Supplemental Online Material

Size: px
Start display at page:

Download "Supplemental Online Material"

Transcription

1 Supplemental Online Material Supplemental Figures Supplemental Figure 1. A) Crosslinking efficiencies of 5 -biotin tagged oligonucleotides screened with the FASTDXL method 1. Reactive and nonreactive cysteine positions are shown as large magenta or small yellow spheres, respectively. The sequence of the archetypal screening oligonucleotide is shown above the protein in register with the nucleic acid as it appears in the structure. Individually modified nucleic acid crosslinking positions are shown in orange. The portion of the FASTDXL screening 1 / 10

2 oligonucleotide translated into crystal trials is capitalized. B) Initial 2mF o -df c (1σ, blue) and mf o -df c (2.5σ, green) maps of the Asn232Cys complex. Maps were calculated after one round of positional and ADP refinement with Refmac 3, using an apo model of the RPD (purple) as a starting point. Superposition of the refined Arg320Cys/ssDNA complex (yellow) upon the Asn232Cys model illustrates that the template binding groove accommodates a similar conformation of nucleic acid within both crystal forms. Severely anisotropic diffraction precluded the generation of a fully refined model, but attempts to model this density with nucleic acid in the opposite orientation (3-5 towards the active site) were unsuccessful. 2 / 10

3 Supplemental Figure 2. 1 H- 15 N HSQC spectrum of the apo wildtype E. coli DnaG RNA Polymerase Domain colored per Figure 3 of the main text. 3 / 10

4 Supplemental Figure 3. 1 H- 15 N HSQC spectrum of the wildtype E. coli DnaG RNA Polymerase Domain with 300 µm ssdna colored per Figure 3 of the main text. 4 / 10

5 Supplemental Figure 4. 1 H- 15 N HSQC spectrum of the wildtype E. coli DnaG RNA Polymerase Domain with 600 µm ssdna colored per Figure 3 of the main text. 5 / 10

6 Supplemental Figure 5. Establishment of statistical equilibrium in alignments and criterion for selection of perturbations 4. A) The mean ΔE stat between five unconserved sites (alignment positions 170, 173, 195, 198, and 400) in a nonredundant multiple sequence alignment of 210 bacterial primases is relatively insensitive to the elimination of a large fraction of the sequences. B) The ΔΔE stat between the same five unconserved sites exhibits low coupling energies with even relatively small subalignments. The minimal subalignment was chosen to be 80 sequences, based on a threshold of kt. 6 / 10

7 Supplemental Methods FASTDXL screening for stable protein-dna complexes. We have recently reported details of this methods elsewhere 1. Briefly, 5 -biotin-tagged oligonucleotides containing a single O6-phenyl-dI modification were purchased from Operon and derivatized by reaction with 1 M cystamine for 18 hours at 68 C. Cysteine point mutations were introduced into the E. coli DnaG RNA Polymerase Domain (residues ) using the QuikChange method. Stable protein-dna complexes were identified by mixing pools of cysteine mutants with cystamine-derivatized oligonucleotides. Successfully crosslinked mutant/oligonucleotide combinations were identified by MALDI/TOF and MS/MS. Several different DnaG/ssDNA combinations crosslinked particularly efficiently (Supplemental Fig. 1A) and were individually scaled up and moved to crystal trials 1. Preparation of protein-dna complexes. The E. coli DnaG RNA Polymerase Domain was cloned into the psv271 vector 2 and expressed as an N-terminal TEV-cleavable His 6 fusion in BL21(DE3) codon+ cells by inducing for 8 hours with 0.5 mm IPTG at a cell density of 0.5 at 600 nm. Following sonication and centrifugation, the crude cell lysate was passed over a Hi-Trap MC-Ni column (Amersham) in Buffer A (0.5 M NaCl, 20 mm HEPES, 10% glycerol (v/v)) with 10 mm imidazole, and bound protein eluted in a single step with Buffer A M imidazole. The His 6 tag was removed by overnight incubation at 4 C with His-tagged TEV protease, and further impurities removed by passing the solution over a second nickel column and collecting the flowthrough. A Sephacryl S-200 gel filtration column (Amersham) equilibrated in Buffer A was used as a 7 / 10

8 final step to remove aggregated protein. The protein/dna complex was formed by mixing each polymerase domain mutant with the thiolated nucleic acid at a 2:1 molar ratio as described 1, and allowing them to crosslink for 48 hours at 4 C. Stable complexes were separated from free protein using a Hi Trap Q column (Amersham) in a gradient of Buffer A from mm NaCl, and free nucleic acid was removed with a final S-200 gel filtration column. 8 / 10

9 Supplemental Movie 1. Interpolated ssdna tracking via the basic groove. The protein cores of each complex in the asymmetric unit of the Arg320Cys crystal form were superposed and linear interpolation was performed over thirty steps 5,6. 9 / 10

10 References 1. Corn, J.E. & Berger, J.M. FASTDXL: a generalized screen to trap disulfidestabilized complexes for use in structural studies. Structure 15, (2007). 2. Corn, J.E., Pease, P.J., Hura, G.L. & Berger, J.M. Crosstalk between primase subunits can act to regulate primer synthesis in trans. Mol Cell 20, (2005). 3. Murshudov, G.N., Vagin, A.A. & Dodson, E.J. Refinement of macromolecular structures by the maximum-likelihood method. Acta Cryst D 53, (1997). 4. Shulman, A.I., Larson, C., Mangelsdorf, D.J. & Ranganathan, R. Structural determinants of allosteric ligand activation in RXR heterodimers. Cell 116, (2004). 5. Flores, S. et al. The Database of Macromolecular Motions: new features added at the decade mark. Nucleic Acids Res 34, D (2006). 6. Krebs, W.G. & Gerstein, M. The morph server: a standardized system for analyzing and visualizing macromolecular motions in a database framework. Nucleic Acids Res 28, (2000). 10 / 10

nature methods Enabling IMAC purification of low abundance recombinant proteins from E. coli lysates

nature methods Enabling IMAC purification of low abundance recombinant proteins from E. coli lysates nature methods Enabling IMAC purification of low abundance recombinant proteins from E. coli lysates Audur Magnusdottir, Ida Johansson, Lars-Göran Dahlgren, Pär Nordlund & Helena Berglund Supplementary

More information

Structural bases for N-glycan processing by mannosidephosphorylase

Structural bases for N-glycan processing by mannosidephosphorylase Supporting information Volume 71 (2015) Supporting information for article: Structural bases for N-glycan processing by mannosidephosphorylase Simon Ladevèze, Gianluca Cioci, Pierre Roblin, Lionel Mourey,

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION SUPPLEMENTAL DATA Table S1: Related to Figure 4. DnaA screen for divalent cations and nucleotides. Concentration of reagents, T m and F fold30 75. Reagent Conc T m (±SEM) mm C

More information

Protocol for in vitro transcription

Protocol for in vitro transcription Protocol for in vitro transcription Assemble the reaction at room temperature in the following order: Component 10xTranscription Buffer rntp T7 RNA Polymerase Mix grna PCR DEPC H 2 O volume 2μl 2μl 2μl

More information

Evaluation of Cu(I) Binding to the E2 Domain of the Amyloid. Precursor Protein A Lesson in Quantification of Metal Binding to

Evaluation of Cu(I) Binding to the E2 Domain of the Amyloid. Precursor Protein A Lesson in Quantification of Metal Binding to Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 2017 Evaluation of Cu(I) Binding to the E2 Domain of the Amyloid Precursor Protein A Lesson in Quantification

More information

SUPPLEMENTARY METHODS Peptides HPLC purified peptides from GL Biochem (Shanghai, China): mthsp75-k332, RYTLHY(acetyl-K)TDAPLN; PDH-K81, KADQLY(acetyl-K)QKFIRG; NADH-DH-K243, IENAYK(acetyl-K)TFLPE; ANPtransloc2-K268,

More information

OPPF-UK Standard Protocols: Insect Cell Purification

OPPF-UK Standard Protocols: Insect Cell Purification OPPF-UK Standard Protocols: Insect Cell Purification Last Updated 6 th October 2016 Joanne Nettleship joanne@strubi.ox.ac.uk OPPF-UK SOP: Insect Cell Purification Table of Contents Suggested Schedule...

More information

5.2 Protein purification

5.2 Protein purification Purification of a His 6 -tagged Green Fluorescent Protein (GFP). Protein purification.. Purification of a His 6 -tagged Green Fluorescent Protein (GFP) Principle You can add either a N- or C-terminal His

More information

pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M

pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described

More information

Supporting Information

Supporting Information Supporting Information Deng et al. 10.1073/pnas.1515692112 SI Materials and Methods FPLC. All fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20),

More information

Supplemental Materials and Methods:

Supplemental Materials and Methods: Supplemental Materials and Methods: Cloning: Oligonucleotides used in the subcloning steps are listed in Supplemental Table 1. Human FANCI (isoform 1, KIAA1794) was subcloned from pcmv6-xl4 [FANCI] in

More information

Lecture 8: Affinity Chromatography-III

Lecture 8: Affinity Chromatography-III Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The

More information

Supplemental Experimental Procedures

Supplemental Experimental Procedures Supplemental Experimental Procedures Cloning, expression and purification of untagged P C, Q D -N 0123, Q D- N 012 and Q D -N 01 - The DNA sequence encoding non tagged P C (starting at the Arginine 57

More information

Supporting Information

Supporting Information Supporting Information Slep et al. 10.1073/pnas.0801569105 SI Materials and Methods Mouse RGS16, residues 53 180, was subcloned into a modified pgex-2t vector (GE Healthcare) to yield a thrombin-cleavable

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany RNA ligands that distinguish metabolite-induced conformations in the TPP riboswitch Günter Mayer, Marie-Sophie L. Raddatz, Julia D. Grunwald,

More information

Supporting Information

Supporting Information Supporting Information Koh et al. 10.1073/pnas.1212917110 SI Materials and Methods Protein Purification. N-terminal His 6 -Dicer was purified as previously described with several modifications (1). After

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Text S1: EvoDesign profile construction Table S1 lists the pair-wise structural alignments generated by the TM-align program [1], between the XIAP scaffold protein (PDB ID: 2OPY)

More information

yellow protein turn off/on label (POOL) , Republic of Korea The PYP gene was subcloned in the pqe80l vector using EZ-Cloning (enzynomics ).

yellow protein turn off/on label (POOL) , Republic of Korea The PYP gene was subcloned in the pqe80l vector using EZ-Cloning (enzynomics ). Supporting Information High-throughput instant quantification of protein expression and purity based on photoactive yellow protein turn off/on label (POOL) Youngmin Kim 1,2, Prabhakar Ganesan 1,2 and Hyotcherl

More information

SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS

SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS SUPPLEMENTAL MATERIAL BIOCHEMICAL AND STRUCTURAL STUDIES ON THE M. TUBERCULOSIS O 6 -METHYLGUANINE METHYLTRANSFERASE AND MUTATED VARIANTS Riccardo Miggiano 1, Valentina Casazza 1, Silvia Garavaglia 1,

More information

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences 191PR 05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Glutathione Resin (Cat. # 786 280, 786 310, 786 311, 786 312) think proteins! think

More information

Six genes, Lsm1, Lsm2, Lsm3, Lsm5, Lsm6, and Lsm7, were amplified from the

Six genes, Lsm1, Lsm2, Lsm3, Lsm5, Lsm6, and Lsm7, were amplified from the Supplementary information, Data S1 Methods Clones and protein preparation Six genes, Lsm1, Lsm2, Lsm3, Lsm5, Lsm6, and Lsm7, were amplified from the Saccharomyces cerevisiae genomic DNA by polymerase chain

More information

Nickel-NTA Agarose Suspension

Nickel-NTA Agarose Suspension Nickel-NTA Agarose Suspension Agarose beads for purification of His-tagged proteins Product No. A9735 Description Nickel-NTA Agarose Suspension is an agarose-based affinity chromatography resin allowing

More information

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences 191PR-05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Glutathione Resin (Cat. # 786-280, 786-310, 786-311, 786-312) think proteins! think

More information

Nature Structural & Molecular Biology: doi: /nsmb.3428

Nature Structural & Molecular Biology: doi: /nsmb.3428 Supplementary Figure 1 Biochemical characterization of the monou and oligou activity switch of TUT4(7). (a) Mouse TUT4 and human TUT7 were assayed for monou and Lin28-dependent oligou addition activities

More information

Figure S2, related to Figure 1. Stereo images of the CarD/RNAP complex and. electrostatic potential surface representation of the CarD/RNAP interface

Figure S2, related to Figure 1. Stereo images of the CarD/RNAP complex and. electrostatic potential surface representation of the CarD/RNAP interface Structure, Volume 21 Supplemental Information Structure of the Mtb CarD/RNAP -Lobes Complex Reveals the Molecular Basis of Interaction and Presents a Distinct DNA-Binding Domain for Mtb CarD Gulcin Gulten

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Nickel NTA Agarose Cartridges 5ml are used for purification of histidine-tagged proteins in native or denaturing conditions. This cartridge can be used with an automated chromatography system,

More information

HEK293T. Fig. 1 in the

HEK293T. Fig. 1 in the Supplementary Information Supplementary Figure 1 Zinc uptake assay of hzip4 and hzip4-δecd transiently expressed in HEK293T cells. The results of one representative e experiment are shown in Fig. 1 in

More information

SUPPLEMENTARY INFORMATION. The nucleotide binding dynamics of MSH2/MSH3 are lesion-dependent.

SUPPLEMENTARY INFORMATION. The nucleotide binding dynamics of MSH2/MSH3 are lesion-dependent. SUPPLEMENTARY INFORMATION The nucleotide binding dynamics of /MSH are lesion-dependent. Barbara A. L. Owen, Walter H. Lang, and Cynthia T. McMurray* mau 1 8 6 4 2 mau 8 6 4 2 mau 8 6 4 2 mau 8 7 6 5 4

More information

Jan 25, 05 His Bind Kit (Novagen)

Jan 25, 05 His Bind Kit (Novagen) Jan 25, 05 His Bind Kit (Novagen) (1) Prepare 5ml of 1X Charge buffer (stock is 8X= 400mM NiSO4): 0.625ml of the stock + 4.375ml DH2O. (2) Prepare 13ml of 1X Binding buffer (stock is 8X = 40mM imidazole,

More information

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) 1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11500 Figure S1: The sector in the PDZ domain family. Sectors are defined as groups of statistically coevolving amino acid positions in a protein family and

More information

Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system

Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system SUPPLEMENTARY DATA Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system Daniel Gleditzsch 1, Hanna Müller-Esparza 1, Patrick Pausch 2,3, Kundan Sharma 4, Srivatsa Dwarakanath 1,

More information

INSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing.

INSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing. 1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE Nickel NTA Agarose Beads DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous

More information

Secondary structure of hvps4b (above) and sequence alignments of VPS4 proteins from

Secondary structure of hvps4b (above) and sequence alignments of VPS4 proteins from Supplemental Figure 1. Secondary structure of hvps4b (above) and sequence alignments of VPS4 proteins from different species as well as four other representative members of the meiotic clade of AAA ATPases.

More information

SUPPLEMENTAL DATA Experimental procedures

SUPPLEMENTAL DATA Experimental procedures SUPPLEMENTAL DATA Experimental procedures Cloning, protein production and purification. The DNA sequences corresponding to residues R10-S250 (DBD) and E258-T351 (IPT/TIG) in human EBF1 (gi:31415878), and

More information

GST Elution Buffer. (Cat. # ) think proteins! think G-Biosciences

GST Elution Buffer. (Cat. # ) think proteins! think G-Biosciences 191PR-05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name GST Elution Buffer (Cat. #786-541) think proteins! think G-Biosciences www.gbiosciences.com

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Growth, Purification, and Characterization of P450 cam

Growth, Purification, and Characterization of P450 cam 1. Cell growth without isotopic labeling Growth, Purification, and Characterization of P450 cam Growth medium Per liter (all components are previously sterilized by either autoclave or filtration): 5 M9

More information

SERVA Ni-NTA Magnetic Beads

SERVA Ni-NTA Magnetic Beads INSTRUCTION MANUAL SERVA Ni-NTA Magnetic Beads Magnetic beads for Affinity Purification of His-Tag Fusion Proteins (Cat. No. 42179) SERVA Electrophoresis GmbH - Carl-Benz-Str. 7-69115 Heidelberg Phone

More information

A(+1) A( 7) RNA hairpin

A(+1) A( 7) RNA hairpin PP7 CP dimer A(+1) A( 7) RNA hairpin 5 3 Supplemental Figure 1. Sample electron density of RNA hairpin. Cartoon showing PP7 FG CP (wheat) bound to RNA hairpin (violet) showing 2Fo-Fc electron density (blue)

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted

More information

Visualization of codon-dependent conformational rearrangements during translation termination

Visualization of codon-dependent conformational rearrangements during translation termination Supplementary information for: Visualization of codon-dependent conformational rearrangements during translation termination Shan L. He 1 and Rachel Green 1 1 Howard Hughes Medical Institute, Department

More information

HOOK 6X His Protein Purification (Bacteria)

HOOK 6X His Protein Purification (Bacteria) 182PR-02 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name HOOK 6X His Protein Purification (Bacteria) For The Purification Of His-Tagged Proteins

More information

Product. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin

Product. Ni-NTA His Bind Resin. Ni-NTA His Bind Superflow. His Bind Resin. His Bind Magnetic Agarose Beads. His Bind Column. His Bind Quick Resin Novagen offers a large variety of affinity supports and kits for the purification of recombinant proteins containing popular peptide fusion tags, including His Tag, GST Tag, S Tag and T7 Tag sequences.

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Resins are products that allow batch or column purifications. This product is supplied as a suspension in 50% aqueous suspension containing 30 vol % ethanol. INSTRUCTIONS The resins are adapted

More information

SERVA IMAC Ni-IDA Test Kit Agarose for Affinity Purification of His-Tag Fusion Proteins

SERVA IMAC Ni-IDA Test Kit Agarose for Affinity Purification of His-Tag Fusion Proteins INSTRUCTION MANUAL SERVA IMAC Ni-IDA Test Kit Agarose for Affinity Purification of His-Tag Fusion Proteins (Cat. No.42164, 42165) SERVA Electrophoresis GmbH - Carl-Benz-Str. 7-69115 Heidelberg Phone +49-6221-138400,

More information

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34.

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34. BACTERIAL PRODUCTION PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT 2015-XXXX XXXX pet-32a 50.9 kda (full-length) 34.0 kda (cleaved) EXPRESSION METHOD OVERVIEW: Plasmid DNA was transformed into BL21

More information

The YTH domain (residues ) of human YTHDF2 (NP_ ) was subcloned

The YTH domain (residues ) of human YTHDF2 (NP_ ) was subcloned Supplementary information, Data S1 Materials and Methods Protein Expression, Purification and Crystallization The YTH domain (residues 383-553) of human YTHDF2 (NP_057342.2) was subcloned into a modified

More information

Ni-NTA Agarose H A N D B O O K. Ni-NTA Agarose NP ml Ni-NTA Agarose NP ml Ni-NTA Agarose NP ml

Ni-NTA Agarose H A N D B O O K. Ni-NTA Agarose NP ml Ni-NTA Agarose NP ml Ni-NTA Agarose NP ml H A N D B O O K NP - 4211 25 ml NP - 4231 1 ml NP - 4251 5 ml Genetix Biotech Asia Pvt. Ltd. 71/1, First Floor, Shivaji Marg, Najafgarh Road, New Delhi - 1115 Phone : +91-11-4527 n Fax : +91-11-25419631

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION A human XRCC4-XLF complex bridges DNA ends. Sara N. Andres 1, Alexandra Vergnes 2, Dejan Ristic 3, Claire Wyman 3, Mauro Modesti 2,4, and Murray Junop 2,4 1 Department of Biochemistry

More information

PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ

PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.

More information

Proteins were extracted from cultured cells using a modified buffer, and immunoprecipitation and

Proteins were extracted from cultured cells using a modified buffer, and immunoprecipitation and Materials and Methods Immunoprecipitation and immunoblot analysis Proteins were extracted from cultured cells using a modified buffer, and immunoprecipitation and immunoblot analyses with corresponding

More information

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C. UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2013-2014 MOLECULAR BIOLOGY BIO-2B02 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/2/11/e1601625/dc1 Supplementary Materials for A molecular mechanism of chaperone-client recognition This PDF file includes: Lichun He, Timothy Sharpe, Adam Mazur,

More information

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van

More information

CAPZ PREPARATION BY BACTERIAL EXPRESSION (LYSIS BY DETERGENT, NOT SONICATION.) Soeno, Y. et al., J Mus. Res. Cell Motility 19:

CAPZ PREPARATION BY BACTERIAL EXPRESSION (LYSIS BY DETERGENT, NOT SONICATION.) Soeno, Y. et al., J Mus. Res. Cell Motility 19: CAPZ PREPARATION BY BACTERIAL EXPRESSION (LYSIS BY DETERGENT, NOT SONICATION.) Soeno, Y. et al., J Mus. Res. Cell Motility 19:639-646 Notes before starting: *Bacterial strain BL21(DE) plys S transformed

More information

Introduction to Protein Purification

Introduction to Protein Purification Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography

More information

of the Triphosphate of ATP

of the Triphosphate of ATP A Small Aptamer with Strong and Specific Recognition of the Triphosphate of Peter L. Sazani, Rosa Larralde and Jack W. Szostak Howard Hughes Medical Institute, and Department of Molecular Biology, Massachusetts

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Results Construct purification and coupling. Two A1-GP1bα ReaLiSM constructs, with and without cysteine residues near the N and C-termini (Fig. S2a), were expressed and purified by Ni affinity chromatography

More information

Supporting Information

Supporting Information Supporting Information Development of a 2,4-Dinitrotoluene-Responsive Synthetic Riboswitch in E. coli cells Molly E. Davidson, Svetlana V. Harbaugh, Yaroslav G. Chushak, Morley O. Stone, Nancy Kelley-

More information

Nickel Chelating Resin Spin Columns

Nickel Chelating Resin Spin Columns 326PR-02 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Nickel Chelating Resin Spin Columns A Ni-IDA IMAC resin for 6X-His Tagged Protein

More information

Supplementary Table 1. DNA sequence synthesized to express the Zika virus NS5 protein.

Supplementary Table 1. DNA sequence synthesized to express the Zika virus NS5 protein. Supplementary Table 1. DNA sequence synthesized to express the Zika virus NS5 protein. MR766 NS5 sequence 1 ACAGAGAACAGATTGGTGGTGGAGGTGGGACGGGAGAGACTCTGGGAGAGAAGTGGAAAG 61 CTCGTCTGAATCAGATGTCGGCCCTGGAGTTCTACTCTTATAAAAAGTCAGGTATCACTG

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq

More information

BIOC 463A Expt. 4: Column Chromatographic Methods Column Chromatography

BIOC 463A Expt. 4: Column Chromatographic Methods Column Chromatography Column Chromatography Chromatography is the process use to separate molecules based on SOME physical property of the molecule: Mass (i.e. size) Charge Affinity for ligands or substrates Hydrophobic interactions

More information

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric

More information

SUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly

SUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly SUPPLEMENTARY INFORMATION Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly Dustin J. E. Huard, Kathleen M. Kane and F. Akif Tezcan* Department of Chemistry and Biochemistry,

More information

Supplemental Information. Single-Molecule Imaging Reveals How. Mre11-Rad50-Nbs1 Initiates DNA Break Repair

Supplemental Information. Single-Molecule Imaging Reveals How. Mre11-Rad50-Nbs1 Initiates DNA Break Repair Molecular Cell, Volume 67 Supplemental Information Single-Molecule Imaging Reveals How Mre11-Rad50-Nbs1 Initiates DNA Break Repair Logan R. Myler, Ignacio F. Gallardo, Michael M. Soniat, Rajashree A. Deshpande,

More information

Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1.

Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1. GR24 (μm) 0 20 0 20 GST-ShHTL7 anti-gst His-MAX2 His-COI1 PVDF staining Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1. Pull-down assays using GST-ShHTL7

More information

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg Supplementary information Supplementary methods PCNA antibody and immunodepletion Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg extracts, one volume of protein

More information

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION DESCRIPTION Test kits are a fast and easy way to screen different IMAC resins before choosing the most appropriate product for each target-protein. All the products supplied in the Test kit are suitable

More information

GST Fusion Protein Purification Kit

GST Fusion Protein Purification Kit Glutathione Resin GST Fusion Protein Purification Kit Cat. No. L00206 Cat. No. L00207 Technical Manual No. TM0185 Version 01042012 Index 1. Product Description 2. Related Products 3. Purification Procedure

More information

Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of

Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of Supplementary data Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of cell free protein lysates from WT M. tuberculosis (Rv) together with various known concentrations

More information

HOOK 6X His Protein Purification (Yeast)

HOOK 6X His Protein Purification (Yeast) G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name HOOK 6X His Protein Purification (Yeast) For The Purification of His Tagged Proteins from

More information

For Research Use Only. Not for use in diagnostic procedures.

For Research Use Only. Not for use in diagnostic procedures. Printed December 13, 2011 Version 1.0 For Research Use Only. Not for use in diagnostic procedures. DDDDK-tagged Protein PURIFICATION GEL with Elution Peptide (MoAb. clone FLA-1) CODE No. 3326 / 3327 PURIFICATION

More information

Mechanism of Transcription Termination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element

Mechanism of Transcription Termination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element Molecular Cell Supplemental Information Mechanism of ranscription ermination by RNA Polymerase III Utilizes a Non-template Strand Sequence-Specific Signal Element Aneeshkumar G. Arimbasseri and Richard

More information

RISE Program Workshop in Protein Purification

RISE Program Workshop in Protein Purification RISE Program Workshop in Protein Purification Objectives: The purpose of this workshop is to introduce students to the principles and practice of protein purification. Each afternoon session will consist

More information

BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt

BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt Introduction to molecular biology Combining genetics, biochemistry, structural chemistry Information flow in biological systems: The Central Dogma

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

Rapid amplification of cdna ends (RACE)

Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE

More information

Extracting Pure Proteins from Cells

Extracting Pure Proteins from Cells Extracting Pure Proteins from Cells 0 Purification techniques focus mainly on size & charge 0 The first step is homogenization (grinding, Potter Elvejhem homogenizer, sonication, freezing and thawing,

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Lecture 7: Affinity Chromatography-II

Lecture 7: Affinity Chromatography-II Lecture 7: Affinity Chromatography-II We have studied basics of affinity purification during last lecture. The current lecture is continuation of last lecture and we will cover following: 1. Few specific

More information

Purification of oligonucleotides by anion exchange chromatography

Purification of oligonucleotides by anion exchange chromatography Purification of oligonucleotides by anion exchange chromatography APPLICATION NOTE AN 4 1 1 AA Solid-phase synthesis of oligonucleotides generally give material of rather high purity. However, for many

More information

PureSpin DNA Clean Up Kit

PureSpin DNA Clean Up Kit PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage

More information

Figure S1. Biosynthetic pathway of GDP-PerNAc. Mass spectrum of purified GDP-PerNAc. Nature Protocols: doi: /nprot

Figure S1. Biosynthetic pathway of GDP-PerNAc. Mass spectrum of purified GDP-PerNAc. Nature Protocols: doi: /nprot Synthesis of GDP-PerNAc In E. coli O157, the biosynthesis of GDP- -N-acetyl-D-perosamine (GDP-PerNAc) involves three enzymes (Fig. S1). GDP-D-Mannose is converted by GDP-mannose-4,6-dehydratase (GMD) into

More information

Crystal Structure of a Self-Splicing Group I Intron with Both Exons

Crystal Structure of a Self-Splicing Group I Intron with Both Exons Supplementary Data for: Crystal Structure of a Self-Splicing Group I Intron with Both Exons Peter L. Adams, Mary R. Stahley, Anne B. Kosek, Jimin Wang and Scott A. Strobel The supplementary material includes

More information

SUMOstar Gene Fusion Technology

SUMOstar Gene Fusion Technology Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com

More information

Purification of GST-tagged proteins using PureCube Glutathione Agarose

Purification of GST-tagged proteins using PureCube Glutathione Agarose Purification GST-tagged proteins using PureCube Glutathione Agarose Overview This protocol describes the generation a cleared lysate from 200 ml E. coli cell culture, and the purification GST-tagged proteins

More information

TECHNICAL BULLETIN. HIS-Select HF Nickel Affinity Gel. Catalog Number H0537 Storage Temperature 2 8 C

TECHNICAL BULLETIN. HIS-Select HF Nickel Affinity Gel. Catalog Number H0537 Storage Temperature 2 8 C HIS-Select HF Nickel Affinity Gel Catalog Number H0537 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select High Flow (HF) is an immobilized metal-ion affinity chromatography (IMAC)

More information

SUPPLEMENTARY INFORMATION. Determinants of laminin polymerization revealed. by the structure of the α5 chain amino-terminal region

SUPPLEMENTARY INFORMATION. Determinants of laminin polymerization revealed. by the structure of the α5 chain amino-terminal region SUPPLEMENTARY INFORMATION Determinants of laminin polymerization revealed by the structure of the α5 chain amino-terminal region Sadaf-Ahmahni Hussain 1, Federico Carafoli 1 & Erhard Hohenester 1 1 Department

More information

HOOK 6X His Protein Spin Purification (Bacteria)

HOOK 6X His Protein Spin Purification (Bacteria) 222PR 03 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name HOOK 6X His Protein Spin Purification (Bacteria) For the Purification of His Tagged

More information

Protein Purification and Characterization Techniques. Nafith Abu Tarboush, DDS, MSc, PhD

Protein Purification and Characterization Techniques. Nafith Abu Tarboush, DDS, MSc, PhD Protein Purification and Characterization Techniques Nafith Abu Tarboush, DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Extracting Pure Proteins from Cells Purification techniques focus

More information

Ver AccuPrep His-tagged Protein Purification kit. Safety Warnings and Precautions. Warranty and Liability. Cat. No. K-7200

Ver AccuPrep His-tagged Protein Purification kit. Safety Warnings and Precautions. Warranty and Liability. Cat. No. K-7200 Ver. 1.0 Safety Warnings and Precautions AccuPrep His-tagged protein purification kit is developed and sold for research purposes only. It is not recommended for human or animal diagnostic use, unless

More information

Supplemental Information

Supplemental Information FOOT-AND-MOUTH DISEASE VIRUS PROTEIN 2C IS A HEXAMERIC AAA+ PROTEIN WITH A COORDINATED ATP HYDROLYSIS MECHANISM. Trevor R. Sweeney 1, Valentina Cisnetto 1, Daniel Bose 2, Matthew Bailey 3, Jon R. Wilson

More information

MagExtactor -His-tag-

MagExtactor -His-tag- Instruction manual MagExtractor-His-tag-0905 F0987K MagExtactor -His-tag- Contents NPK-701 100 preparations Store at Store at 4 C [1] Introduction [2] Components [3] Materials required [4] Protocol3 1.

More information

Electronic Supplementary Information. Evolved polymerases facilitate selection of fully 2 - OMe- modified aptamers

Electronic Supplementary Information. Evolved polymerases facilitate selection of fully 2 - OMe- modified aptamers Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Evolved polymerases facilitate selection of fully

More information

Supplementary Online Material. Structural mimicry in transcription regulation of human RNA polymerase II by the. DNA helicase RECQL5

Supplementary Online Material. Structural mimicry in transcription regulation of human RNA polymerase II by the. DNA helicase RECQL5 Supplementary Online Material Structural mimicry in transcription regulation of human RNA polymerase II by the DNA helicase RECQL5 Susanne A. Kassube, Martin Jinek, Jie Fang, Susan Tsutakawa and Eva Nogales

More information

Supporting Information

Supporting Information Supporting Information Ni/NiO Core/shell Nanoparticles for Selective Binding and Magnetic Separation of Histidine-Tagged Proteins In Su Lee,, No Hyun Lee,, Jongnam Park,, Byung Hyo Kim,, Yong-Weon Yi,

More information