mix Illumina (B25201, 9 PCR ). Red line: PCR product without size HP12, Index 1 (i7) Sequencing Primer Mix selection, purified directly by 1x magnetic beads. Purple line: ~ 350 bp library selected by When sequencing, use HP10 for Read1, use HP11 for Read2 and use HP12 for INdex 1 (i7); for single read sequencing, use HP9 for Index 2 (i5); for Paired End sequencing, use RMX intruseq PE Cluster Kit for Index 2 (i5). magnetic beads; Green line: ~ 450 bp library selected by magnetic beads; Yellow line: ~ 550 bp library selected by magnetic beads.

5 Notices A. Notices for magnetic beads manipulation" Use magnetic beads after it reaches room temperature Abstract magnetic beads solution after thorough mix Mix thoroughly after DNA adding to magnetic beads All manipulation of magnetic beads should be at room temperature Supernatant removal should be careful and be after full attachment of magnetic beads to the separator 80% ethanol should be made freshly and discarded after usage Remove liquid as clean as possible during washing magnetic beads by 80% ethanol Fully dry the magnetic beads before elution, avoid ethanol remaining to interrupt following experiment B. Avoid cross contamination between samples Change pipette tips for different samples Use pipette tips with a filter core C. Stock the reagents in the kit in small packages To avoid activity decrease due to frequent freeze-and-thaw and long-term usage, it is recommended to split reagents to small packages and freeze after first usage. D. Avoid PCR product contamination Faulty operation of PCR product easily leads to contamination which will disturb the accuracy and reliability of experimental results. It is recommended to set physical separation between PCR reaction application area and PCR purification area, use specific transferpettor, and clean experiment area regularly (wipe with 0.5% sodium hypochlorite or 10% bleacher). Appendix Library product reference for Biotool DNA Library Prep Kit V2 for Illumina: B25201/25202 (50 ng DNA Input) B25301/25302(5 ng DNA Input) B25401/25402 (1 ng DNA Input) Library Product (without size selection, ng): Library Product (with size selection, ng): Note: The "ng" numbers in the table stand for library total mass. Library mass concentration could be calculated by this number divided by library final volume. Library molar concentration could be calculated by library mass concentration based on library average size.