Biotool DNA library prep kit V2 for Illumina
|
|
- Blaise Grant
- 5 years ago
- Views:
Transcription
1 Biotool DNA library prep kit V2 for Illumina Description Biotool DNA library prep kit V2 for Illumina is developed specially for the Illumina high-throughput sequencing platform, and generates sequencing-ready DNA libraries. Compared to traditional library construction method, Biotool DNA library prep kit provides a single step transposase reaction in which DNA is simultaneously fragmented, end-repaired and tagged with sequencing adapters. This advanced method reduces the input amount of DNA and shortens the library construction time. The kit provides three sizes as 50 ng, 5 ng, and 1 ng of input DNA amount for your choice according to experimental types. All the reagents included in this kit have been under strict quality control and function validation, guaranteeing the consistency and repeatability of DNA library construction. Components Contents Size Input DNA TTE Mix V5 TTE Mix V1 5 TS Control DNA Cat#:B25201/ Cat#:B25202 Cat#:B25301/ Cat#:B25302 Cat#:B25401/ Cat#:B ng 5 ng 1 ng /96 μl 10/ / /96 μl 10/ / /96 μl 10/ Magnetic Separator PCR thermo cycler Biotool Index Kit V2 for Illumina (B25501) Biotool Dual Index Sequencing Primer Box for Illumina (B25601 or B25602) or TrueSeq Dual Index Sequencing Primer Box (Illumina #FC or #PE ) Application DNA library construction specially for Illumina high-throughput sequencing plantform. Note: The size of DNA sample as PCR product should be more than 500bp. The transposase can not react at DNA terminal, therefore the sequencing coverage of the last 50bp at the end of PCR product will decreases. It is recommended to elongate bp at each end of your PCR product to avoid the decrease of sequencing coverage. Basic Principle of Biotool DNA library prep kit V2 for Illumina Tagment Enzyme Mix Adapter 1 *TTE = Biotool Tagment Enzyme; TTBL = Biotool Tagment Buffer L; TS= Terminate Solution; = PCR Primer Mix; = Biotool Amplify Enzyme; TAB = Biotool Amplify Buffer. *Control DNA, Mouse Genomic DNA, 50 ng/μl. Tagmentation of input DNA Storage B25201/B25202, store all components at 20 C. Expire after one year. B25301/B25302, B25401/B25402, store 5X TS buffer at room temperature and other components at 20 C. Expire after one year. Adapter 2 Strand Displacement and Limited-Cycle PCR P5 N5 Index 1 (i7) N7 P7 Index 2 (i5) Size-Selection and Purification Other Materials Needed Absolute ethyl alcohol Sterile ultrapure water Low absorbance EP tube and PCR tube AMPure XP Beads (Beckman Coulter, Inc. #A63881) i5 index Read Sequencing Strategy Read 1 i7 index Read Read 2 A dapter 1 and Adapter 2, two oligos embedded in Biotool Tagment Enzyme P5 and P7, two universal PCR Primers N5 and N7, two index primers containing index 2 (i5) and index 1 (i7) respectively
2 Tagment Enzyme Mix (TTE Mix) contains transposase and equal molar mass of Adapter1 and Adapter2. Mix TTE and DNA, and incubate for 10 minutes at 55 C, and DNA fragmentation and end adapter ligation will be accomplished after this single step. Then these fragmented product will be amplified with two pairs of primers N5(N5xx)/N7(N7xx) and P5/P7 (PCR Primer Mix, ), and these PCR product will be selected by size and purified, which become the accomplished DNA library ready for sequencing. To 50 μl 50 ng DNA Flow chart B252xx (50 ng DNA Input) B253xx/B254xx (5 ng/1 ng DNA Input) Fragmentation 1. DNA fragmentation (According to different Cat. number) 1-A: For 50 ng DNA Input (B25201/25202) use. Fragmentation To 50 μl 50 ng DNA 5 ng / 1 ng DNA TTE Mix V5 / V1 Incubate for 10 min at AMPure XP Beads Purification Incubate for 10 min at Add 5 TS to terminate reaction PCR Enrichment PCR Enrichment Purified Product 2 Fragmented Product 2 N5XX N5XX N7XX N7XX AMPure XP Beads Purification Size Selection AMPure XP Beads Purification Size Selection Protocol Starting Material: Purified DNA, dissolved in sterile ultrapure water. DNA concentration determination The TTE Mix is extremely sensitive to DNA concentration, thus DNA concentration is of great concern in this experiment and should be determined precisely. It is recommended that DNA concentration be determined by Qubit or fluorescent dye PicoGreen. Do not apply the data from any detection method based on absorption spectrophotometry. e. Purify fragmented product by AMPure XP Beads: 1. Vortex the AMPure XP beads, and abstract 50 µl and add into 50 µl fragmented product in a EP tube, pipette gently for 10 times. Incubate for 5 min at room temperature. 2. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and discard the supernatant carefully. 3. Keep the EP tube attached to the magnetic separator, add 200 µl freshly made 80% ethanol to wash the beads. Incubate for 30 sec at room temperature and discard the supernatant carefully. 4. Repeat step 3, washing for 2 times in total. 5. Keep the EP tube attached to the magnetic separator, open the lid and dry for 10 min in the air. 6. Take the EP tube off the magnetic separator, add 26 µl sterile ultrapure water to elute. Vortex or pipette gently to mix. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and remove the 24 µl supernatant carefully to a new sterile PCR tube. Fragmented PCR products can be purified by other magnetic beads or column kit. f.proceed immediately to step 2. PCR enrichment. 1-B: For 5 ng DNA Input (B25301/25302) use. Confirm that 5x TS buffer is at room temperature and confirm there is no precipitation by flicking the tube wall. If there is precipitation, heat the buffer at 37 C and vortex violently, and the precipitation will resolve. Demand for DNA Purity OD 260 nm / OD 280nm = 1.8 ~ ng DNA TTE Mix V5
3 e. Add 5µL 5x TS to the product immediately, pipette gently to mix well. Incubate for 5 min at room temperature. f. Proceed immediately to step 2. PCR enrichment. 1-c. For 1 ng DNA Input (B25401/25402) use. Confirm that 5x TS buffer is at room temperature and confirm there is no precipitation by flicking the tube wall. If there is precipitation, heat the buffer at 37 C and vortex violently, and the precipitation will resolve. 1 ng DNA TTE Mix V1 e. Add 5µL 5x TS to the product immediately, pipette gently to mix well. Incubate for 5 min at room temperature. f. Proceed immediately to step 2. PCR enrichment. 2. PCR enrichment a. Put the sterile PCR tube on the ice bath, and add the following components successively: Cat#:B25201/ Cat#:B Contents Cat#:B25301/Cat#:B25302 Cat#:B25401/Cat#:B25402 step N5XX* N7XX* Biotool Index Kit V2 for Illumina (B25501) provides 8 N5xx and 12 N7xx primers, choose according to sample number and Index choice strategy. b. Pipette and mix well, put the PCR tube in the PCR thermo cycler, react as following: 72 C* 98 C 5-15 cycles* 72 C 4 C 98 C 60 C 72 C 3 min 30 sec 15 sec 30 sec 3 min 5 min *72 C incubation step is for chain substitution reaction, please do not delete this step. *Amplification cycle numbers should be decided according to specific situation and the common rules are as following: Input DNA amount is 50 ng (B25201/25202): recommended 5-9 cycles Input DNA amount is 5 ng (B25301/25302): recommended 8-12 cycles Input DNA amount is 1 ng (B25401/25402): recommended cycles Note: The less the cycle numbers, the less the amplification duplication situation, but the library production will also decrease. The appendix gives the information of the total amount of library from amplification product of different cycles after being selected by magnetic beads. c. After PCR reaction proceed to step 3. Size Selection and Purification of Amplified product. 3. Size Selection and Purification of Amplified product. It is recommended to use AMP XP beads in size selection and purification. The initiation volume of PCR product should be 50µL. The volume will decrease due to volatilization during PCR reaction, and the total volume should be supplemented to 50µL by sterile ultrapure water, or the selected size will be inconsistent with prediction. During selection, the volume of magnetic beads to be used in round1 and round2 (R1 and R2) are as following: Average total size of library ~ 350 bp ~ 450 bp Average insertion size of library ~ 230 bp ~ 330 bp ~ 430 bp Distribution of total size of library 250 bp bp 300 bp bp 400 bp bp ~ 550 bp Volume of magnetic beads in round1 R1 = 35.0 μl (0.70 ) R1 = 30.0 μl (0.60 ) R1 = 25.0 μl (0.50 ) Volume of magnetic beads in round1 R2 = 7. (0.15 ) R2 = 7. (0.15 ) R2 = 7. (0.15 ) "X" is calculated by PCR product volume, for example, "0.6X" stands for 0.6 X 50 µl = 30.0 µl 1. Vortex and mix well the AMP XP beads, abstract volume R1 and add to 50µL PCR product. Pipette gently for 10 times and incubate for 5 min at room temperature. 2. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and remove the supernatant carefully to a new EP tube, discard the magnetic beads. 3. Vortex and mix well the AMP XP beads, abstract volume R2 and add to the supernatant. Pipette gently for 10 times and incubate for 5 min at room temperature. 4. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and discard the supernatant carefully. 5. Keep the EP tube attached to the magnetic separator, add 200 µl freshly made 80% ethanol to wash the beads. Incubate for 30 sec at room temperature and discard the supernatant carefully. 6. Repeat step 5, washing for 2 times in total. 7. Keep the EP tube attached to the magnetic separator, open the lid and dry for 10 min in the air.
4 8. Take the EP tube off the magnetic separator, add 22 µl sterile ultrapure water to elute. Vortex or pipette gently to mix. Shortly centrifuge the tube and put into magnetic separator to separate magnetic beads and solution. Wait for the solution to be clear (about 5 min) and remove the 20 µl supernatant carefully to a new sterile EP tube. Store at 20 C. And for library with more concentrated size distribution, the amplified product could be selected and purified by gel purification kit. If there is no specific demand for library's size distribution, the selection step could be neglected and the amplification product could be directly purified by magnetic beads or column kit. 4. Library quality control Library concentration determination For high quality sequencing result, the library concentration should be determined precisely. It is recommended to use Realtime PCR to acquire absolute quantification of library concentration. And library concentration could be determined based on fluorescent dye method which specifically identify double strands DNA (like Qubit or PicoGreen ). Do not apply the data from any detection method based on absorption spectrophotometry. It is recommended to use the similar equation as following to calculate library's molar concentration: Average size of library Similar transform equation 350 bp 1 ng/μl = 4.3 nm 450 bp 1 ng/μl = 3.3 nm 550 bp 1 ng/μl = 2.7 nm Library Structure Biotool DNA Library Prep Kit V2 for Illumina Library Structure Index 2 (i5) 5 -AATGATACGGCGACCACCGAGATCTACAC IIIIIIIITCGTCGGCAGCGTCAGATGTGTATAAGAG ACAG-NNN NNN-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC IIIIIIIIATCTCGTATGCCGTC Index 1 (i7) TTCTGCTTG-3 IIIIIIII: Index 2 (i5), 8 bases IIIIIIII: Index 1 (i7), 8 bases -NNNNNN-: Insertion Sequence About Sequencing Library dilution and Pool Refer to Illumina Guide of "Preparing DNA for MiSeq" for Miseq platform. Refer to Illumina HiSeq System User Guide for HiSeq platform. Fill in Sample Information Table Refer to "MiSeq Sample Sheet Quick Reference guide" for Miseq platform Refer to "HiSeq 2500 System User Guide" for Hiseq platform Sequencing Primers Biotool DNA library need to work with Biotool specific sequencing primers kit for sequencing on Illumina platform. The following products could be ordered from Biotool: Single Read Biotool Dual Index Sequencing Primer Box for Illumina, B25601 IX2: Index 2 (i5) Sequencing Primer Library Size Distribution Detection R1: Read 1 Sequencing Primer Detect the size distribution of prepared DNA library on Agilent 2100 Bioanalyzer. Paired End IX1: Index 1 (i7) Sequencing Primer Biotool Dual Index Sequencing Primer Box for Illumina, B25602 R1: Read 1 Sequencing Primer R2: Read 2 Sequencing Primer IX1: Index 1 (i7) Sequencing Primer In sequencing, use R1 for Read1, use R2 for Read2, and use IX1 for Index 1 (i7); for single read sequencing, use IX2 for Index 2 (i5); for Paired End sequencing, use RMX in TruSeq PE Cluster Kit for Index 2 (i5). You can also order from Illumina Single Read TruSeq Dual Index Sequencing Primer Box, Single Read, Illumina #FC HP9, Index 2 (i5) SR Sequencing Primer Mix HP10, Read 1 Sequencing Primer Mix HP12, Index 1 (i7) Sequencing Primer Mix Paired End TruSeq Dual Index Sequencing Primer Box, Paired End, Illumina #PE HP10, Read 1 Sequencing Primer Mix Human genomic DNA library constructed by Biotool DNA Library Prep Kit V2 for HP11, Read 2 Sequencing Primer Mix Illumina (B25201, 9 PCR ). Red line: PCR product without size HP12, Index 1 (i7) Sequencing Primer Mix selection, purified directly by 1x magnetic beads. Purple line: ~ 350 bp library selected by When sequencing, use HP10 for Read1, use HP11 for Read2 and use HP12 for INdex 1 (i7); for single read sequencing, use HP9 for Index 2 (i5); for Paired End sequencing, use RMX intruseq PE Cluster Kit for Index 2 (i5). magnetic beads; Green line: ~ 450 bp library selected by magnetic beads; Yellow line: ~ 550 bp library selected by magnetic beads.
5 Notices A. Notices for magnetic beads manipulation" Use magnetic beads after it reaches room temperature Abstract magnetic beads solution after thorough mix Mix thoroughly after DNA adding to magnetic beads All manipulation of magnetic beads should be at room temperature Supernatant removal should be careful and be after full attachment of magnetic beads to the separator 80% ethanol should be made freshly and discarded after usage Remove liquid as clean as possible during washing magnetic beads by 80% ethanol Fully dry the magnetic beads before elution, avoid ethanol remaining to interrupt following experiment B. Avoid cross contamination between samples Change pipette tips for different samples Use pipette tips with a filter core C. Stock the reagents in the kit in small packages To avoid activity decrease due to frequent freeze-and-thaw and long-term usage, it is recommended to split reagents to small packages and freeze after first usage. D. Avoid PCR product contamination Faulty operation of PCR product easily leads to contamination which will disturb the accuracy and reliability of experimental results. It is recommended to set physical separation between PCR reaction application area and PCR purification area, use specific transferpettor, and clean experiment area regularly (wipe with 0.5% sodium hypochlorite or 10% bleacher). Appendix Library product reference for Biotool DNA Library Prep Kit V2 for Illumina: B25201/25202 (50 ng DNA Input) B25301/25302(5 ng DNA Input) B25401/25402 (1 ng DNA Input) Library Product (without size selection, ng): Library Product (with size selection, ng): Note: The "ng" numbers in the table stand for library total mass. Library mass concentration could be calculated by this number divided by library final volume. Library molar concentration could be calculated by library mass concentration based on library average size.
Complete protocol in 110 minutes Enzymatic fragmentation without sonication One-step fragmentation/tagging to save time
Molecular Cloning Laboratories Manual Version 1.2 Product name: MCNext UT DNA Sample Prep Kit Cat #: MCUDS-4, MCUDS-24, MCUDS-96 Description: This protocol explains how to prepare up to 96 pooled indexed
More informationNEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V15.
NEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA-5143-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2015-2018 V15.07 This product is for research use only. Not for use in diagnostic procedures.
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More information5X WGS Fragmentation Mix
4.1. 5X WGS Fragmentation Mix Instructions for Use Product Number Y9410L and Y9410F Product Description The 5X WGS Fragmentation Mix is an enzyme mix to perform DNA fragmentation, end-repair and da-tailing
More informationSupplemental File 1: Modified Nextera XT DNA Sample Preparation Guide (Illumina, USA, Part # rev. C, October 2012).
Supplemental File 1: Modified Nextera XT DNA Sample Preparation Guide (Illumina, USA, Part # 15031942 rev. C, October 2012). Required Kit content: Box1 ATM Amplicon Tagment Mix TD Tagment DNA Buffer NPM
More informationThruPLEX -FD Prep Kit Instruction Manual. Single Tube Library Preparation for Illumina NGS Platforms
ThruPLEX -FD Prep Kit Instruction Manual Single Tube Library Preparation for Illumina NGS Platforms Contents Product Description... 2 Kit Contents... 2 Shipping and Storage... 2 Getting Started... 3 Input
More informationGENERAL INFORMATION...
BIOO LIFE SCIENCE PRODUCTS NEXTflex-96 TM DNA Barcodes (Illumina Compatible) Catalog #: 514106 BIOO Scientific Corp. 2012 V12.11 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents,
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationNEXTflex Cystic Fibrosis Amplicon Panel. (For Illumina Platforms) Catalog # (Kit contains 8 reactions) Bioo Scientific Corp V17.
NEXTflex Cystic Fibrosis Amplicon Panel (For Illumina Platforms) Catalog #4231-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2017 V17.02 This product is for research use only. Not for use in diagnostic
More informationFOR REFERENCE PURPOSES
FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit and protocol, so it is important
More informationNEXTFLEX 16S V4 Amplicon-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V18.
NEXTFLEX 16S V4 Amplicon-Seq Kit 2.0-4 (For Illumina Platforms) Catalog #NOVA-4203-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2018 V18.07 This product is for research use only. Not for use in
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationGENERAL INFORMATION...
BIOO LIFE SCIENCE PRODUCTS NEXTflex TM DNA Barcodes - 6 (Illumina Compatible) Catalog #: 514101 (48 reactions) BIOO Scientific Corp. 2012 V12.11 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview...
More informationBIOO LIFE SCIENCE PRODUCTS. NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) BIOO Scientific Corp V13.01
BIOO LIFE SCIENCE PRODUCTS NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) Catalog #: 4201-01 (16 reactions) BIOO Scientific Corp. 2013 V13.01 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product
More informationNEXTFLEX Rapid Directional RNA-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions)
NEXTFLEX Rapid Directional RNA-Seq Kit (For Illumina Platforms) Catalog #NOVA-5138-07 (Kit contains 8 reactions) Bioo Scientific Corp. 2014-2018 V18.07 This product is for research use only. Not for use
More informationsparq HiFi PCR Master Mix
sparq HiFi PCR Master Mix Cat. No. 95192-050 Size: 50 reactions Store at -25 C to -15 C 95192-250 250 reactions Description The sparq HiFi PCR Master Mix is a high efficiency, high-fidelity, and low bias
More information3.1 RNA Fragmentation, Priming and First Strand cdna Synthesis. 3.1A RNA Fragmentation and Priming Starting from Intact or Partially Degraded RNA:
CHAPTER 3 Please refer to revision history for a summary of protocol updates Symbols SAFE STOP This is a point where you can safely stop the protocol and store the samples prior to proceeding to the next
More informationFragment Library Preparation
Fragment Library Preparation 5500 Series SOLiD Systems QUICK REFERENCE Note: For safety and biohazard guidelines, refer to the Safety section in the Fragment Library Preparation: 5500 Series SOLiD Systems
More informationHashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification (Cell Reports).
CEL-Seq Protocol Hashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification. 2012 (Cell Reports). Reagents: LoBind tubes 0.5 ml Eppendorf 022431005 Ultra pure RNase
More informationProcedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
More informationThermo Scientific MuSeek Library Preparation Kit for Ion Torrent
PRODUCT INFORMATION Thermo Scientific MuSeek Library Preparation Kit for Ion Torrent Cat. no. 4480829 For 10 rxns Lot Exp. Store below -70 C before opening For barcoded DNA fragment library generation
More informationTailorMix Stranded mrna Sample Preparation Kit
TailorMix Stranded mrna Sample Preparation Kit Catalog Numbers: TM200-A and TM200-B Introduction The TailorMix Stranded mrna Sample Preparation Kit from SeqMatic is a comprehensive solution for generating
More informationUpdated August well High-multiplexing Tagmentation and Amplification Robyn Tanny August Company Kit Catalog Number.
96-well High-multiplexing Tagmentation and Amplification Robyn Tanny August 2015 This protocol uses the following purchased reagents: Company Kit Catalog Number Illumina Nextera DNA Sample Preparation
More informationNEBNext Direct Custom Ready Panels
LIBRARY PREPARATION NEBNext Direct Custom Ready Panels Instruction Manual NEB #E6631S/L/X 8/24/96 reactions Version 1.0 4/18 be INSPIRED drive DISCOVERY stay GENUINE i This product is intended for research
More informationJetSeq Flex DNA Library Preparation Kit. Product Manual
JetSeq Flex DNA Library Preparation Kit Product Manual 2 Product Manual bioline.com/jetseq JetSeq Flex DNA Library Preparation Kit JetSeq Flex DNA Library Preparation Kit TABLE OF CONTENTS 1 Kit contents
More informationTruSeq Rapid Exome Library Prep
Tagment Genomic DNA Clean Up Tagmented DNA Amplify Tagmented DNA Quantify gdna using a fluorometric method. Dilute gdna in Tris-HCl 10 mm, ph 8.5 to a final volume of 10 μl at 5 ng/μl. Add the following
More informationFor detailed instructions about the TruSeq Custom Amplicon library preparation methods, refer to your reference guide.
1 TruSeq Custom Amplicon Script Welcome Navigation Objectives Welcome to the TruSeq Custom Amplicon course. Click next to begin. Take a moment to familiarize yourself with the navigation for this course.
More informationFragment Library Preparation Using the AB Library Builder System
Fragment Library Preparation Using the AB Library Builder System 5500 Series SOLiD Systems QUICK REFERENCE Note: For safety and biohazard guidelines, refer to the Safety section in the Fragment Library
More informationTruSight DNA Amplicon Sequencing Panel
FOR RESEARCH USE ONLY Date: Illumina Kit Description: New or less experienced users are strongly advised to follow the protocol in the latest version of the Library Prep Kit Guide (part # 15054779) before
More informationGenome Reagent Kits v2 Quick Reference Cards
Chromium Genome Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Genome Library Kit & Gel Bead Kit v2, 16 rxns PN-120258 Chromium Genome Chip Kit v2, 48 rxns PN-120257 Chromium i7 Multiplex
More informationTruSeq ChIP Sample Preparation
FOR RESEARCH USE ONLY Date: Illumina Kit Description: NOTE Unless familiar with the protocol in the latest version of the TruSeq ChIP Sample Preparation Guide (part # 15023092), new or less experienced
More informationSingle Cell 3 Reagent Kits v2 Quick Reference Cards
Chromium Single Cell 3 Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Single Cell 3' Library & Gel Bead Kit v2, 16 rxns PN-120237 Chromium Single Cell 3' Library & Gel Bead Kit, 4 rxns PN-120267
More informationSingle Cell 3 Reagent Kits v2 Quick Reference Cards
Chromium Single Cell 3 Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Single Cell 3' Library & Gel Bead Kit v2 PN-120237 Chromium Single Cell 3 Chip Kit v2 PN-120236 Chromium i7 Multiplex
More informationEPIGENTEK. EpiNext DNA Library Preparation Kit (Illumina) Base Catalog # P-1051 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiNext DNA Library Preparation Kit (Illumina) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiNext DNA Library Preparation Kit (Illumina) is suitable for preparing a DNA library
More informationCleanup. Total Time 2.5 hr
sparq DNA Library Prep Kit Cat. No. 95191-024 Size: 24 reactions Store at -25 C to -15 C 95191-096 96 reactions Description The sparq DNA Library Prep Kit provides components for the rapid construction
More informationProcedure & Checklist - Preparing Asymmetric SMRTbell Templates
Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Before You Begin In this procedure, PCR products are generated using two rounds of amplification. The first round uses target specific primers
More informationsparq DNA Frag & Library Prep Kit
sparq DNA Frag & Library Prep Kit Cat. No. 95194-024 Size: 24 reactions Store at -25 C to -15 C 95194-096 96 reactions Description The sparq DNA Frag & Library Prep Kit provides reagents essential for
More informationNEBNext. Ultra II RNA Library Prep Kit for Illumina
LIBRARY PREPARATION NEBNext Ultra II RNA Library Prep Kit for Illumina Instruction Manual NEB #E7770S/L, #E7775S/L 24/96 reactions Version 1.0 4/17 be INSPIRED drive DISCOVERY stay GENUINE This product
More informationHybridization capture of DNA libraries using xgen Lockdown Probes and Reagents
Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents For use with: llumina TruSeq adapter ligated libraries xgen Universal Blockers TS Mix (Catalog # 1075474, 1075475, 1075476)
More informationUser-Demonstrated Protocol: BD Single-Cell Multiplexing Kit Human
User-Demonstrated Protocol: BD Single-Cell Multiplexing Kit For use with the 10x Chromium Single Cell 3 Reagent Kit v2 01/2018 Doc ID: 179682 Rev. 1.0 Contents Disclaimer on page 3 Overview on page 3 Workflow
More informationArcher ALK, RET, ROS1 Fusion Detection v1 Illumina Platform
Archer ALK, RET, ROS1 Fusion Detection v1 Illumina Platform P/N AK0001-8 Archer ALK, RET, ROS1 Fusion Detection v1 for Illumina Platform IFU-AK0001-8 Rev. A Table of Contents Product Description..3 Workflow
More informationTwist Human Core Exome EF Multiplex Complete Kit, 16 Samples PN
Twist Human Core Exome Enrichment Kit Twist Human Core Exome EF Multiplex Complete Kit, 16 Samples PN 100252 Reagents for preparing 16 exome-enriched libraries ready for sequencing from human genomic DNA
More informationHALOPLEX PCR TARGET ENRICHMENT & LIBRARY PREPARATION PROTOCOL. Version 1.0.3, April 2011 For research use only
HALOPLEX PCR TARGET ENRICHMENT & LIBRARY PREPARATION PROTOCOL Version 1.0.3, April 2011 For research use only HALOPLEX PCR TARGET ENRICHMENT & LIBRARY PREPARATION PROTOCOL Halo Genomics AB, 2011 No part
More informationHEAT-Seq and HEAT-Seq Ultra Target Enrichment User s Guide Version 1.1
HEAT-Seq and HEAT-Seq Ultra Target Enrichment User s Guide Version 1.1 For Research Use Only. Not for use in diagnostic procedures. Copyright 2016-2017 Roche Sequencing Solutions, Inc. All Rights Reserved.
More informationLibrary Loading Bead Kit (EXP-LLB001) Agencourt AMPure XP beads Vortex mixer. Freshly prepared 70% ethanol in nucleasefree
Before start checklist Materials Consumables Equipment PCR Barcoding Kit (EXP-PBC001) NEBNext End repair / da-tailing Module (E7546) Thermal cycler at 20 C and 65 C Ligation Sequencing Kit 1D (SQK-LSK108)
More informationNEXTflex Myeloid Amplicon Panel (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V17.
NEXTflex Myeloid Amplicon Panel (For Illumina Platforms) Catalog #NOVA-4260-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2017 V17.05 This product is for research use only. Not for use in diagnostic
More informationHyperCap, an automatable workflow on the Agilent Bravo B
Automation Note February 2018 HyperCap, an automatable workflow on the Agilent Bravo B 1. OVERVIEW As the demand for next-generation sequencing (NGS) grows, laboratories must adapt to manage increased
More informationCat. Nos. NT09115, NT091120, NT , NT , and NTBC0950 DISCONTINUED
Nextera DNA Sample Prep Kit (Roche Titanium-compatible) Cat. Nos. NT09115, NT091120, NT0911-50, NT0911-96, and NTBC0950 DISCONTINUED The Nextera DNA Sample Prep Kit is designed to prepare genomic DNA libraries
More informationAmplicon Library Preparation Method Manual. GS FLX Titanium Series October 2009
GS FLX Titanium Series 1. Workflow 3. Procedure The procedure to prepare Amplicon libraries is shown in Figure 1. It consists of a PCR amplification, performed using special Fusion Primers for the Genome
More informationEpiGnome Methyl-Seq Kit. EpiGnome Index PCR Primers
EGMK81312 12 Reactions EGMK91324-24 Reactions EGMK91396-96 Reactions EpiGnome Index PCR Primers EGIDX81312 12 Indexes Important! Epicentre s FailSafe PCR Enzyme (available separately; catalog number FSE51100)
More informationi5 Dual Indexing Add-on Kit for QuantSeq/SENSE ( ) Instruction Manual
i5 Dual Indexing Add-on Kit for QuantSeq/SENSE (5001-5004) Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina)
More informationMethods S1. Minimal Starting Amount Sample Preparation Protocol (MSA-Cap)
1 Methods S1 Minimal Starting Amount Sample Preparation Protocol (MSA-Cap) 1. Methods. 1.1. Fragmentation. Start from 50-60 ng DNA in 10-30 µl Elution buffer (EB) or TE buffer (10mM Tris, ph 7.5/ 1 mm
More informationab High Sensitivity DNA Library Preparation Kit (For Illumina )
ab185905 High Sensitivity DNA Library Preparation Kit (For Illumina ) Instructions for Use For the preparation of a DNA library using sub-nanogram amounts of DNA input for next generation sequencing applications
More informationab High Sensitivity DNA Library Preparation Kit (For Illumina )
ab185905 High Sensitivity DNA Library Preparation Kit (For Illumina ) Instructions for Use For the preparation of a DNA library using sub-nanogram amounts of DNA input for next generation sequencing applications
More informationNEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina
LIBRARY PREPARATION NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina Instruction Manual NEB #E6420S/L 24/96 reactions Version 1.0 4/18 be INSPIRED drive DISCOVERY stay GENUINE i This product
More informationKAPA Library Preparation Kits
Technical Data Sheet KAPA Library Preparation Kits Illumina series Product Description The KAPA Library Preparation Kit provides all of the enzymes and reaction buffers required for constructing libraries
More informationLibrary Loading Bead Kit (EXP-LLB001) Agencourt AMPure XP beads Vortex mixer. Freshly prepared 70% ethanol in nucleasefree
Before start checklist Materials Consumables Equipment Native Barcoding Kit 1D (EXP-NBD103) NEBNext End repair / da-tailing Module (E7546) Thermal cycler at 20 C and 65 C Ligation Sequencing Kit 1D ( NEB
More informationLibrary Loading Bead Kit (EXP-LLB001) NEBNext FFPE Repair Mix (M6630) Magnetic rack. NEBNext End repair / da-tailing Module (E7546)
Before start checklist Materials Consumables Equipment Low Input by PCR Barcoding Kit (SQK- LWB001) Agencourt AMPure XP beads Hula mixer (gentle rotator mixer) Library Loading Bead Kit (EXP-LLB001) NEBNext
More informationScriptSeq v2 RNA-Seq Library Preparation Kit*
726 Post Road I Madison, WI 53713 Phone: 800-284-8474 I 608-258-3080 Fax: 608-258-3088 ScriptSeq v2 RNA-Seq Library Preparation Kit* SSV21106 6 Reactions SSV21124 24 Reactions Note: To improve library
More informationNEBNext Fast DNA Fragmentation & Library Prep Set for Ion Torrent
LIBRARY PREPARATION NEBNext Fast DNA Fragmentation & Library Prep Set for Ion Torrent Instruction Manual NEB #E6285S/L 10/50 reactions Version 7.0 4/18 be INSPIRED drive DISCOVERY stay GENUINE This product
More informationScriptSeq Complete Kit*
ScriptSeq Complete Kit* (Bacteria) Low Input Cat. No. SCL6B 6 Reactions (Contains 1 box of Cat. No. LIB1206, 1 box of Cat. No. LIMC126 and 1 box of SSV21106) Cat. No. SCL24B 24 Reactions (Contains 1 box
More informationIon TrueMate Library Preparation
USER GUIDE Ion TrueMate Library Preparation for use with: Ion TrueMate Library Kit Ion TrueMate Plus Library Kit Catalog Numbers A25614 and A25656 Publication Number MAN0010280 Revision B.0 For Research
More informationEpiNext 5-mC RNA Bisulfite-Seq Easy Kit (Illumina)
EpiNext 5-mC RNA Bisulfite-Seq Easy Kit (Illumina) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiNext 5-mC RNA Bisulfite-Seq Easy Kit (Illumina) is designed for easily carrying
More informationIon AmpliSeq Library Kit 2.0
QUICK REFERENCE Ion AmpliSeq Library Kit 2.0 DNA Library Preparation with 1- or 2-Pool Panels Using qpcr Quantification Catalog Numbers 4475345, 4480441, 4480442, 4479790, A31133, A31136, A29751 Pub. No.
More informationCell Hashing Protocol
Cell Hashing Protocol For experiments involving Cell Hashing, use cost per cell calculator to plan experiments, determine number of hashes, number of cells to load, expected doublet rates (detected and
More information1D^2 Sequencing Kit (SQK-LSK308) Pipettes P2, P10, P20, P100, P200, P1000 Freshly prepared 70% ethanol in nucleasefree
Before start checklist Library Loading Bead Kit (EXP-LLB001) Heating block at 37 C capable of taking 1.5 ml tubes Agencourt AMPure XP beads 1D^2 Sequencing Kit (SQK-LSK308) Pipettes P2, P10, P20, P100,
More informationChIPmentation CeMM v1.14 (September 2016)
ChIPmentation CeMM v1.14 (September 2016) This protocol works well for efficient histone modification and transcription factor antibodies. For less efficient antibodies sonication different sonication-,
More informationProtein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide
Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide technology and the 10X Genomics Chromium Single Cell Gene Expression Solution Jocelyn G. Olvera, Brigid S. Boland, John T.
More informationPremium WGBS Kit. Whole Genome Bisulfite Sequencing. Cat. No. C (8 rxns) Version 1 I 07.15
Premium WGBS Kit Whole Genome Bisulfite Sequencing Cat. No. C02030034 (8 rxns) Version 1 I 07.15 Contacts diagenode headquarters Diagenode s.a. BELGIUM EUROPE LIEGE SCIENCE PARK Rue Bois Saint-Jean, 3
More informationi5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual
i5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina)
More informationPCR Barcoding Kit (SQK-PBK004) Agencourt AMPure XP beads Hula mixer (gentle rotator mixer) NEB Blunt/TA Ligase Master Mix (M0367)
Before start checklist Materials Consumables Equipment Agencourt AMPure XP beads Hula mixer (gentle rotator mixer) Flow Cell Priming Kit (EXP-FLP001) NEBNext End repair / da-tailing Module (E7546) NEB
More informationBD Single-Cell Multiplexing Kit Human Protocol
BD Single-Cell Multiplexing Kit Protocol For use with the BD Rhapsody system 11/2017 Doc ID: 54478 Rev. 1.0 Contents Overview on page 3 Sample Tag library preparation workflow on page 4 Reference for BD
More informationMultiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms
Multiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms Important Things to know before you start: This protocol generates strand-specific reads, but may lead to slightly
More informationNGS Library Construction Kit User Guide
NGS Library Construction Kit User Guide Catalog Number BX2000-08M REV. 1.0 11.21.16 Part number 40023 LEGAL NOTICES Technical Services Limited Use Label License Limited Warranty Trademark Information Regulatory
More informationThruPLEX Tag-seq Kit User Manual
ThruPLEX Tag-seq Kit User Manual Cat. Nos. R400584, R400585 & R400586 (022818) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United States/Canada 800.662.2566
More informationPreparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq)
Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Last updated: Oct 28, 2016 Overview First-strand cdna is synthesized using oligo-dt containing primers and an RNA oligo
More informationIon Total RNA-Seq Kit v2
Ion Total RNA-Seq Kit v2 USER GUIDE for use with: Ion PGM System Ion Proton System Ion S5 System Ion S5 XL System Catalog Numbers 4475936, 4479789, 4475485 Publication Number MAN0010654 Revision C.0 For
More informationGlobin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
More informationFunctional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq
Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste
More informationFFPE DNA Extraction Protocol
FFPE DNA Extraction Protocol Introduction The number of archival formalin-fixed paraffin embedded (FFPE) samples is in the millions, providing an invaluable repository of information for genetic analysis.
More informationNEBNext Ultra II DNA Library Prep Kit for Illumina
LIBRARY PREPARATION NEBNext Ultra II DNA Library Prep Kit for Illumina Instruction Manual NEB #E7645S/L, #E7103S/L 24/96 reactions Version 5.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product
More informationGBS v2. A Rieseberg Lab Production. (Pronounced jibs ) (Genotyping-By-Sequencing) Creators: Edd Buckler Lab. Refiner: Greg Baute
A Rieseberg Lab Production January 29, 2013 GBS v2 (Pronounced jibs ) (Genotyping-By-Sequencing) Creators: Edd Buckler Lab Refiner: Greg Baute Perfectors and Writers: Kristin Nurkowski & Gregory Owens
More informationWestburg NGS DNA Library Prep Kit
Manual Westburg NGS DNA Library Prep Kit WB 9024 WB 9096 Version 3.0 09/2018 Westburg NGS DNA Library Prep Kit Manual 1 CONTENTS Page Introduction 3 Compatibility 3 Outline of procedure 4 Kit Components
More informationIllumina Sequencing Sample Preparation for use with CRISPRi/a-v2 Libraries
Illumina Sequencing Sample Preparation for use with CRISPRi/a-v2 Libraries Overview This protocol describes the four steps required for generating sequencing samples from cells harvested from screens conducted
More informationScriptSeq Complete Gold Kit
ScriptSeq Complete Gold Kit (Epidemiology) Low Input Cat. No. SCL6EP 6 Reactions (Contains 1 box of Cat. No. LIE1206, 1 box of Cat. No. LIMC126 and 1 box of SSV21106) Cat. No. SCL24EP 24 Reactions (Contains
More informationCOFACTOR GENOMICS Cofactor ImmunoPrism Kit Version 1.0 THE LEADERS IN RNA. Cofactor ImmunoPrism Kit Version 1.0
THE LEADERS IN RNA Cofactor ImmunoPrism Kit Version 1.0 Table of Contents Introduction Procedure Protocol Notes Thermal Cycler Programs Optional Protocol Modifications Support Protocol Overview Kit Reagents
More informationFlow Cell Priming Kit (EXP-FLP001) NEBNext Quick Ligation Module (E6056) Vortex mixer. 0.2 ml thin-walled PCR tubes Timer
Before start checklist Materials Consumables Equipment
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationKAPA Library Preparation Kit with Real-time PCR Library Amplification for Illumina Platforms
KAPA Library Preparation Kit with Real-time PCR Library Amplification for Illumina Platforms KR0411 v5.16 This provides product information and a detailed protocol for the KAPA Library Preparation Kits
More information10 RXN 50 RXN 500 RXN
SeqPlex Enhanced DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQXE Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification
More informationCITE-seq & Cell Hashing Protocol
CITE-seq & Cell Hashing Protocol For experiments involving Cell Hashing, use cost per cell calculator to plan experiments, determine number of hashes, number of cells to load, expected doublet rates (detected
More informationLigation Sequencing Kit 1D (SQK-LSK108) Ice bucket with ice NEBNext End repair / da-tailing Module (E7546)
Before start checklist Ligation Sequencing Kit 1D (SQK-LSK108) Ice bucket with ice NEBNext End repair / da-tailing Module (E7546) Library Loading Bead Kit (EXP-LLB001) Timer NEB Blunt/TA Ligase Master
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationPuro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
More informationJetSeq DNA Library Preparation Kit. Product Manual
JetSeq DNA Library Preparation Kit Product Manual JetSeq DNA Library Preparation Kit JetSeq DNA Library Preparation Kit TABLE OF CONTENTS 1 Kit contents 04 2 Description 05 3 Storage 06 4 Safety information
More information