A Phase I Study to Evaluate the Safety, Tolerability, and Immunogenicity of a Clostridium difficile
|
|
- Cornelia Bryant
- 5 years ago
- Views:
Transcription
1 A Phase I Study to Evaluate the Safety, Tolerability, and Immunogenicity of a Clostridium difficile vaccine administered with or without Aluminum Hydroxide, in a 3-Dose Regimen in Healthy Adults Aged 50 to 85 Years Louise Pedneault, Eric Sheldon, Nicholas Kitchin, Yahong Peng, Joseph Eiden, William Gruber, Erik Johnson, Kathrin U. Jansen, Michael Pride 5 th ICDS, Bled Slovenia, 20 May 2015
2 Clostridium difficile-associated disease represents a significant unmet medical need Anaerobic spore-forming Grampositive bacillus Main cause of nosocomial infections 1 Increase in CDAD incidence and disease severity 2-5 C.difficile associated disease (CDAD) is directly attributable to production of Toxins A and B by C. difficile 6,7 No prophylactic vaccine is currently available for prevention of primary or recurrent CDAD Estimated US Burden of C.difficile Infection, CO-HCA = community onset health care-associated; NHO = nursing home onset; HO = hospital onset 1 Magill SS et al, NEJM 2014;370: ; 2 Gerding & Lessa, Infect Dis Clin N Am 2015;29:37-50; 3 Lessa FC et al, NEJM 2015;372:825-34; 4 Bauer et al, Lancet 2011;377:63-73; 5 Davies et al, Lancet Infect Dis 2014;14: ; 6 Giannasca et al (1999) Infect Immun; 7 Torres et al. (1995) Infect Immun Pfizer Confidential 2
3 Proof of Concept for a Toxoid Vaccine Toxin-based diseases like diphtheria, cholera and tetanus have been prevented by antitoxin antibodies or toxoid vaccines Clinical data indicate that antitoxin antibodies provide protection from CDAD: 72% reduction of CDAD recurrence Lowy I et al. N Engl J Med 2010;362: Pfizer Confidential 3
4 Pfizer s bivalent toxoid vaccine preserves important antigenic epitopes and neutralizes toxins from circulating clinical strains TOXIN STRUCTURE GENETIC TOXOID EXPRESSION PLASMID EXPRESSION IN C.difficile (Cytotoxic Function) RECIPIENT VPI SPO-A AND TOXIN MINUS Neutralization of B Toxins from C.difficile Strains Chemical Treatment of Genetically Modified Toxins Preserves Neutralizing Epitopes Sample EC 50 (ug/ml) Reduction in Cytotoxtoicity (log) Max Binding (Rmax) Neut mab Genetic txd A Formalin-txdA >1000 > Pfizer-txd A >1000 > Genetic txd B Formalin-txd B > Pfizer-txd B > Pfizer Confidential 4
5 Percent survival Bleed / Vax Bleed / Vax Bleed / Vax Clindamycin Bleed / Challenge (5,000 CFU Strain 630) Day 11/ Termination C. difficile Toxoid Vaccine Candidate Protects Hamsters (n=15/group) from C. difficile Challenge Post challenge W0 W2 W4 W5, 9, W6, 10, or 13 or 14 Challenge Post Last Vaccination Weeks 6 Weeks 10 Weeks Formulation Adjuvant 1 1 Formulation Adjuvant 2 2 Placebo (Matrix/NaCl) Days post-infection Formulation 1 = 93% (14/15) Formulation 2 = 93% (14/15) Days post-infection Formulation 1 = 93% (14/15) Formulation 2 = 80% (12/15) Days post-infection Formulation 1 = 100% (15/15) Formulation 2 = 80% (12/15) 5 Jansen K. 4 th International Clostridium difficile Symposium, 2012, Bled, Slovenia, Abstract O2
6 Phase 1 Study - Methods Design Phase 1, randomized, placebo-controlled, observer-blind Two age cohorts: yo and yo healthy adults Three doses administered on Day 1, Months 1 and 6 4 US sites Study Group* Formulation Subjects receiving Vaccine Placebo 1 50 mcg C. diff mcg C. diff mcg C. diff mcg C. diff mcg C. diff mcg C. diff * Six study groups replicated for each of the two age cohorts Pfizer Confidential 6
7 Phase 1 Study Methods Safety Evaluations Prompted e-diary events (both local reactions and systemic events that occurred in the 7 days after investigational product administration) Acute reactions within the first 30 minutes after investigational product administration Adverse events (AEs), serious AEs (SAEs) Hematologic and blood chemistry assessments Safety-driven stopping rules were in effect throughout the trial Unblinded safety data were reviewed by the internal Pfizer safety review team (PSRT) and external data monitoring committee (DMC) throughout the study Pfizer Confidential 7
8 Phase 1 Study Methods Immunogenicity Assessment Toxin A- and toxin B-specific neutralizing antibody levels measured at multiple time points Pfizer Confidential 8
9 Toxin Neutralization Assay (TNA): A Brief Overview R L U TOXIN REFERENCE STANDARD Neut U/mL R e f S td A (U /m L ) Automated and sensitive assay based on luminescence readout Neutralization titers of test samples are calculated based on Reference standard Assay LLOQ: Txd A = U/ml; Txd B = U/ml
10 Phase 1 Study Statistical Considerations All analyses descriptive Each age cohort analyzed separately Safety analysis population All subjects who received at least one dose of investigational product Primary immunogenicity population: Evaluable population All subjects who received the investigational product to which they were randomized, had blood drawn within specified time frames, had valid and determinate assay results for the proposed analysis, and no major protocol violations Immunogenicity endpoint Geometric mean concentrations (GMCs) of C. difficile toxin A- and toxin B-specific neutralizing antibody levels Pfizer Confidential 10
11 Baseline characteristics year olds Placebo Randomized, n Received dose 1, n Received dose 2, n Received dose 3, n Total Age in years, mean Sex, n Female Male Pfizer Confidential 11
12 Baseline characteristics year olds Placebo Randomized, n Received dose 1, n Received dose 2, n Received dose 3, n Total Age in years, mean Sex, n Female Male Pfizer Confidential 12
13 Any local reaction 1 within 7 days yrs 100% 80% 60% 40% 20% 0% Placebo N=22 + N= Placebo N= N=11 + Placebo N=11 N=20 N=8 + N=11 N=11 + N=10 + N=8 Dose 1 Dose 2 Dose 3 Mild Moderate Severe 1 Injection site pain, swelling, redness Pfizer Confidential 13
14 Any local reaction 1 within 7 days yrs 100% 80% 60% 40% * 20% 0% Placebo N= Placebo N=21 + N= Placebo N=11 N=17 N=10 + N=9 N=8 + N=11 N=10 + N=9 Dose 1 Dose 2 Dose 3 Mild Moderate Severe * One subject reported severe redness and swelling on Day 2 after Dose 2 this was an e-diary entry error (the true diameters were mild). 1 Injection site pain, swelling, redness Pfizer Confidential 14
15 Any systemic event 1 within 7 days yrs 100% 80% 60% 40% 20% ** * 0% Placebo N=22 + N= Placebo N= N=11 + Placebo N=11 N=20 N=8 + N=11 N=11 + N=10 + N=8 Dose 1 Dose 2 Dose 3 Mild Moderate Severe * One subject reported severe fever on Days 2&3 after Dose 1 this was an e-diary entry error (the subject actually had no reactions). ** One subject reported severe fever (39.2ºC) and headache (as well as moderate diarrhea and joint pain) on Day 2 after Dose 1; both headache and diarrhea were mild on Day 3 and then resolved. One subject reported severe fever (up to 39.3ºC) on Days 1&2 after Dose 2, accompanied by moderate headache and muscle pain. 1 Vomiting, diarrhea, headache, fatigue, new or worsening muscle or joint pain Pfizer Confidential 15
16 Any systemic event 1 within 7 days yrs 100% 80% 60% 40% 20% * ** 0% Placebo N= Placebo N=21 + N= Placebo N=11 N=17 N=10 + N=9 N=8 + N=11 N=10 + N=9 Dose 1 Dose 2 Dose 3 Mild Moderate Severe Grade 4 * One subject reported Grade 4 fever (41.1ºC) on Day 4 after Dose 1 this was an e-diary entry error (the subject actually had no fever or other reactions on that day). ** One subject reported severe joint pain on Day 4 after Dose 2. The investigator confirmed that this reaction was not vaccine related, but that the subject had broken his finger a month earlier and developed a soft tissue infection secondary to a local laceration. 1 Vomiting, diarrhea, headache, fatigue, new or worsening muscle or joint pain Pfizer Confidential 16
17 Any adverse event up to 28 days post-dose 3 100% 80% 60% 40% 20% yrs 0% Placebo N=22 + N= yrs 100% 80% 60% 40% 20% 0% Placebo N= Five subjects reported SAEs all considered unrelated + Pfizer Confidential 17
18 Safety summary All dose levels and both formulations were generally safe and well tolerated Majority of local reactogenicity reported was injection site pain and majority of systemic events reported were headache and fatigue Median duration of local reactions and systemic events was generally 1 to 2 days and 1 to 3 days, respectively Within dose levels: Tendency for more frequent local reactions in recipients of the toxoidalone formulations in both age cohorts Tendency for more frequent systemic events in recipients of the toxoid-alone formulations in the younger age cohort Adverse events more frequent amongst older age cohort No worsening of safety laboratory parameters in relation to vaccination Pfizer Confidential 18
19 Robust Anti-Toxin A Immune Response in Both Age Cohorts (Geometric Mean Concentrations, Evaluable Immunogenicity Population) Toxin A-Specific Neutralizing Antibody GMC (50- to 64-Year Age Cohort) Pfizer Confidential 19
20 Robust Anti-Toxin A Immune Response in Both Age Cohorts (Geometric Mean Concentrations, Evaluable Immunogenicity Population) Toxin A-Specific Neutralizing Antibody GMC (65- to 85-Year Age Cohort) Pfizer Confidential 20
21 Robust Anti-Toxin B Immune Response in Both Age Cohorts (Geometric Mean Concentrations, Evaluable Immunogenicity Population) Toxin B-Specific Neutralizing Antibody GMC (50- to 64-Year Age Cohort) Pfizer Confidential 21
22 Robust Anti-Toxin B Immune Response in Both Age Cohorts (Geometric Mean Concentrations, Evaluable Immunogenicity Population) Toxin B-Specific Neutralizing Antibody GMC (65- to 85-Year Age Cohort) Pfizer Confidential 22
23 Phase 1 Study Conclusions Pfizer s Clostridium difficile vaccine at 3 toxoid dose levels, administered at Months 0, 1, 6, with or without Alhydrogel is generally safe and well tolerated in healthy adults aged 50 to 85 years No clear dose response was observed, due to limited sample size and 95% confidence intervals often overlapping Toxin-neutralizing antibody titers increased with each dose Increased GMC s sustained up to at least 6 months postdose 3 The encouraging early immune response and favorable safety profile reported in this FIH study warrant further investigation of Pfizer s Clostridium difficile vaccine Pfizer Confidential 23
Recombinant, Insect Cell-Derived RSV Nanoparticle Vaccine
Recombinant, Insect Cell-Derived RSV Nanoparticle Vaccine Gregory Glenn Chief Medical Officer MVADS-Copenhagen 4 July 2012 1 Agenda for RSV Discussion Overview of Insect Cell Technology Respiratory Syncytial
More informationNovavax RSV F Vaccine is composed of a recombinant near full length F protein
Magnitude and Durability of Anti-F IgG and Palivizumab-Competitive Antibody (PCA) Responses One Year Following Immunization with RSV F Nanoparticle Vaccine Adjuvanted with Aluminum Phosphate, or a Novel
More informationRSV F Nanoparticle Vaccine: Update Gregory M. Glenn M.D., SVP R&D
RSV F Nanoparticle Vaccine: Update Gregory M. Glenn M.D., SVP R&D Summary of Findings in Recent Clinical Trials International Society of Vaccines October 26, 2014 1 www.novavax.com 2 The Problem with RSV
More informationDrug Substance Process Challenges- A Vaccine Perspective. May 17, 2016 Justin Moran
Drug Substance Process Challenges- A Vaccine Perspective May 17, 2016 Justin Moran Outline Background Vaccines versus monoclonal antibodies Case study: Development of a protein antigen 2 A Legacy of Achievement
More informationGenitope Corporation. Summary of MyVax Personalized Immunotherapy Phase 3 Clinical Trial Results
Genitope Corporation Summary of MyVax Personalized Immunotherapy Phase 3 Clinical Trial Results Introduction In December 27, Genitope Corporation ( Genitope ) obtained data indicating that its pivotal
More informationUpdate on the role of dtpa-ipv vaccine as a booster in the pre-school age
Update on the role of dtpa-ipv vaccine as a booster in the pre-school age Gabutti G 1, Conversano M 2, Ferrera G 3, Matera R 4, Parlato A 5, Zivelonghi G 6, Azzari C 7 1 Dipartimento di Medicina Clinica
More informationDepoVax TM : A novel delivery formulation for cancer immunotherapy and infectious disease vaccines
DepoVax TM : A novel delivery formulation for cancer immunotherapy and infectious disease vaccines May 10, 2017 The DepoVax Platform A patented oil-based formulation NOT an adjuvant Creates powerful vaccines
More information1. TITLE PAGE Study Title:
1. TITLE PAGE Study Title: A Randomized, Placebo Controlled Study Evaluating the Efficacy and Safety of AMG 531 Treatment of Thrombocytopenic Subjects with Immune (Idiopathic) Thrombocytopenic Purpura
More informationFor personal use only
ADMEDUS Ltd ABN 35 088 221 078 REGISTERED OFFICE: Level 1, 197 Adelaide Terrace Perth Western Australia 6000 PO Box 6879 East Perth Western Australia 6892 ASX ANNOUNCEMENT T +61 (0)8 9266 0100 F +61 (0)8
More informationEvaluation of AMG 531 Efficacy in Splenectomized Patients with Chronic ITP in a Randomized Placebo- Controlled Phase 3 Study
Evaluation of AMG 531 Efficacy in Splenectomized Patients with Chronic ITP in a Randomized Placebo- Controlled Phase 3 Study Plenary Session at ASH 2007 Presented by Terry B. Gernsheimer Madeleine Verhovsek
More information1.0 Abstract. Palivizumab P Study Results Final
1.0 Abstract Title: Prospective, Multi-Center, Observational Program to Assess RSV Hospitalization Rate in Population of Children at High-risk of Serious RSV Illness Who Received Palivizumab Immunoprophylaxis
More informationHUMAN CHALLENGE TESTING
HUMAN CHALLENGE TESTING CLINICAL RESEARCH SOLUTIONS DE-RISKING Faced with increasing pressures on timelines and budgets, clinical research practices need to continuously evolve in order to ensure pipeline
More informationPassive vaccination as a global strategy for preventing RSV disease in infants. Filip Dubovsky MD MPH FAAP MedImmune March 2016
Passive vaccination as a global strategy for preventing RSV disease in infants Filip Dubovsky MD MPH FAAP MedImmune March 2016 Outline for Presentation Rationale for passive immunization for RSV prophylaxis
More informationTreating and Preventing Infectious Disease. November 2011 Nasdaq: INHX
Treating and Preventing Infectious Disease November 2011 Nasdaq: INHX Safe Harbor This presentation contains forward looking statements about Inhibitex and its business, business prospects, strategy and
More informationPage 1 of 11. WHO Target Product Profile for multivalent filovirus vaccines: providing long-term protection to high-risk populations.
Page 1 of 11 WHO Target Product Profile for multivalent filovirus vaccines: providing long-term protection to high-risk populations November 2016 Page 2 of 11 Target Audience The target audience for this
More informationRSV F Vaccine: Phase 2 Clinical Trial to Protect Infants via Maternal Immunization Allison August, MD
RSV F Vaccine: Phase 2 Clinical Trial to Protect Infants via Maternal Immunization Allison August, MD Agenda Novavax: Brief Overview RSV Disease Burden in Target Population Novavax RSV F Recombinant Nanoparticle
More informationOral vaccines to protect patients against Clostridium difficile infection
Oral vaccines to protect patients against Clostridium difficile infection Jonathan Kearsey: Leads To Development Antibiotics and their alternatives-fixing and feeding the pipeline Project number: 601810
More informationSimonetta Viviani, MD BIO-VIPE Consulting Limited, Hong Kong
Simonetta Viviani, MD BIO-VIPE Consulting Limited, Hong Kong DCVMN Clinical Development & Pharmacovigilance Training 17-21 July 2016, Bali, Indonesia Pratical tips on how to write a protocol Write the
More informationNON-INTERVENTIONAL STUDY ABSTRACT FOR EXTERNAL DISCLOSURE
NON-INTERVENTIONAL STUDY ABSTRACT FOR EXTERNAL DISCLOSURE Title: KIMS (Pfizer International Metabolic Database) Date of Abstract: 25 February 2015 Keywords: Growth hormone deficiency, Genotropin, hypopituitarism.
More informationInfectious Disease Programs:
Infectious Disease Programs: Valortim (MDX-133) Fully Human Anti-Anthrax Toxin MAb Candidate for Project BioShield Procurement Israel Lowy, M.D., Ph.D. Senior Director, Clinical Science and Infectious
More informationSUPPLEMENTAL DIGITAL CONTENT 1 SUPPLEMENTAL TEXT. Supplemental to: Randomized trial to compare immunogenicity and safety of a CRM and TT
SUPPLEMENTAL DIGITAL CONTENT 1 SUPPLEMENTAL TEXT Supplemental to: Randomized trial to compare immunogenicity and safety of a CRM and TT conjugated quadrivalent meningococcal vaccine in teenagers who received
More informationVaccine Safety Monitoring, Reporting and Analysis. GBC 2017, Yun Chon, Ph. D
Vaccine Safety Monitoring, Reporting and Analysis GBC 2017, Yun Chon, Ph. D Disclaimer This presentation is based on my own opinion and is not representing the opinion of International Vaccine Institute.
More informationNew generation typhoid conjugate vaccine for preventing typhoid disease TEAM BHARAT
(Typhoid Vi Capsular Polysaccharide-Tetanus Toxoid Conjugate Vaccine) New generation typhoid conjugate vaccine for preventing typhoid disease TEAM BHARAT Introduction This disease is common in many developing
More informationClinical Evaluation Phases 1,2,3,4
Clinical Evaluation Phases 1,2,3,4 Matt Laurens, MD MPH Associate Professor of Pediatrics Center for Vaccine Development Institute for Global Health University of Maryland School of Medicine February 1,
More informationDevelopment of Vaxfectin -formulated HSV-2 Plasmid DNA Vaccines for Prophylactic and Therapeutic Applications
Development of Vaxfectin -formulated HSV-2 Plasmid DNA Vaccines for Prophylactic and Therapeutic Applications Sean M. Sullivan, Ph.D. Executive Director Pharmaceutical Sciences 14 July 2011 - DNA Vaccines
More informationDisclosure. Hemophilia: The Royal Treatment. Objectives. Background. History of Hemophilia. Epidemiology 1/4/2018
Disclosure Hemophilia: The Royal Treatment Nikki Heeren, PharmD PGY1 Resident Avera McKennan Hospital I have had no financial relationship over the past 12 months with any commercial sponsor with a vested
More informationFirst Results of the Phase 3 Randomized, Placebo-Controlled ZOE-HSCT Clinical Trial
Efficacy and Safety of an Adjuvanted Herpes Zoster Subunit Vaccine in Autologous Hematopoietic Stem Cell Transplant Recipients 18 Years of Age or Older First Results of the Phase 3 Randomized, Placebo-Controlled
More informationGenentech Contacts: Media: Tara Cooper (650) Investor: Kathee Littrell (650)
NEWS RELEASE Genentech Contacts: Media: Tara Cooper (650) 225-5505 Investor: Kathee Littrell (650) 225-1034 XOMA Media/Investor Contacts: Laura Zobkiw (510) 204-7273 Peter Davis (510) 204-7231 FDA APPROVES
More informationJ.P. Morgan 36 th Annual Healthcare Conference. January 10, 2018
J.P. Morgan 36 th Annual Healthcare Conference January 10, 2018 Forward Looking Statements BioCryst s presentation may contain forward looking statements, including statements regarding future results,
More informationResults to be Presented at LDN WORLD Symposium in February Initiation of Repeat-Dose Pompe Study Anticipated in 3Q13
Amicus Therapeutics Announces Positive Results from All Four Cohorts in Phase 2 Chaperone-Enzyme Replacement Therapy (ERT) Co-Administration Study for Pompe Disease Strong Proof-of-Concept Data for Chaperone
More informationSabin-IPV development, clinical trials & optimization
Sabin-IPV development, clinical trials & optimization Wilfried Bakker 11 th WHO/UNICEF consultation with OPV/IPV manufacturers Contents Sabin-IPV type 2 immunogenicity Clinical Trials Optimizations update
More informationField trial with veterinary vaccine
١ Field trial with veterinary vaccine Saeedeh Forghani,, M.D. Clinical Trial and Ethics Department Human Health Management Deputy of Quality Assurance 89/4/2 ٢ ٣ Introduction: The efficacy and safety shall
More informationIndividual-Based Correlates of Protection
Module 8 Evaluating Immunological Correlates of Protection Session 3 Evaluating Correlates of Protection Using Individual, Population, and Titer-specific Approaches Ivan S.F. Chan, Ph.D. Merck Research
More informationSponsor. Generic Drug Name. Trial Indication(s) Protocol Number. Protocol Title. Clinical Trial Phase. Study Start/End Dates
Sponsor Sandoz GmbH Generic Drug Name Filgrastim Trial Indication(s) Neutropenia in breast cancer patients on myelosuppressive chemotherapy Protocol Number EP06-302 Protocol Title A randomized, double-blind,
More informationEU Regulatory Perspective on RSV vaccines
EU Regulatory Perspective on RSV vaccines EU Perspective No RSV-specific guideline in the EU There is no established EU (i.e. CHMP) position CHMP scientific advice has been given, which reflects current
More informationImmunogenicity of Therapeutic Proteins. Steven J Swanson, Ph.D. Executive Director, Clinical Immunology
Immunogenicity of Therapeutic Proteins Steven J Swanson, Ph.D. Executive Director, Clinical Immunology swanson@amgen.com Causes of Immunogenicity Sequence differences between therapeutic protein and endogenous
More informationASSESSING THE EFFICACY AND SAFETY OF NORMAL INTRAVENOUS IMMUNOGLOBULIN PRODUCTS FOR MARKETING AUTHORISATIONS
ASSESSING THE EFFICACY AND SAFETY OF NORMAL INTRAVENOUS IMMUNOGLOBULIN PRODUCTS FOR MARKETING AUTHORISATIONS Guideline Title Assessing the Efficacy and Safety of Normal Intravenous Immunoglobulin Products
More informationAntibody against Chikungunya virus (mrna-1944)
Antibody against Chikungunya virus (mrna-1944) Modality Program # Program Indication Preclinical development Phase 1 Phase 2 Phase 3 and commercial Moderna rights mrna-1944 Antibody against Chikungunya
More informationPolicy Position. Pharmacy-mediated interchangeability for Similar Biotherapeutic Products (SBPs)
Pharmacy-mediated interchangeability for Similar Biotherapeutic Products (SBPs) Geneva, April 2016 Appropriate use of biotherapeutics including SBPs - SBPs, also known as biosimilars, are developed to
More informationPreclinical study. Assist.Prof. Witthawat Wiriyarat Faculty of Veterinary Science, Mahidol University
Preclinical study Assist.Prof. Witthawat Wiriyarat Faculty of Veterinary Science, Mahidol University Overviews Principle of animal use Biological activity/pharmacodynamics Animal species and model selection
More informationSYNOPSIS. Clinical Study Report for Study CV Individual Study Table Referring to the Dossier
Name of Sponsor/Company: Bristol-Myers Squibb Name of Finished Product: Individual Study Table Referring to the Dossier (For National Authority Use Only) Name of Active Ingredient: SYNOPSIS Clinical Study
More informationBrain Tumour Australia Information FACT SHEET 22 Clinical Trials: Questions and Answers
FACT SHEET 22 Clinical Trials: Questions and Answers What is a clinical trial? Clinical trials are research studies that answer scientific questions and try to find better ways to prevent, screen for,
More informationBringing True Novelty to the Anti-Infective Space
Bringing True Novelty to the Anti-Infective Space New Class of Antibacterials Based on a Unique Mechanism of Action Dr Dawn Firmin SMi s 17 th Annual Conference on Superbugs & Superdrugs March 2015 1 Contents
More informationAffimed Presents Data from Phase 1b Combination Study of AFM13 with Pembrolizumab at ASH
FOR IMMEDIATE RELEASE Affimed Presents Data from Phase 1b Combination Study of AFM13 with Pembrolizumab at ASH Completed dose-escalation shows combination of AFM13 and pembrolizumab is well-tolerated;
More informationICH Considerations. Oncolytic Viruses September 17, 2009
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH Considerations Oncolytic Viruses September 17, 2009 1. Introduction Oncolytic viruses
More informationNext-Gen Cholera Vaccines
Next-Gen Cholera Vaccines GTFCC OCV Working Group Meeting Sourabh Sobti December 5-6 th 2018, Annecy, France 1 HILLCHOL IS AN INNOVATIVE VACCINE WITH STREAMLINED MANUFACTURING PROCESS PROBLEM STATEMENT
More informationInnovative Clinical Development Solutions
Innovative Clinical Development Solutions From Protocol to Package Insert: A Data Journey AMWA Medical Writing & Communication Conference Thursday, November 1, 2018 Introductions Alex Rohall Senior Manager,
More informationCD33-Targeting ADCs in AML
Maturing Clinical Profile of IMGN779, a Next- Generation CD33-Targeting Antibody-Drug Conjugate, in Patients with Relapsed or Refractory Acute Myeloid Leukemia Jorge E. Cortes 1, Daniel J. DeAngelo 2,
More informationIn vivo Evaluation of Lassa virus Therapeutics. David Safronetz, Ph.D Public Health Agency of Canada
In vivo Evaluation of Lassa virus Therapeutics David Safronetz, Ph.D Public Health Agency of Canada Outline: Caveats Ribavirin Favipiravir or Ribavirin Favipiravir plus Ribavirin Antibody Treatments Promising
More information12-Month Interim Analysis of APOE4 Carriers for Fixed and Titration Dosing Regimens in PRIME, a Phase 1b study of Aducanumab
12-Month Interim Analysis of APOE4 Carriers for Fixed and Titration Dosing Regimens in PRIME, a Phase 1b study of Aducanumab Vissia Viglietta, 1 John O Gorman, 1 Leslie Williams, 1 Tianle Chen, 1 Ahmed
More informationAnnex 5 Recommendations for diphtheria, tetanus, pertussis and combined vaccines (Amendments 2003)
World Health Organization WHO Technical Report Series, No. 927, 2005 Annex 5 Recommendations for diphtheria, tetanus, pertussis and combined vaccines (Amendments 2003) Introduction These amendments should
More informationChapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology
Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing
More information1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology
Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing
More informationFDA Statistical Review and Evaluation. September 22, 2004
FDA Statistical Review and Evaluation Document for the Vaccines and Related Biological Products Advisory Committee (VRBPAC) September 22, 2004 Menactra, Meningococcal (Groups A, C, Y, and W135) Polysaccharide
More informationCLINICAL STUDY REPORT SYNOPSIS
CLINICAL STUDY REPORT SYNOPSIS Document No.: EDMS-PSDB-7385407:2.0 Name of Sponsor/Company Grünenthal GmbH/Johnson & Johnson Pharmaceutical Research & Development, L.L.C. Name of Finished Product Name
More informationStealth BioTherapeutics Mission:
The following is a summary of a live presentation offered through joint collaboration with UMDF, MitoAction and the Foundation for Mitochondrial Medicine to the mitochondrial disease patient and family
More informationCONTRACTING ORGANIZATION: Albert Einstein College of Medicine Bronx, NY 10461
AD Award Number: W81XWH-08-1-0011 TITLE: Defining B. Anthracis Protective Antigen Antigenic Domains PRINCIPAL INVESTIGATOR: Arturo Casadevall, M.D., Ph.D. CONTRACTING ORGANIZATION: Albert Einstein College
More informationClinicalTrials.gov Protocol Registration and Results System (PRS) Receipt Release Date: 08/04/2013. ClinicalTrials.gov ID: NCT
ClinicalTrials.gov Protocol Registration and Results System (PRS) Receipt Release Date: 08/04/2013 ClinicalTrials.gov ID: NCT01237340 Study Identification Unique Protocol ID: EMR 701048-009 Brief Title:
More informationWHO-MSD Collaboration to Bring an Ebola Vaccine to the Populations in Need
WHO-MSD Collaboration to Bring an Ebola Vaccine to the Populations in Need Jules Millogo, MD, MSc Director, Public Health Partnerships Merck & Co, Inc. North Wales, PA, USA V920: rvsvδg-zebov-gp Vaccine
More informationCaplacizumab. Wholly-owned anti-vwf Nanobody
1 Caplacizumab Wholly-owned anti-vwf Nanobody First-in-class bivalent Nanobody with Orphan Drug Status and patent protection up to 2035 Developed for the treatment of acquired thrombotic thrombocytopenic
More informationClinical Study Synopsis
Clinical Study Synopsis This document is not intended to replace the advice of a healthcare professional and should not be considered as a recommendation. Patients should always seek medical advice before
More informationSmall-Cap Research. ContraFect Corp. (CFRX-NASDAQ) CFRX: CF-301 Phase 1 Results Presented at ECCMID Conference UPDATE SUMMARY DATA ZACKS ESTIMATES
Small-Cap Research April 12, 2016 David Bautz, PhD 312-265-9471 dbautz@zacks.com scr.zacks.com 10 S. Riverside Plaza, Chicago, IL 60606 ContraFect Corp. (CFRX-NASDAQ) CFRX: CF-301 Phase 1 Results Presented
More informationPublished 07 February 2011 Page January 2011
filgrastim 12 million units (120microgram) / 0.2mL, 30 million units (300microgram) / 0.5mL, 48 million units (480microgram) / 0.5mL solution for injection/infusion in pre-filled syringe (Nivestim) SMC
More informationIntroducing MN-166 Multiple Sclerosis. July 9, 2008
Introducing MN-166 A New Treatment Paradigm for Multiple Sclerosis July 9, 2008 MediciNova, Inc. 2008 Forward-Looking Statements Statements in this presentation that are not historical in nature constitute
More informationPraxbind. (idarucizumab) New Product Slideshow
Praxbind (idarucizumab) New Product Slideshow Introduction Brand name: Praxbind Generic name: Idarucizumab Pharmacological class: Humanized monoclonal antibody fragment Strength and Formulation: 2.5g/50mL;
More informationValue Assessment: Building Payercentric value propositions to inform decision-making
Value Assessment: Building Payercentric value propositions to inform decision-making Aris Angelis and Panos Kanavos Medical Technology Research Group, LSE Health Advance-HTA dissemination workshop, Santiago,
More informationHeparin Induced Thrombocytopenia. Heparin Induced Thrombocytopenia. Heparin Induced Thrombocytopenia. Temporal Aspects.
Heparin Induced Eric Kraut, MD Professor of Internal Medicine The Ohio State University Medical Center Heparin Induced Heparin induced thrombocytopenia occurs in up to 5 % of patients receiving unfractionated
More informationSynthetic Biologics Reports Year End 2012 Financial Results
April 16, 2013 Synthetic Biologics Reports Year End 2012 Financial Results -- Strengthening Infectious Disease Portfolio to Include C. difficile, Pertussis and Acinetobacter Targets -- ROCKVILLE, Md.,
More informationWHO vaccine standardization: an update
PDVAC WHO vaccine standardization: an update Dr, WHO/HIS/EMP/TSN/NSB 10 th June 2016 Geneva Outline Standardization and regulatory evaluation of vaccines and biotherapeutic products Development of measurement
More informationIMMUNOLOGY Receptors of T cells are TCR T Cell Receptors which are present on the cell surface of T lymphocytes.
IMMUNOLOGY - 4 - What is an ANTIGEN? It is a molecule that can be recognized by a receptor and combine with it specifically and the receptor here is the one either produced by B cells or T cells: Receptors
More informationCHALLENGES AND SOLUTIONS TO RECEPTOR OCCUPANCY STUDIES BY FLOW CYTOMETRY
CHALLENGES AND SOLUTIONS TO RECEPTOR OCCUPANCY STUDIES BY FLOW CYTOMETRY 4th RSC / DMDG / DMG New Perspectives in DMPK James Munday Science Lead I&I (Harrogate, UK) 21 st -22nd May 2018 Copyright 2018
More informationICH CONSIDERATIONS Oncolytic Viruses
European Medicines Agency Pre-authorisation Evaluation of Medicines for Human Use 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 ICH CONSIDERATIONS Oncolytic Viruses 20 November 2008 EMEA/CHMP/GTWP/607698/2008
More informationEbola Facts. October 14, 2014
Ebola Facts October 14, 2014 Symptoms of Ebola Initial symptoms are nonspecific - may include fever, chills, myalgias, and malaise. Patients can progress to develop gastrointestinal symptoms: severe watery
More informationGHIT の活動から新薬開発へのファンディングを考える. BT Slingsby, CEO, GHIT Fund
GHIT の活動から新薬開発へのファンディングを考える BT Slingsby, CEO, GHIT Fund Anti-Infectives Over 100 Years Development of antibacterial agents in Japan 八木澤守正 : 抗菌薬を概観する : 過去, 現在, そしてこれから 日化療会誌 2016 60: 149-167 舘田一博 : 抗菌薬開発停滞の打破へ向けて
More informationPrimer Sequence b Amino acids a. agccatgggtttaatatctaaagaagagttaataaaactcgcatatagc. ccggatccacttaatctagcaaattcgcttgtgttgaattcatctttacc
Table S1. Oligonucleotides used for cloning toxin domains of C. difficile VPI10463 Toxin and fragment Primer Sequence b Amino acids a Toxin A fragment 1 TxAfrag1Fw TxAfrag1Rv agccatgggtttaatatctaaagaagagttaataaaactcgcatatagc
More informationGEN-003. Positive Phase 2b Clinical Efficacy Results. Immunotherapy Candidate for Genital Herpes. 12-Month Top-line Results
GEN-003 Positive Phase 2b Clinical Efficacy Results Immunotherapy Candidate for Genital Herpes 12-Month Top-line Results Disclaimer This presentation contains forward-looking statements that are within
More informationA regulatory update on the EU guideline on First-in-Human clinical trials
A regulatory update on the EU guideline on First-in-Human clinical trials Thomas Sudhop, BfArM, Bonn Thomas Sudhop A regulatory update on the EU guideline on First-in-Human clinical trials 17 May 2017
More informationEfficacy trials of Lassa Therapeutics: endpoints, trial design, site selection
Efficacy trials of Lassa Therapeutics: endpoints, trial design, site selection WHO Workshop Final Report April 25, 2018 INSERM, Paris, France Table of contents TABLE OF CONTENTS 1 1. INTRODUCTION 2 2.
More informationAdverse Event Reporting: During the Study
Vol. 5, No. 8, August 2009 Can You Handle the Truth? Adverse Event Reporting: During the Study By S. Eric Ceh The reporting of adverse events (AEs) is a standard task for investigative sites involved in
More informationThe Science of Drug Discovery: The Intersection of Clinical Trials and Drug Development. Rich Whitley March 2, 2017
The Science of Drug Discovery: The Intersection of Clinical Trials and Drug Development Rich Whitley March 2, 2017 The Many Faces of Clinical Research n Natural History Study n The impact of congenital
More information2018 ECTRIMS Data Review Call. October 2018
2018 ECTRIMS Data Review Call October 2018 TG Therapeutics Michael S. Weiss, CEO Forward Looking Safe Harbor Statement This presentation contains forward-looking statements within the meaning of the Private
More informationThe Dengue Vaccine Landscape. In-Kyu Yoon, M.D. Director, Dengue Vaccine Initiative International Vaccine Institute Seoul, Korea
The Dengue Vaccine Landscape In-Kyu Yoon, M.D. Director, Dengue Vaccine Initiative International Vaccine Institute Seoul, Korea 1 Dec 2015 Dengue Vaccine Initiative (DVI) John Hopkins University School
More informationAlexion to Acquire Syntimmune Conference Call September 26, 2018
Alexion to Acquire Syntimmune Conference Call September 26, 2018 Alexion to Acquire Syntimmune Introduction Susan Altschuller, Ph.D., Investor Relations Summary & Strategic Rationale Ludwig Hantson, Ph.D.,
More informationDevelopment of plasma therapies for emerging infectious diseases. Dr Glenn Smith Biological Science Section Scientific Evaluation Branch
Development of plasma therapies for emerging infectious diseases Dr Glenn Smith Biological Science Section Scientific Evaluation Branch June 2017 Therapeutic Goods Administration (TGA) A part of the Australian
More informationAccelerated Ebola Vaccine Development: Phase 1-2
15 April 2015 Vasee Moorthy MRCP PhD Accelerated Ebola Vaccine Development: Phase 1-2 WHO calls for accelerated ebola vaccine development We call on the international vaccine community to accelerate development
More informationA GUIDE TO THIS REFLECTIONS B RESEARCH STUDY IF YOU RE FIGHTING BREAST CANCER, YOU RE NOT ALONE
A GUIDE TO THIS REFLECTIONS B327-02 RESEARCH STUDY IF YOU RE FIGHTING BREAST CANCER, YOU RE NOT ALONE Do you have breast cancer that has spread to outside the breast? Has your tumor tested positive for
More informationJanuary (San Francisco, CA) January 8, 2018
January 2017 J.P. Morgan 36 th Annual Management Healthcare Presentation Conference (San Francisco, CA) January 8, 2018 DISCLAIMER Certain information contained in this presentation relates to or is based
More informationPreclinical Development of Biologics: Case-by-case, so get off of my case!
Preclinical Development of Biologics: Case-by-case, so get off of my case! Northeast Chapter SOT David Jacobson-Kram, Ph.D., DABT Office of New Drugs Center for Drug Evaluation and Research FDA October
More informationActelion Pharmaceuticals Ltd. Gewerbestrasse 16 Allschwil 4123 Switzerland
Trial information Subject disposition Subject analysis sets Baseline characteristics End points Adverse events More information TRIAL INFORMATION Trial identification Eudract number Sponsor protocol code
More informationCADTH CANADIAN DRUG EXPERT COMMITTEE FINAL RECOMMENDATION
CADTH CANADIAN DRUG EXPERT COMMITTEE FINAL RECOMMENDATION FILGRASTIM (Grastofil Apotex Inc.) Indications: Prevention or Treatment of Neutropenia Recommendation: The CADTH Canadian Drug Expert Committee
More informationTotal urinary GAGs declined by 51%, dermatan sulfate by 32%, and heparan sulfate by 61% in Cohort 2 at 16 weeks
September 5, 2018 Sangamo Announces 16 Week Clinical Results Including Reductions In Glycosaminoglycans In Phase 1/2 Trial Evaluating SB-913, A Zinc Finger Nuclease Genome Editing Treatment For MPS II
More informationVACCINE DELIVERY USING THE NEMAURA SOLID DOSE INJECTOR
VACCINE DELIVERY USING THE NEMAURA SOLID DOSE INJECTOR In this article, Joanne Broadhead, PhD, Product Development, Nemaura Pharma; and Karmen Cheung, MSc, Department of Chemical Engineering, Loughborough
More informationDMC member experience: studies with adaptive designs. P.Bauer Medical University of Vienna December 2007
DMC member experience: studies with adaptive designs P.Bauer Medical University of Vienna December 2007 A typical application: Dose selection and confirmative inference (the critical issue of combining
More informationUse of Heparin and The Related Incidence of Heparin- Induced Thrombocytopenia in an Education and Research Hospital in Turkey
VOLUME 8 NUMBER 3 September 2017 JOURNAL OF CLINICAL AND EXPERIMENTAL INVESTIGATIONS ORIGINAL ARTICLE Use of Heparin and The Related Incidence of Heparin- Induced Thrombocytopenia in an Education and Research
More informationSafety and Efficacy of Daratumumab with Lenalidomide and Dexamethasone in Relapsed, or Relapsed and Refractory Multiple Myeloma
Safety and Efficacy of Daratumumab with Lenalidomide and Dexamethasone in Relapsed, or Relapsed and Refractory Multiple Myeloma Torben Plesner 1, Hendrik-Tobias Arkenau 2, Henk M Lokhorst 3, Peter Gimsing
More informationWHO Blood Regulators Network (BRN)
Distribution: General English only WHO Blood Regulators Network (BRN) Position Paper on Use of Convalescent Plasma, Serum or Immune Globulin Concentrates as an Element in Response to an Emerging Virus*
More informationDrug Utilization Review: Palivizumab (Synagis ; Medimmune)
Background Respiratory syncitial virus (RSV) is a highly contagious virus that is estimated to infect nearly all children by 3 years of age, and is the leading cause of serious lower respiratory tract
More informationQ3 Analysts Presentation. November 5, 2013
Q3 Analysts Presentation November 5, 2013 Disclaimer Forward Looking Statements These materials contain certain forward-looking statements relating to the business of Valneva SE (the Company ), including
More informationICH S9 guideline on nonclinical evaluation for anticancer pharmaceuticals - questions and answers
16 May 2018 EMA/CHMP/ICH/453684/2016 Committee for Human Medicinal Products ICH S9 guideline on nonclinical evaluation for anticancer pharmaceuticals - questions and answers Step 5 Transmission to CHMP
More informationFDA Perspective on the Preclinical Evaluation of Biological Therapies for Cancer
FDA Perspective on the Preclinical Evaluation of Biological Therapies for Cancer Yongjie Zhou, M.D., Ph.D. FDA/CBER/OCTGT/DCEPT Yongjie.zhou@fda.hhs.gov isbtc Global Regulatory Summit October 29, 2008
More information