A Phase I Study to Evaluate the Safety, Tolerability, and Immunogenicity of a Clostridium difficile

Size: px
Start display at page:

Download "A Phase I Study to Evaluate the Safety, Tolerability, and Immunogenicity of a Clostridium difficile"

Transcription

1 A Phase I Study to Evaluate the Safety, Tolerability, and Immunogenicity of a Clostridium difficile vaccine administered with or without Aluminum Hydroxide, in a 3-Dose Regimen in Healthy Adults Aged 50 to 85 Years Louise Pedneault, Eric Sheldon, Nicholas Kitchin, Yahong Peng, Joseph Eiden, William Gruber, Erik Johnson, Kathrin U. Jansen, Michael Pride 5 th ICDS, Bled Slovenia, 20 May 2015

2 Clostridium difficile-associated disease represents a significant unmet medical need Anaerobic spore-forming Grampositive bacillus Main cause of nosocomial infections 1 Increase in CDAD incidence and disease severity 2-5 C.difficile associated disease (CDAD) is directly attributable to production of Toxins A and B by C. difficile 6,7 No prophylactic vaccine is currently available for prevention of primary or recurrent CDAD Estimated US Burden of C.difficile Infection, CO-HCA = community onset health care-associated; NHO = nursing home onset; HO = hospital onset 1 Magill SS et al, NEJM 2014;370: ; 2 Gerding & Lessa, Infect Dis Clin N Am 2015;29:37-50; 3 Lessa FC et al, NEJM 2015;372:825-34; 4 Bauer et al, Lancet 2011;377:63-73; 5 Davies et al, Lancet Infect Dis 2014;14: ; 6 Giannasca et al (1999) Infect Immun; 7 Torres et al. (1995) Infect Immun Pfizer Confidential 2

3 Proof of Concept for a Toxoid Vaccine Toxin-based diseases like diphtheria, cholera and tetanus have been prevented by antitoxin antibodies or toxoid vaccines Clinical data indicate that antitoxin antibodies provide protection from CDAD: 72% reduction of CDAD recurrence Lowy I et al. N Engl J Med 2010;362: Pfizer Confidential 3

4 Pfizer s bivalent toxoid vaccine preserves important antigenic epitopes and neutralizes toxins from circulating clinical strains TOXIN STRUCTURE GENETIC TOXOID EXPRESSION PLASMID EXPRESSION IN C.difficile (Cytotoxic Function) RECIPIENT VPI SPO-A AND TOXIN MINUS Neutralization of B Toxins from C.difficile Strains Chemical Treatment of Genetically Modified Toxins Preserves Neutralizing Epitopes Sample EC 50 (ug/ml) Reduction in Cytotoxtoicity (log) Max Binding (Rmax) Neut mab Genetic txd A Formalin-txdA >1000 > Pfizer-txd A >1000 > Genetic txd B Formalin-txd B > Pfizer-txd B > Pfizer Confidential 4

5 Percent survival Bleed / Vax Bleed / Vax Bleed / Vax Clindamycin Bleed / Challenge (5,000 CFU Strain 630) Day 11/ Termination C. difficile Toxoid Vaccine Candidate Protects Hamsters (n=15/group) from C. difficile Challenge Post challenge W0 W2 W4 W5, 9, W6, 10, or 13 or 14 Challenge Post Last Vaccination Weeks 6 Weeks 10 Weeks Formulation Adjuvant 1 1 Formulation Adjuvant 2 2 Placebo (Matrix/NaCl) Days post-infection Formulation 1 = 93% (14/15) Formulation 2 = 93% (14/15) Days post-infection Formulation 1 = 93% (14/15) Formulation 2 = 80% (12/15) Days post-infection Formulation 1 = 100% (15/15) Formulation 2 = 80% (12/15) 5 Jansen K. 4 th International Clostridium difficile Symposium, 2012, Bled, Slovenia, Abstract O2

6 Phase 1 Study - Methods Design Phase 1, randomized, placebo-controlled, observer-blind Two age cohorts: yo and yo healthy adults Three doses administered on Day 1, Months 1 and 6 4 US sites Study Group* Formulation Subjects receiving Vaccine Placebo 1 50 mcg C. diff mcg C. diff mcg C. diff mcg C. diff mcg C. diff mcg C. diff * Six study groups replicated for each of the two age cohorts Pfizer Confidential 6

7 Phase 1 Study Methods Safety Evaluations Prompted e-diary events (both local reactions and systemic events that occurred in the 7 days after investigational product administration) Acute reactions within the first 30 minutes after investigational product administration Adverse events (AEs), serious AEs (SAEs) Hematologic and blood chemistry assessments Safety-driven stopping rules were in effect throughout the trial Unblinded safety data were reviewed by the internal Pfizer safety review team (PSRT) and external data monitoring committee (DMC) throughout the study Pfizer Confidential 7

8 Phase 1 Study Methods Immunogenicity Assessment Toxin A- and toxin B-specific neutralizing antibody levels measured at multiple time points Pfizer Confidential 8

9 Toxin Neutralization Assay (TNA): A Brief Overview R L U TOXIN REFERENCE STANDARD Neut U/mL R e f S td A (U /m L ) Automated and sensitive assay based on luminescence readout Neutralization titers of test samples are calculated based on Reference standard Assay LLOQ: Txd A = U/ml; Txd B = U/ml

10 Phase 1 Study Statistical Considerations All analyses descriptive Each age cohort analyzed separately Safety analysis population All subjects who received at least one dose of investigational product Primary immunogenicity population: Evaluable population All subjects who received the investigational product to which they were randomized, had blood drawn within specified time frames, had valid and determinate assay results for the proposed analysis, and no major protocol violations Immunogenicity endpoint Geometric mean concentrations (GMCs) of C. difficile toxin A- and toxin B-specific neutralizing antibody levels Pfizer Confidential 10

11 Baseline characteristics year olds Placebo Randomized, n Received dose 1, n Received dose 2, n Received dose 3, n Total Age in years, mean Sex, n Female Male Pfizer Confidential 11

12 Baseline characteristics year olds Placebo Randomized, n Received dose 1, n Received dose 2, n Received dose 3, n Total Age in years, mean Sex, n Female Male Pfizer Confidential 12

13 Any local reaction 1 within 7 days yrs 100% 80% 60% 40% 20% 0% Placebo N=22 + N= Placebo N= N=11 + Placebo N=11 N=20 N=8 + N=11 N=11 + N=10 + N=8 Dose 1 Dose 2 Dose 3 Mild Moderate Severe 1 Injection site pain, swelling, redness Pfizer Confidential 13

14 Any local reaction 1 within 7 days yrs 100% 80% 60% 40% * 20% 0% Placebo N= Placebo N=21 + N= Placebo N=11 N=17 N=10 + N=9 N=8 + N=11 N=10 + N=9 Dose 1 Dose 2 Dose 3 Mild Moderate Severe * One subject reported severe redness and swelling on Day 2 after Dose 2 this was an e-diary entry error (the true diameters were mild). 1 Injection site pain, swelling, redness Pfizer Confidential 14

15 Any systemic event 1 within 7 days yrs 100% 80% 60% 40% 20% ** * 0% Placebo N=22 + N= Placebo N= N=11 + Placebo N=11 N=20 N=8 + N=11 N=11 + N=10 + N=8 Dose 1 Dose 2 Dose 3 Mild Moderate Severe * One subject reported severe fever on Days 2&3 after Dose 1 this was an e-diary entry error (the subject actually had no reactions). ** One subject reported severe fever (39.2ºC) and headache (as well as moderate diarrhea and joint pain) on Day 2 after Dose 1; both headache and diarrhea were mild on Day 3 and then resolved. One subject reported severe fever (up to 39.3ºC) on Days 1&2 after Dose 2, accompanied by moderate headache and muscle pain. 1 Vomiting, diarrhea, headache, fatigue, new or worsening muscle or joint pain Pfizer Confidential 15

16 Any systemic event 1 within 7 days yrs 100% 80% 60% 40% 20% * ** 0% Placebo N= Placebo N=21 + N= Placebo N=11 N=17 N=10 + N=9 N=8 + N=11 N=10 + N=9 Dose 1 Dose 2 Dose 3 Mild Moderate Severe Grade 4 * One subject reported Grade 4 fever (41.1ºC) on Day 4 after Dose 1 this was an e-diary entry error (the subject actually had no fever or other reactions on that day). ** One subject reported severe joint pain on Day 4 after Dose 2. The investigator confirmed that this reaction was not vaccine related, but that the subject had broken his finger a month earlier and developed a soft tissue infection secondary to a local laceration. 1 Vomiting, diarrhea, headache, fatigue, new or worsening muscle or joint pain Pfizer Confidential 16

17 Any adverse event up to 28 days post-dose 3 100% 80% 60% 40% 20% yrs 0% Placebo N=22 + N= yrs 100% 80% 60% 40% 20% 0% Placebo N= Five subjects reported SAEs all considered unrelated + Pfizer Confidential 17

18 Safety summary All dose levels and both formulations were generally safe and well tolerated Majority of local reactogenicity reported was injection site pain and majority of systemic events reported were headache and fatigue Median duration of local reactions and systemic events was generally 1 to 2 days and 1 to 3 days, respectively Within dose levels: Tendency for more frequent local reactions in recipients of the toxoidalone formulations in both age cohorts Tendency for more frequent systemic events in recipients of the toxoid-alone formulations in the younger age cohort Adverse events more frequent amongst older age cohort No worsening of safety laboratory parameters in relation to vaccination Pfizer Confidential 18

19 Robust Anti-Toxin A Immune Response in Both Age Cohorts (Geometric Mean Concentrations, Evaluable Immunogenicity Population) Toxin A-Specific Neutralizing Antibody GMC (50- to 64-Year Age Cohort) Pfizer Confidential 19

20 Robust Anti-Toxin A Immune Response in Both Age Cohorts (Geometric Mean Concentrations, Evaluable Immunogenicity Population) Toxin A-Specific Neutralizing Antibody GMC (65- to 85-Year Age Cohort) Pfizer Confidential 20

21 Robust Anti-Toxin B Immune Response in Both Age Cohorts (Geometric Mean Concentrations, Evaluable Immunogenicity Population) Toxin B-Specific Neutralizing Antibody GMC (50- to 64-Year Age Cohort) Pfizer Confidential 21

22 Robust Anti-Toxin B Immune Response in Both Age Cohorts (Geometric Mean Concentrations, Evaluable Immunogenicity Population) Toxin B-Specific Neutralizing Antibody GMC (65- to 85-Year Age Cohort) Pfizer Confidential 22

23 Phase 1 Study Conclusions Pfizer s Clostridium difficile vaccine at 3 toxoid dose levels, administered at Months 0, 1, 6, with or without Alhydrogel is generally safe and well tolerated in healthy adults aged 50 to 85 years No clear dose response was observed, due to limited sample size and 95% confidence intervals often overlapping Toxin-neutralizing antibody titers increased with each dose Increased GMC s sustained up to at least 6 months postdose 3 The encouraging early immune response and favorable safety profile reported in this FIH study warrant further investigation of Pfizer s Clostridium difficile vaccine Pfizer Confidential 23

Recombinant, Insect Cell-Derived RSV Nanoparticle Vaccine

Recombinant, Insect Cell-Derived RSV Nanoparticle Vaccine Recombinant, Insect Cell-Derived RSV Nanoparticle Vaccine Gregory Glenn Chief Medical Officer MVADS-Copenhagen 4 July 2012 1 Agenda for RSV Discussion Overview of Insect Cell Technology Respiratory Syncytial

More information

Novavax RSV F Vaccine is composed of a recombinant near full length F protein

Novavax RSV F Vaccine is composed of a recombinant near full length F protein Magnitude and Durability of Anti-F IgG and Palivizumab-Competitive Antibody (PCA) Responses One Year Following Immunization with RSV F Nanoparticle Vaccine Adjuvanted with Aluminum Phosphate, or a Novel

More information

RSV F Nanoparticle Vaccine: Update Gregory M. Glenn M.D., SVP R&D

RSV F Nanoparticle Vaccine: Update Gregory M. Glenn M.D., SVP R&D RSV F Nanoparticle Vaccine: Update Gregory M. Glenn M.D., SVP R&D Summary of Findings in Recent Clinical Trials International Society of Vaccines October 26, 2014 1 www.novavax.com 2 The Problem with RSV

More information

Drug Substance Process Challenges- A Vaccine Perspective. May 17, 2016 Justin Moran

Drug Substance Process Challenges- A Vaccine Perspective. May 17, 2016 Justin Moran Drug Substance Process Challenges- A Vaccine Perspective May 17, 2016 Justin Moran Outline Background Vaccines versus monoclonal antibodies Case study: Development of a protein antigen 2 A Legacy of Achievement

More information

Genitope Corporation. Summary of MyVax Personalized Immunotherapy Phase 3 Clinical Trial Results

Genitope Corporation. Summary of MyVax Personalized Immunotherapy Phase 3 Clinical Trial Results Genitope Corporation Summary of MyVax Personalized Immunotherapy Phase 3 Clinical Trial Results Introduction In December 27, Genitope Corporation ( Genitope ) obtained data indicating that its pivotal

More information

Update on the role of dtpa-ipv vaccine as a booster in the pre-school age

Update on the role of dtpa-ipv vaccine as a booster in the pre-school age Update on the role of dtpa-ipv vaccine as a booster in the pre-school age Gabutti G 1, Conversano M 2, Ferrera G 3, Matera R 4, Parlato A 5, Zivelonghi G 6, Azzari C 7 1 Dipartimento di Medicina Clinica

More information

DepoVax TM : A novel delivery formulation for cancer immunotherapy and infectious disease vaccines

DepoVax TM : A novel delivery formulation for cancer immunotherapy and infectious disease vaccines DepoVax TM : A novel delivery formulation for cancer immunotherapy and infectious disease vaccines May 10, 2017 The DepoVax Platform A patented oil-based formulation NOT an adjuvant Creates powerful vaccines

More information

1. TITLE PAGE Study Title:

1. TITLE PAGE Study Title: 1. TITLE PAGE Study Title: A Randomized, Placebo Controlled Study Evaluating the Efficacy and Safety of AMG 531 Treatment of Thrombocytopenic Subjects with Immune (Idiopathic) Thrombocytopenic Purpura

More information

For personal use only

For personal use only ADMEDUS Ltd ABN 35 088 221 078 REGISTERED OFFICE: Level 1, 197 Adelaide Terrace Perth Western Australia 6000 PO Box 6879 East Perth Western Australia 6892 ASX ANNOUNCEMENT T +61 (0)8 9266 0100 F +61 (0)8

More information

Evaluation of AMG 531 Efficacy in Splenectomized Patients with Chronic ITP in a Randomized Placebo- Controlled Phase 3 Study

Evaluation of AMG 531 Efficacy in Splenectomized Patients with Chronic ITP in a Randomized Placebo- Controlled Phase 3 Study Evaluation of AMG 531 Efficacy in Splenectomized Patients with Chronic ITP in a Randomized Placebo- Controlled Phase 3 Study Plenary Session at ASH 2007 Presented by Terry B. Gernsheimer Madeleine Verhovsek

More information

1.0 Abstract. Palivizumab P Study Results Final

1.0 Abstract. Palivizumab P Study Results Final 1.0 Abstract Title: Prospective, Multi-Center, Observational Program to Assess RSV Hospitalization Rate in Population of Children at High-risk of Serious RSV Illness Who Received Palivizumab Immunoprophylaxis

More information

HUMAN CHALLENGE TESTING

HUMAN CHALLENGE TESTING HUMAN CHALLENGE TESTING CLINICAL RESEARCH SOLUTIONS DE-RISKING Faced with increasing pressures on timelines and budgets, clinical research practices need to continuously evolve in order to ensure pipeline

More information

Passive vaccination as a global strategy for preventing RSV disease in infants. Filip Dubovsky MD MPH FAAP MedImmune March 2016

Passive vaccination as a global strategy for preventing RSV disease in infants. Filip Dubovsky MD MPH FAAP MedImmune March 2016 Passive vaccination as a global strategy for preventing RSV disease in infants Filip Dubovsky MD MPH FAAP MedImmune March 2016 Outline for Presentation Rationale for passive immunization for RSV prophylaxis

More information

Treating and Preventing Infectious Disease. November 2011 Nasdaq: INHX

Treating and Preventing Infectious Disease. November 2011 Nasdaq: INHX Treating and Preventing Infectious Disease November 2011 Nasdaq: INHX Safe Harbor This presentation contains forward looking statements about Inhibitex and its business, business prospects, strategy and

More information

Page 1 of 11. WHO Target Product Profile for multivalent filovirus vaccines: providing long-term protection to high-risk populations.

Page 1 of 11. WHO Target Product Profile for multivalent filovirus vaccines: providing long-term protection to high-risk populations. Page 1 of 11 WHO Target Product Profile for multivalent filovirus vaccines: providing long-term protection to high-risk populations November 2016 Page 2 of 11 Target Audience The target audience for this

More information

RSV F Vaccine: Phase 2 Clinical Trial to Protect Infants via Maternal Immunization Allison August, MD

RSV F Vaccine: Phase 2 Clinical Trial to Protect Infants via Maternal Immunization Allison August, MD RSV F Vaccine: Phase 2 Clinical Trial to Protect Infants via Maternal Immunization Allison August, MD Agenda Novavax: Brief Overview RSV Disease Burden in Target Population Novavax RSV F Recombinant Nanoparticle

More information

Oral vaccines to protect patients against Clostridium difficile infection

Oral vaccines to protect patients against Clostridium difficile infection Oral vaccines to protect patients against Clostridium difficile infection Jonathan Kearsey: Leads To Development Antibiotics and their alternatives-fixing and feeding the pipeline Project number: 601810

More information

Simonetta Viviani, MD BIO-VIPE Consulting Limited, Hong Kong

Simonetta Viviani, MD BIO-VIPE Consulting Limited, Hong Kong Simonetta Viviani, MD BIO-VIPE Consulting Limited, Hong Kong DCVMN Clinical Development & Pharmacovigilance Training 17-21 July 2016, Bali, Indonesia Pratical tips on how to write a protocol Write the

More information

NON-INTERVENTIONAL STUDY ABSTRACT FOR EXTERNAL DISCLOSURE

NON-INTERVENTIONAL STUDY ABSTRACT FOR EXTERNAL DISCLOSURE NON-INTERVENTIONAL STUDY ABSTRACT FOR EXTERNAL DISCLOSURE Title: KIMS (Pfizer International Metabolic Database) Date of Abstract: 25 February 2015 Keywords: Growth hormone deficiency, Genotropin, hypopituitarism.

More information

Infectious Disease Programs:

Infectious Disease Programs: Infectious Disease Programs: Valortim (MDX-133) Fully Human Anti-Anthrax Toxin MAb Candidate for Project BioShield Procurement Israel Lowy, M.D., Ph.D. Senior Director, Clinical Science and Infectious

More information

SUPPLEMENTAL DIGITAL CONTENT 1 SUPPLEMENTAL TEXT. Supplemental to: Randomized trial to compare immunogenicity and safety of a CRM and TT

SUPPLEMENTAL DIGITAL CONTENT 1 SUPPLEMENTAL TEXT. Supplemental to: Randomized trial to compare immunogenicity and safety of a CRM and TT SUPPLEMENTAL DIGITAL CONTENT 1 SUPPLEMENTAL TEXT Supplemental to: Randomized trial to compare immunogenicity and safety of a CRM and TT conjugated quadrivalent meningococcal vaccine in teenagers who received

More information

Vaccine Safety Monitoring, Reporting and Analysis. GBC 2017, Yun Chon, Ph. D

Vaccine Safety Monitoring, Reporting and Analysis. GBC 2017, Yun Chon, Ph. D Vaccine Safety Monitoring, Reporting and Analysis GBC 2017, Yun Chon, Ph. D Disclaimer This presentation is based on my own opinion and is not representing the opinion of International Vaccine Institute.

More information

New generation typhoid conjugate vaccine for preventing typhoid disease TEAM BHARAT

New generation typhoid conjugate vaccine for preventing typhoid disease TEAM BHARAT (Typhoid Vi Capsular Polysaccharide-Tetanus Toxoid Conjugate Vaccine) New generation typhoid conjugate vaccine for preventing typhoid disease TEAM BHARAT Introduction This disease is common in many developing

More information

Clinical Evaluation Phases 1,2,3,4

Clinical Evaluation Phases 1,2,3,4 Clinical Evaluation Phases 1,2,3,4 Matt Laurens, MD MPH Associate Professor of Pediatrics Center for Vaccine Development Institute for Global Health University of Maryland School of Medicine February 1,

More information

Development of Vaxfectin -formulated HSV-2 Plasmid DNA Vaccines for Prophylactic and Therapeutic Applications

Development of Vaxfectin -formulated HSV-2 Plasmid DNA Vaccines for Prophylactic and Therapeutic Applications Development of Vaxfectin -formulated HSV-2 Plasmid DNA Vaccines for Prophylactic and Therapeutic Applications Sean M. Sullivan, Ph.D. Executive Director Pharmaceutical Sciences 14 July 2011 - DNA Vaccines

More information

Disclosure. Hemophilia: The Royal Treatment. Objectives. Background. History of Hemophilia. Epidemiology 1/4/2018

Disclosure. Hemophilia: The Royal Treatment. Objectives. Background. History of Hemophilia. Epidemiology 1/4/2018 Disclosure Hemophilia: The Royal Treatment Nikki Heeren, PharmD PGY1 Resident Avera McKennan Hospital I have had no financial relationship over the past 12 months with any commercial sponsor with a vested

More information

First Results of the Phase 3 Randomized, Placebo-Controlled ZOE-HSCT Clinical Trial

First Results of the Phase 3 Randomized, Placebo-Controlled ZOE-HSCT Clinical Trial Efficacy and Safety of an Adjuvanted Herpes Zoster Subunit Vaccine in Autologous Hematopoietic Stem Cell Transplant Recipients 18 Years of Age or Older First Results of the Phase 3 Randomized, Placebo-Controlled

More information

Genentech Contacts: Media: Tara Cooper (650) Investor: Kathee Littrell (650)

Genentech Contacts: Media: Tara Cooper (650) Investor: Kathee Littrell (650) NEWS RELEASE Genentech Contacts: Media: Tara Cooper (650) 225-5505 Investor: Kathee Littrell (650) 225-1034 XOMA Media/Investor Contacts: Laura Zobkiw (510) 204-7273 Peter Davis (510) 204-7231 FDA APPROVES

More information

J.P. Morgan 36 th Annual Healthcare Conference. January 10, 2018

J.P. Morgan 36 th Annual Healthcare Conference. January 10, 2018 J.P. Morgan 36 th Annual Healthcare Conference January 10, 2018 Forward Looking Statements BioCryst s presentation may contain forward looking statements, including statements regarding future results,

More information

Results to be Presented at LDN WORLD Symposium in February Initiation of Repeat-Dose Pompe Study Anticipated in 3Q13

Results to be Presented at LDN WORLD Symposium in February Initiation of Repeat-Dose Pompe Study Anticipated in 3Q13 Amicus Therapeutics Announces Positive Results from All Four Cohorts in Phase 2 Chaperone-Enzyme Replacement Therapy (ERT) Co-Administration Study for Pompe Disease Strong Proof-of-Concept Data for Chaperone

More information

Sabin-IPV development, clinical trials & optimization

Sabin-IPV development, clinical trials & optimization Sabin-IPV development, clinical trials & optimization Wilfried Bakker 11 th WHO/UNICEF consultation with OPV/IPV manufacturers Contents Sabin-IPV type 2 immunogenicity Clinical Trials Optimizations update

More information

Field trial with veterinary vaccine

Field trial with veterinary vaccine ١ Field trial with veterinary vaccine Saeedeh Forghani,, M.D. Clinical Trial and Ethics Department Human Health Management Deputy of Quality Assurance 89/4/2 ٢ ٣ Introduction: The efficacy and safety shall

More information

Individual-Based Correlates of Protection

Individual-Based Correlates of Protection Module 8 Evaluating Immunological Correlates of Protection Session 3 Evaluating Correlates of Protection Using Individual, Population, and Titer-specific Approaches Ivan S.F. Chan, Ph.D. Merck Research

More information

Sponsor. Generic Drug Name. Trial Indication(s) Protocol Number. Protocol Title. Clinical Trial Phase. Study Start/End Dates

Sponsor. Generic Drug Name. Trial Indication(s) Protocol Number. Protocol Title. Clinical Trial Phase. Study Start/End Dates Sponsor Sandoz GmbH Generic Drug Name Filgrastim Trial Indication(s) Neutropenia in breast cancer patients on myelosuppressive chemotherapy Protocol Number EP06-302 Protocol Title A randomized, double-blind,

More information

EU Regulatory Perspective on RSV vaccines

EU Regulatory Perspective on RSV vaccines EU Regulatory Perspective on RSV vaccines EU Perspective No RSV-specific guideline in the EU There is no established EU (i.e. CHMP) position CHMP scientific advice has been given, which reflects current

More information

Immunogenicity of Therapeutic Proteins. Steven J Swanson, Ph.D. Executive Director, Clinical Immunology

Immunogenicity of Therapeutic Proteins. Steven J Swanson, Ph.D. Executive Director, Clinical Immunology Immunogenicity of Therapeutic Proteins Steven J Swanson, Ph.D. Executive Director, Clinical Immunology swanson@amgen.com Causes of Immunogenicity Sequence differences between therapeutic protein and endogenous

More information

ASSESSING THE EFFICACY AND SAFETY OF NORMAL INTRAVENOUS IMMUNOGLOBULIN PRODUCTS FOR MARKETING AUTHORISATIONS

ASSESSING THE EFFICACY AND SAFETY OF NORMAL INTRAVENOUS IMMUNOGLOBULIN PRODUCTS FOR MARKETING AUTHORISATIONS ASSESSING THE EFFICACY AND SAFETY OF NORMAL INTRAVENOUS IMMUNOGLOBULIN PRODUCTS FOR MARKETING AUTHORISATIONS Guideline Title Assessing the Efficacy and Safety of Normal Intravenous Immunoglobulin Products

More information

Antibody against Chikungunya virus (mrna-1944)

Antibody against Chikungunya virus (mrna-1944) Antibody against Chikungunya virus (mrna-1944) Modality Program # Program Indication Preclinical development Phase 1 Phase 2 Phase 3 and commercial Moderna rights mrna-1944 Antibody against Chikungunya

More information

Policy Position. Pharmacy-mediated interchangeability for Similar Biotherapeutic Products (SBPs)

Policy Position. Pharmacy-mediated interchangeability for Similar Biotherapeutic Products (SBPs) Pharmacy-mediated interchangeability for Similar Biotherapeutic Products (SBPs) Geneva, April 2016 Appropriate use of biotherapeutics including SBPs - SBPs, also known as biosimilars, are developed to

More information

Preclinical study. Assist.Prof. Witthawat Wiriyarat Faculty of Veterinary Science, Mahidol University

Preclinical study. Assist.Prof. Witthawat Wiriyarat Faculty of Veterinary Science, Mahidol University Preclinical study Assist.Prof. Witthawat Wiriyarat Faculty of Veterinary Science, Mahidol University Overviews Principle of animal use Biological activity/pharmacodynamics Animal species and model selection

More information

SYNOPSIS. Clinical Study Report for Study CV Individual Study Table Referring to the Dossier

SYNOPSIS. Clinical Study Report for Study CV Individual Study Table Referring to the Dossier Name of Sponsor/Company: Bristol-Myers Squibb Name of Finished Product: Individual Study Table Referring to the Dossier (For National Authority Use Only) Name of Active Ingredient: SYNOPSIS Clinical Study

More information

Brain Tumour Australia Information FACT SHEET 22 Clinical Trials: Questions and Answers

Brain Tumour Australia Information FACT SHEET 22 Clinical Trials: Questions and Answers FACT SHEET 22 Clinical Trials: Questions and Answers What is a clinical trial? Clinical trials are research studies that answer scientific questions and try to find better ways to prevent, screen for,

More information

Bringing True Novelty to the Anti-Infective Space

Bringing True Novelty to the Anti-Infective Space Bringing True Novelty to the Anti-Infective Space New Class of Antibacterials Based on a Unique Mechanism of Action Dr Dawn Firmin SMi s 17 th Annual Conference on Superbugs & Superdrugs March 2015 1 Contents

More information

Affimed Presents Data from Phase 1b Combination Study of AFM13 with Pembrolizumab at ASH

Affimed Presents Data from Phase 1b Combination Study of AFM13 with Pembrolizumab at ASH FOR IMMEDIATE RELEASE Affimed Presents Data from Phase 1b Combination Study of AFM13 with Pembrolizumab at ASH Completed dose-escalation shows combination of AFM13 and pembrolizumab is well-tolerated;

More information

ICH Considerations. Oncolytic Viruses September 17, 2009

ICH Considerations. Oncolytic Viruses September 17, 2009 INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH Considerations Oncolytic Viruses September 17, 2009 1. Introduction Oncolytic viruses

More information

Next-Gen Cholera Vaccines

Next-Gen Cholera Vaccines Next-Gen Cholera Vaccines GTFCC OCV Working Group Meeting Sourabh Sobti December 5-6 th 2018, Annecy, France 1 HILLCHOL IS AN INNOVATIVE VACCINE WITH STREAMLINED MANUFACTURING PROCESS PROBLEM STATEMENT

More information

Innovative Clinical Development Solutions

Innovative Clinical Development Solutions Innovative Clinical Development Solutions From Protocol to Package Insert: A Data Journey AMWA Medical Writing & Communication Conference Thursday, November 1, 2018 Introductions Alex Rohall Senior Manager,

More information

CD33-Targeting ADCs in AML

CD33-Targeting ADCs in AML Maturing Clinical Profile of IMGN779, a Next- Generation CD33-Targeting Antibody-Drug Conjugate, in Patients with Relapsed or Refractory Acute Myeloid Leukemia Jorge E. Cortes 1, Daniel J. DeAngelo 2,

More information

In vivo Evaluation of Lassa virus Therapeutics. David Safronetz, Ph.D Public Health Agency of Canada

In vivo Evaluation of Lassa virus Therapeutics. David Safronetz, Ph.D Public Health Agency of Canada In vivo Evaluation of Lassa virus Therapeutics David Safronetz, Ph.D Public Health Agency of Canada Outline: Caveats Ribavirin Favipiravir or Ribavirin Favipiravir plus Ribavirin Antibody Treatments Promising

More information

12-Month Interim Analysis of APOE4 Carriers for Fixed and Titration Dosing Regimens in PRIME, a Phase 1b study of Aducanumab

12-Month Interim Analysis of APOE4 Carriers for Fixed and Titration Dosing Regimens in PRIME, a Phase 1b study of Aducanumab 12-Month Interim Analysis of APOE4 Carriers for Fixed and Titration Dosing Regimens in PRIME, a Phase 1b study of Aducanumab Vissia Viglietta, 1 John O Gorman, 1 Leslie Williams, 1 Tianle Chen, 1 Ahmed

More information

Annex 5 Recommendations for diphtheria, tetanus, pertussis and combined vaccines (Amendments 2003)

Annex 5 Recommendations for diphtheria, tetanus, pertussis and combined vaccines (Amendments 2003) World Health Organization WHO Technical Report Series, No. 927, 2005 Annex 5 Recommendations for diphtheria, tetanus, pertussis and combined vaccines (Amendments 2003) Introduction These amendments should

More information

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing

More information

1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing

More information

FDA Statistical Review and Evaluation. September 22, 2004

FDA Statistical Review and Evaluation. September 22, 2004 FDA Statistical Review and Evaluation Document for the Vaccines and Related Biological Products Advisory Committee (VRBPAC) September 22, 2004 Menactra, Meningococcal (Groups A, C, Y, and W135) Polysaccharide

More information

CLINICAL STUDY REPORT SYNOPSIS

CLINICAL STUDY REPORT SYNOPSIS CLINICAL STUDY REPORT SYNOPSIS Document No.: EDMS-PSDB-7385407:2.0 Name of Sponsor/Company Grünenthal GmbH/Johnson & Johnson Pharmaceutical Research & Development, L.L.C. Name of Finished Product Name

More information

Stealth BioTherapeutics Mission:

Stealth BioTherapeutics Mission: The following is a summary of a live presentation offered through joint collaboration with UMDF, MitoAction and the Foundation for Mitochondrial Medicine to the mitochondrial disease patient and family

More information

CONTRACTING ORGANIZATION: Albert Einstein College of Medicine Bronx, NY 10461

CONTRACTING ORGANIZATION: Albert Einstein College of Medicine Bronx, NY 10461 AD Award Number: W81XWH-08-1-0011 TITLE: Defining B. Anthracis Protective Antigen Antigenic Domains PRINCIPAL INVESTIGATOR: Arturo Casadevall, M.D., Ph.D. CONTRACTING ORGANIZATION: Albert Einstein College

More information

ClinicalTrials.gov Protocol Registration and Results System (PRS) Receipt Release Date: 08/04/2013. ClinicalTrials.gov ID: NCT

ClinicalTrials.gov Protocol Registration and Results System (PRS) Receipt Release Date: 08/04/2013. ClinicalTrials.gov ID: NCT ClinicalTrials.gov Protocol Registration and Results System (PRS) Receipt Release Date: 08/04/2013 ClinicalTrials.gov ID: NCT01237340 Study Identification Unique Protocol ID: EMR 701048-009 Brief Title:

More information

WHO-MSD Collaboration to Bring an Ebola Vaccine to the Populations in Need

WHO-MSD Collaboration to Bring an Ebola Vaccine to the Populations in Need WHO-MSD Collaboration to Bring an Ebola Vaccine to the Populations in Need Jules Millogo, MD, MSc Director, Public Health Partnerships Merck & Co, Inc. North Wales, PA, USA V920: rvsvδg-zebov-gp Vaccine

More information

Caplacizumab. Wholly-owned anti-vwf Nanobody

Caplacizumab. Wholly-owned anti-vwf Nanobody 1 Caplacizumab Wholly-owned anti-vwf Nanobody First-in-class bivalent Nanobody with Orphan Drug Status and patent protection up to 2035 Developed for the treatment of acquired thrombotic thrombocytopenic

More information

Clinical Study Synopsis

Clinical Study Synopsis Clinical Study Synopsis This document is not intended to replace the advice of a healthcare professional and should not be considered as a recommendation. Patients should always seek medical advice before

More information

Small-Cap Research. ContraFect Corp. (CFRX-NASDAQ) CFRX: CF-301 Phase 1 Results Presented at ECCMID Conference UPDATE SUMMARY DATA ZACKS ESTIMATES

Small-Cap Research. ContraFect Corp. (CFRX-NASDAQ) CFRX: CF-301 Phase 1 Results Presented at ECCMID Conference UPDATE SUMMARY DATA ZACKS ESTIMATES Small-Cap Research April 12, 2016 David Bautz, PhD 312-265-9471 dbautz@zacks.com scr.zacks.com 10 S. Riverside Plaza, Chicago, IL 60606 ContraFect Corp. (CFRX-NASDAQ) CFRX: CF-301 Phase 1 Results Presented

More information

Published 07 February 2011 Page January 2011

Published 07 February 2011 Page January 2011 filgrastim 12 million units (120microgram) / 0.2mL, 30 million units (300microgram) / 0.5mL, 48 million units (480microgram) / 0.5mL solution for injection/infusion in pre-filled syringe (Nivestim) SMC

More information

Introducing MN-166 Multiple Sclerosis. July 9, 2008

Introducing MN-166 Multiple Sclerosis. July 9, 2008 Introducing MN-166 A New Treatment Paradigm for Multiple Sclerosis July 9, 2008 MediciNova, Inc. 2008 Forward-Looking Statements Statements in this presentation that are not historical in nature constitute

More information

Praxbind. (idarucizumab) New Product Slideshow

Praxbind. (idarucizumab) New Product Slideshow Praxbind (idarucizumab) New Product Slideshow Introduction Brand name: Praxbind Generic name: Idarucizumab Pharmacological class: Humanized monoclonal antibody fragment Strength and Formulation: 2.5g/50mL;

More information

Value Assessment: Building Payercentric value propositions to inform decision-making

Value Assessment: Building Payercentric value propositions to inform decision-making Value Assessment: Building Payercentric value propositions to inform decision-making Aris Angelis and Panos Kanavos Medical Technology Research Group, LSE Health Advance-HTA dissemination workshop, Santiago,

More information

Heparin Induced Thrombocytopenia. Heparin Induced Thrombocytopenia. Heparin Induced Thrombocytopenia. Temporal Aspects.

Heparin Induced Thrombocytopenia. Heparin Induced Thrombocytopenia. Heparin Induced Thrombocytopenia. Temporal Aspects. Heparin Induced Eric Kraut, MD Professor of Internal Medicine The Ohio State University Medical Center Heparin Induced Heparin induced thrombocytopenia occurs in up to 5 % of patients receiving unfractionated

More information

Synthetic Biologics Reports Year End 2012 Financial Results

Synthetic Biologics Reports Year End 2012 Financial Results April 16, 2013 Synthetic Biologics Reports Year End 2012 Financial Results -- Strengthening Infectious Disease Portfolio to Include C. difficile, Pertussis and Acinetobacter Targets -- ROCKVILLE, Md.,

More information

WHO vaccine standardization: an update

WHO vaccine standardization: an update PDVAC WHO vaccine standardization: an update Dr, WHO/HIS/EMP/TSN/NSB 10 th June 2016 Geneva Outline Standardization and regulatory evaluation of vaccines and biotherapeutic products Development of measurement

More information

IMMUNOLOGY Receptors of T cells are TCR T Cell Receptors which are present on the cell surface of T lymphocytes.

IMMUNOLOGY Receptors of T cells are TCR T Cell Receptors which are present on the cell surface of T lymphocytes. IMMUNOLOGY - 4 - What is an ANTIGEN? It is a molecule that can be recognized by a receptor and combine with it specifically and the receptor here is the one either produced by B cells or T cells: Receptors

More information

CHALLENGES AND SOLUTIONS TO RECEPTOR OCCUPANCY STUDIES BY FLOW CYTOMETRY

CHALLENGES AND SOLUTIONS TO RECEPTOR OCCUPANCY STUDIES BY FLOW CYTOMETRY CHALLENGES AND SOLUTIONS TO RECEPTOR OCCUPANCY STUDIES BY FLOW CYTOMETRY 4th RSC / DMDG / DMG New Perspectives in DMPK James Munday Science Lead I&I (Harrogate, UK) 21 st -22nd May 2018 Copyright 2018

More information

ICH CONSIDERATIONS Oncolytic Viruses

ICH CONSIDERATIONS Oncolytic Viruses European Medicines Agency Pre-authorisation Evaluation of Medicines for Human Use 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 ICH CONSIDERATIONS Oncolytic Viruses 20 November 2008 EMEA/CHMP/GTWP/607698/2008

More information

Ebola Facts. October 14, 2014

Ebola Facts. October 14, 2014 Ebola Facts October 14, 2014 Symptoms of Ebola Initial symptoms are nonspecific - may include fever, chills, myalgias, and malaise. Patients can progress to develop gastrointestinal symptoms: severe watery

More information

GHIT の活動から新薬開発へのファンディングを考える. BT Slingsby, CEO, GHIT Fund

GHIT の活動から新薬開発へのファンディングを考える. BT Slingsby, CEO, GHIT Fund GHIT の活動から新薬開発へのファンディングを考える BT Slingsby, CEO, GHIT Fund Anti-Infectives Over 100 Years Development of antibacterial agents in Japan 八木澤守正 : 抗菌薬を概観する : 過去, 現在, そしてこれから 日化療会誌 2016 60: 149-167 舘田一博 : 抗菌薬開発停滞の打破へ向けて

More information

Primer Sequence b Amino acids a. agccatgggtttaatatctaaagaagagttaataaaactcgcatatagc. ccggatccacttaatctagcaaattcgcttgtgttgaattcatctttacc

Primer Sequence b Amino acids a. agccatgggtttaatatctaaagaagagttaataaaactcgcatatagc. ccggatccacttaatctagcaaattcgcttgtgttgaattcatctttacc Table S1. Oligonucleotides used for cloning toxin domains of C. difficile VPI10463 Toxin and fragment Primer Sequence b Amino acids a Toxin A fragment 1 TxAfrag1Fw TxAfrag1Rv agccatgggtttaatatctaaagaagagttaataaaactcgcatatagc

More information

GEN-003. Positive Phase 2b Clinical Efficacy Results. Immunotherapy Candidate for Genital Herpes. 12-Month Top-line Results

GEN-003. Positive Phase 2b Clinical Efficacy Results. Immunotherapy Candidate for Genital Herpes. 12-Month Top-line Results GEN-003 Positive Phase 2b Clinical Efficacy Results Immunotherapy Candidate for Genital Herpes 12-Month Top-line Results Disclaimer This presentation contains forward-looking statements that are within

More information

A regulatory update on the EU guideline on First-in-Human clinical trials

A regulatory update on the EU guideline on First-in-Human clinical trials A regulatory update on the EU guideline on First-in-Human clinical trials Thomas Sudhop, BfArM, Bonn Thomas Sudhop A regulatory update on the EU guideline on First-in-Human clinical trials 17 May 2017

More information

Efficacy trials of Lassa Therapeutics: endpoints, trial design, site selection

Efficacy trials of Lassa Therapeutics: endpoints, trial design, site selection Efficacy trials of Lassa Therapeutics: endpoints, trial design, site selection WHO Workshop Final Report April 25, 2018 INSERM, Paris, France Table of contents TABLE OF CONTENTS 1 1. INTRODUCTION 2 2.

More information

Adverse Event Reporting: During the Study

Adverse Event Reporting: During the Study Vol. 5, No. 8, August 2009 Can You Handle the Truth? Adverse Event Reporting: During the Study By S. Eric Ceh The reporting of adverse events (AEs) is a standard task for investigative sites involved in

More information

The Science of Drug Discovery: The Intersection of Clinical Trials and Drug Development. Rich Whitley March 2, 2017

The Science of Drug Discovery: The Intersection of Clinical Trials and Drug Development. Rich Whitley March 2, 2017 The Science of Drug Discovery: The Intersection of Clinical Trials and Drug Development Rich Whitley March 2, 2017 The Many Faces of Clinical Research n Natural History Study n The impact of congenital

More information

2018 ECTRIMS Data Review Call. October 2018

2018 ECTRIMS Data Review Call. October 2018 2018 ECTRIMS Data Review Call October 2018 TG Therapeutics Michael S. Weiss, CEO Forward Looking Safe Harbor Statement This presentation contains forward-looking statements within the meaning of the Private

More information

The Dengue Vaccine Landscape. In-Kyu Yoon, M.D. Director, Dengue Vaccine Initiative International Vaccine Institute Seoul, Korea

The Dengue Vaccine Landscape. In-Kyu Yoon, M.D. Director, Dengue Vaccine Initiative International Vaccine Institute Seoul, Korea The Dengue Vaccine Landscape In-Kyu Yoon, M.D. Director, Dengue Vaccine Initiative International Vaccine Institute Seoul, Korea 1 Dec 2015 Dengue Vaccine Initiative (DVI) John Hopkins University School

More information

Alexion to Acquire Syntimmune Conference Call September 26, 2018

Alexion to Acquire Syntimmune Conference Call September 26, 2018 Alexion to Acquire Syntimmune Conference Call September 26, 2018 Alexion to Acquire Syntimmune Introduction Susan Altschuller, Ph.D., Investor Relations Summary & Strategic Rationale Ludwig Hantson, Ph.D.,

More information

Development of plasma therapies for emerging infectious diseases. Dr Glenn Smith Biological Science Section Scientific Evaluation Branch

Development of plasma therapies for emerging infectious diseases. Dr Glenn Smith Biological Science Section Scientific Evaluation Branch Development of plasma therapies for emerging infectious diseases Dr Glenn Smith Biological Science Section Scientific Evaluation Branch June 2017 Therapeutic Goods Administration (TGA) A part of the Australian

More information

Accelerated Ebola Vaccine Development: Phase 1-2

Accelerated Ebola Vaccine Development: Phase 1-2 15 April 2015 Vasee Moorthy MRCP PhD Accelerated Ebola Vaccine Development: Phase 1-2 WHO calls for accelerated ebola vaccine development We call on the international vaccine community to accelerate development

More information

A GUIDE TO THIS REFLECTIONS B RESEARCH STUDY IF YOU RE FIGHTING BREAST CANCER, YOU RE NOT ALONE

A GUIDE TO THIS REFLECTIONS B RESEARCH STUDY IF YOU RE FIGHTING BREAST CANCER, YOU RE NOT ALONE A GUIDE TO THIS REFLECTIONS B327-02 RESEARCH STUDY IF YOU RE FIGHTING BREAST CANCER, YOU RE NOT ALONE Do you have breast cancer that has spread to outside the breast? Has your tumor tested positive for

More information

January (San Francisco, CA) January 8, 2018

January (San Francisco, CA) January 8, 2018 January 2017 J.P. Morgan 36 th Annual Management Healthcare Presentation Conference (San Francisco, CA) January 8, 2018 DISCLAIMER Certain information contained in this presentation relates to or is based

More information

Preclinical Development of Biologics: Case-by-case, so get off of my case!

Preclinical Development of Biologics: Case-by-case, so get off of my case! Preclinical Development of Biologics: Case-by-case, so get off of my case! Northeast Chapter SOT David Jacobson-Kram, Ph.D., DABT Office of New Drugs Center for Drug Evaluation and Research FDA October

More information

Actelion Pharmaceuticals Ltd. Gewerbestrasse 16 Allschwil 4123 Switzerland

Actelion Pharmaceuticals Ltd. Gewerbestrasse 16 Allschwil 4123 Switzerland Trial information Subject disposition Subject analysis sets Baseline characteristics End points Adverse events More information TRIAL INFORMATION Trial identification Eudract number Sponsor protocol code

More information

CADTH CANADIAN DRUG EXPERT COMMITTEE FINAL RECOMMENDATION

CADTH CANADIAN DRUG EXPERT COMMITTEE FINAL RECOMMENDATION CADTH CANADIAN DRUG EXPERT COMMITTEE FINAL RECOMMENDATION FILGRASTIM (Grastofil Apotex Inc.) Indications: Prevention or Treatment of Neutropenia Recommendation: The CADTH Canadian Drug Expert Committee

More information

Total urinary GAGs declined by 51%, dermatan sulfate by 32%, and heparan sulfate by 61% in Cohort 2 at 16 weeks

Total urinary GAGs declined by 51%, dermatan sulfate by 32%, and heparan sulfate by 61% in Cohort 2 at 16 weeks September 5, 2018 Sangamo Announces 16 Week Clinical Results Including Reductions In Glycosaminoglycans In Phase 1/2 Trial Evaluating SB-913, A Zinc Finger Nuclease Genome Editing Treatment For MPS II

More information

VACCINE DELIVERY USING THE NEMAURA SOLID DOSE INJECTOR

VACCINE DELIVERY USING THE NEMAURA SOLID DOSE INJECTOR VACCINE DELIVERY USING THE NEMAURA SOLID DOSE INJECTOR In this article, Joanne Broadhead, PhD, Product Development, Nemaura Pharma; and Karmen Cheung, MSc, Department of Chemical Engineering, Loughborough

More information

DMC member experience: studies with adaptive designs. P.Bauer Medical University of Vienna December 2007

DMC member experience: studies with adaptive designs. P.Bauer Medical University of Vienna December 2007 DMC member experience: studies with adaptive designs P.Bauer Medical University of Vienna December 2007 A typical application: Dose selection and confirmative inference (the critical issue of combining

More information

Use of Heparin and The Related Incidence of Heparin- Induced Thrombocytopenia in an Education and Research Hospital in Turkey

Use of Heparin and The Related Incidence of Heparin- Induced Thrombocytopenia in an Education and Research Hospital in Turkey VOLUME 8 NUMBER 3 September 2017 JOURNAL OF CLINICAL AND EXPERIMENTAL INVESTIGATIONS ORIGINAL ARTICLE Use of Heparin and The Related Incidence of Heparin- Induced Thrombocytopenia in an Education and Research

More information

Safety and Efficacy of Daratumumab with Lenalidomide and Dexamethasone in Relapsed, or Relapsed and Refractory Multiple Myeloma

Safety and Efficacy of Daratumumab with Lenalidomide and Dexamethasone in Relapsed, or Relapsed and Refractory Multiple Myeloma Safety and Efficacy of Daratumumab with Lenalidomide and Dexamethasone in Relapsed, or Relapsed and Refractory Multiple Myeloma Torben Plesner 1, Hendrik-Tobias Arkenau 2, Henk M Lokhorst 3, Peter Gimsing

More information

WHO Blood Regulators Network (BRN)

WHO Blood Regulators Network (BRN) Distribution: General English only WHO Blood Regulators Network (BRN) Position Paper on Use of Convalescent Plasma, Serum or Immune Globulin Concentrates as an Element in Response to an Emerging Virus*

More information

Drug Utilization Review: Palivizumab (Synagis ; Medimmune)

Drug Utilization Review: Palivizumab (Synagis ; Medimmune) Background Respiratory syncitial virus (RSV) is a highly contagious virus that is estimated to infect nearly all children by 3 years of age, and is the leading cause of serious lower respiratory tract

More information

Q3 Analysts Presentation. November 5, 2013

Q3 Analysts Presentation. November 5, 2013 Q3 Analysts Presentation November 5, 2013 Disclaimer Forward Looking Statements These materials contain certain forward-looking statements relating to the business of Valneva SE (the Company ), including

More information

ICH S9 guideline on nonclinical evaluation for anticancer pharmaceuticals - questions and answers

ICH S9 guideline on nonclinical evaluation for anticancer pharmaceuticals - questions and answers 16 May 2018 EMA/CHMP/ICH/453684/2016 Committee for Human Medicinal Products ICH S9 guideline on nonclinical evaluation for anticancer pharmaceuticals - questions and answers Step 5 Transmission to CHMP

More information

FDA Perspective on the Preclinical Evaluation of Biological Therapies for Cancer

FDA Perspective on the Preclinical Evaluation of Biological Therapies for Cancer FDA Perspective on the Preclinical Evaluation of Biological Therapies for Cancer Yongjie Zhou, M.D., Ph.D. FDA/CBER/OCTGT/DCEPT Yongjie.zhou@fda.hhs.gov isbtc Global Regulatory Summit October 29, 2008

More information