Detection of pathogenic bacteria in a mussel farming area by multiplex PCR

Transcription

1 Detection of pathogenic bacteria in a mussel farming area by multiplex PCR Gugliandolo Concetta*, Lentini Valeria, Maugeri Teresa L. Dipartimento di Biologia Animale ed Ecologia Marina, University of Messina, V.le F. Stagno d Alcontres, Messina, Italy. *Corresponding author: cgugliandolo@unime.it To detect Aeromonas hydrophila, Salmonella typhimurium, Vibrio cholerae, V. parahaemolyticus and V. vulnificus in Mediterranean mussels (Mytilus galloprovincialis) and water samples, conventional and molecular methods were used. Samples were collected from Faro Lake (Italy), from April to September The simultaneous detection of the five pathogens was performed by a multiplex PCR (m-pcr) on DNA extracted from enrichment cultures of the samples. The aerolysin gene (aero) of A. hydrophila, the invasion plasmid antigen B (ipab) gene of the enterotoxin extracellular secretion protein (epsm) gene of V. cholerae, the species-specific region of 16S rdna gene of V. vulnificus, the speciesspecific pr72h conservative fragment of V. parahaemolyticus and the thermostable direct haemolysin (tdh) gene for the detection of pathogenic V. parahaemolyticus were used as the gene targets. A. hydrophila gene was detected in water sample in April. The gene of S. typhimurium was found in mussels from June to September and in water in April and from July to September. V. cholerae gene was detected in April and in September in mussels and only in September in water. Mussels collected in June and September and water collected in May were positive for V. vulnificus. V. parahaemolyticus species-specific gene was detected in all samples, while the tdh gene was targeted in V. parahaemolyticus isolates and enrichment from mussels of September. The occurrence of pathogens in samples was independent to Escherichia coli counts. The sensitivity of the m-pcr was higher than that observed by using the conventional isolation procedures. Multiplex PCR assay may provide a useful tool for rapid and specific detection of pathogens in mussels and water to protect human health. Keywords: Pathogenic bacteria; detection and molecular typing methods. Introduction Faro Lake, located near Messina (Italy), is an approved shellfish harvesting area, classified as class A according to the Italian Legislative Decree 530/1992, laying down the health conditions for the production and marketing of live bivalve molluscs. Bacterial indicators for the classification of production areas is currently established by the 1

2 evaluation of Escherichia coli in the mollusc flesh and fluid, and requirements concerning live bivalve molluscs also include the determination of Salmonella spp. Vibrio spp. and Aeromonas spp. are normal inhabitants of aquatic environments and some species are recognised as human pathogens causing enteric pathologies, wound infection and septicemia (Thompson et al., 2004; Janda and Abbott, 2010). V. cholerae and non-epidemic Vibrio spp., including V. parahaemolyticus and V. vulnificus, are associated with the consumption of raw or undercooked shellfish or exposure of skin wounds to water (Morris, 2003). Salmonella spp. are ubiquitous enteric bacteria and etiological agents of food-borne salmonellosis, causing typhoid and paratyphoid fevers, commonly related to shellfish consumption. Conventional detection of pathogenic bacteria is largely based on cultivation procedures, which use enrichment broths followed by isolation of colonies on selective media, biochemical identification and confirmation of pathogenicity of the isolates. The development of molecular technologies are used to complement or replace culture-based approaches and bypass some of their intrinsic biases and their own limitations. PCR is considered a sensitive detection method for specific pathogens in environmental samples and a multiplex PCR method (m-pcr) was developed to rapidly detect different bacterial pathogens in marine waters (Kong et al., 2002). Since many human pathogenic bacteria in the aquatic environment, as well as in seafood are independent from bacterial indicators, the specific detection of pathogens is often suggested to assess a more accurate human health risk (DePaola et al., 1990; 2003; Gugliandolo et al., 2008, 2009; Maugeri et al., 2000, 2004, 2006). In this study the detection of A. hydrophila, V. cholerae, V. parahaemolyticus and V. vulnificus in mussels and water samples, by comparing conventional and molecular methods is reported. 1. Materials and Methods Sampling and enrichment cultures Mussel (M. galloprovincialis) and water samples were monthly collected from April to September Temperature and salinity were measured in situ by a portable multiparameter probe (Idromar IM 201, Inc. Austin, USA). For each shellfish sample (10-15 mussels/sample) 25g of homogenised flesh and intervalvular liquor were inoculated into the following broths: Alkaline Peptone Water (Bacto peptone 1%, NaCl 1%) to enrich Aeromonas spp. and Vibrio spp.; Alkaline Peptone Water plus Polymyxin B ( U l -1 ) for selective enrichment of V. parahaemolyticus and V. vulnificus; Tryptone Soya Broth (Oxoid) and Selenite Broth (Oxoid) for Salmonella spp. pre-enrichment and selective enrichment steps, respectively. All enrichments were incubated at 37 C for 24h. Water samples (100 ml) were concentrated onto 0.2 μm membrane filters (Millipore Corp., Bedford, MA, USA) and filters were inoculated into the enrichment broths and incubated as described above. Aliquots of enrichment cultures were analysed by conventional and molecular methods, as reported in Figure 1. 2

3 CONVENTIONAL METHOD MOLECULAR METHOD A loopful of each enrichment culture Isolation (24 h) DNA extraction from isolates (20 min) Biochemical and cultural characterization of isolates (72 h) Enrichment (24 h) - Alkaline Peptone Water - Alkaline Peptone Water + Polymyxin B -Tryptone Soya Broth - Selenite Broth 2.0 ml of each enrichment culture DNA extraction Centrifugation rpm/10min Resuspend pellet in 50 μl of sterile H 2 O Boil for 10 min Freeze at -20 C PCR confirmation (6 h) m-pcr (6 h) Figure 1. Flow diagram of the conventional and the molecular methods for detection of five pathogens. Conventional method In order to isolate strains of Aeromonas, Salmonella and Vibrio, a loopful of each enrichment culture was streaked onto the appropriate solid medium. m-aeromonas (Biolife), Salmonella Shigella (Oxoid) and Thiosulphate Citrate Bile Sucrose (Oxoid) agar plates were incubated at 37 C for 24 h. Identification of isolates was performed by using the following tests: Gram stain, motility, glucose fermentation, production of gas from glucose, production of H 2 S, oxidase, catalase, esculin hydrolysis, acidification of sucrose and lactose, ability to grow at different NaCl concentrations (0, 6, 8 and 10%). The isolates were studied for their biochemical properties by using the API 20E system (biomérieux). Confirmation of phenotypic identification of isolates was performed by PCR on DNA extracted from single colonies as previously reported (Gugliandolo et al., 2008; Kong et al., 2002). The PCR target genes and primers are reported in Table 1. The enumeration of Escherichia coli in mussels was performed by using plates of Tryptone Bile X-Glucuronide medium (Oxoid). After incubation at 44 C for 24 h, blue colonies were counted and results were expressed as E. coli CFU per 100 g. 3

4 Table 1. Target genes, primers and size of PCR-amplified genes of the five types of pathogenic bacteria. Organism Target genes Primer Sequences (5'-3') Aeromonas hydrophila Aerolysin (aero ) Aero -F TGTCGGSGATGACATGGAYGTG Aero -R CCAGTTCCAGTCCCACCACTTCA Amplicon size (bp) 720 Reference Chopra et al. (1993) Salmonella typhimurium Invasion plasmid Antigen B (ipa B) IpaB -F IpaB -R GGACTTTTTAAAAGCGGCGG GCCTCTCCCAGAGCCGTCTGG 314 Kaniga et al. (1995) Vibrio cholerae Enterotoxin Extracellular Secretion protein (eps M) EpsM- F EpsM- R GAATTATTGGCTCCTGTGCAGG ATCGCTTGGCGCATCACTGCCC 248 Overbye et al. (1993) V. parahaemolyticus pr72h conservative Vp32 CGAATCCTTGAACATACGCAGC fragment Vp33 TGCGAATTCGATAGGGTGTTAACC 387 Lee et al. (1995) Thermostable direct haemolysin (tdh ) Tdh- F Tdh- R GTAAAGGTGTCTGACTTTTTGAC TGGAATAGAACCTTCATCTTCACC 296 Bej et al. (1999) V. vulnificus 16S rrna Vib2 Vib3 TCTAGCGGAGACGCTGGA GTCCACTTTCGCAAGTTGG 273 Kim and Jeong (2001) Molecular method The simultaneous detection of the five pathogens was performed by a multiplex PCR on DNA extracted from enrichment cultures of the samples. DNA was extracted from 2.0 ml of each enrichment culture and was submitted to m-pcr in a final volume of 50 μl (Figure 1). Target genes used in the multiplex PCR assays are reported in Table 1. Concentration of each pair of primers was as follows: 0.2 mm of Aero, 0.3 mm of IpaB, 0.1 mm of EpsM, 1.0 mm of Vp32 and Vp33, 0.5 mm of Tdh, 0.5 mm of Vib2 and Vib3 and amplification was performed under the following conditions: denaturation at 94 C for 2 min followed by 35 cycles of denaturation at 94 C for 1 min, primer annealing at 62 C for 1 min, DNA extension at 72 C for 2.5 min, and final extension at 72 C for 10 min. The thermostable direct haemolysin (tdh) gene for pathogenic strains of V. parahaemolyticus was additionally targeted in enrichments positive for total V. parahaemolyticus. 2. Results and Discussion None of the isolates was identify as A. hydrophila, S. typhimurium and V. cholerae, while their genes were detected by m-pcr assays from water and mussels enrichment cultures (Figure 2, Table 2). The gene of S. typhimurium was found in mussels from June to September and in water in April and from July to September. V. cholerae gene was detected in April and in September in mussels and only in September in water. Total V. parahaemolyticus was detected using molecular approaches in all samples, independently from water temperatures and salinities 4

5 Kb Water April May June July August September M A B C D A B C D A B C D A B C D A B C D A B C D aero pr72h ipab Vib EpsM Mussels April May June July August September Kb M A B C D A B C D A B C D A B C D A B C D A B C D aero pr72h ipab Vib EpsM Figure 2. Electrophoretic profiles of PCR amplified target genes from reference bacterial pathogens and of m-pcr products from the different enrichment cultures. Line M: 1-Kb DNA ladder; line 1: A. hydrophila ATCC 23211; line 2: V. parahaemolyticus lab strain 1; line 3: V. parahaemolyticus (tdh +) lab strain 2; line 4: V. vulnificus lab strain; line 5: S. typhimurium ATCC 33055; line 6: V. cholerae ATCC 25873; line A: Alkaline Peptone Water; line B: Alkaline Peptone Water plus Polymyxin B; line C: Tryptone Soya Broth; line D: Selenite Broth. V. parahaemolyticus strains isolated from water were negative for the tdh gene. Pathogenic V. parahaemolyticus (tdh+) strains were isolated from mussels in September and represented 5.26% of total V. parahaemolyticus strains. This percentage of V. parahaemolyticus (tdh+) is comparable with those (4-13%) previously reported in other studies (DePaola et al., 2003), but is lower than that found in shellfish from Southern Italy (Di Pinto et al., 2008). V. vulnificus was sporadically isolated from mussels (June), and was detected by m-pcr in water sample of May and in mussels of June and September. V. vulnificus and V. parahaemolyticus are known to be widely distributed throughout temperate habitats worldwide, and tend to be more abundant when water temperature exceeds 17 C (Gugliandolo et al., 2005, 2008, 2009; Maugeri et al., 2000, 2006; Wright et al., 1996). Low salinity may favour V. vulnificus growth in shellfish (Wright et al., 1996, 2007), while V. parahaemolyticus tolerates higher salinity values (DePaola et al., 2003; Maugeri et al., 2004). 5

6 Table 2. Detection of pathogenic bacteria by conventional and molecular methods in water and mussels from April to September (V. parahaemolyticus*: pathogenic V. parahaemolyticus (tdh+). Conventional method Molecular method T C S Water Mussels Water Mussels April May Aeromonas hydrophila,, V.vulnificus V. cholerae, June V.vulnificus S. typhimurium V.vulnificus July August September * V. cholerae S. typhimurium S. typhimurium V. cholerae * V.vulnificus E. coli was absent in mussel samples throughout the study period, confirming that the occurrence of studied pathogens was independent from E. coli evaluation. The sensitivity of the m-pcr was higher than that observed by conventional isolation procedures. This method allows also the detection of species which may enter in a viable but non-culturable (VBNC) state in response to adverse environmental conditions. VBNC cells no longer grow on conventional media, but may retain their pathogenicity (Maugeri et al., 2006). The multiplex PCR assay may be considered a useful tool for rapid and specific detection of bacterial pathogens in harvested and post-harvested mussels. Acknowledgments This research was partially funded by the Regione Sicilia, Assessorato Regionale Cooperazione Commercio Artigianato Pesca. References Bej A.K., Patterson D.P., Brasher C.W., Vickery M.C., Jones D.D., Kaysner C.A., Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh, J. Microbiol. Meth., 36,

7 Chopra A.K., Houston C.W., Peterson J.W., Jin G.F., Cloning, expression and sequence analysis of a cytolytic enterotoxin gene from Aeromonas hydrophila, Can. J. Microbiol., 39, DePaola A., Hopkins L.H., Peeler J.T., Wentz B., McPhearson R.M., Incidence of Vibrio parahaemolyticus in U.S. coastal waters and oysters, Appl. Environ. Microbiol., 56, DePaola A., Nordstrom J.L., Bowers J.C., Wells J.G., Cook D.W., Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters, Appl. Environ. Microbiol., 69, Di Pinto A., Ciccarese G., De Corato R., Novello L., Terio V., Detection of pathogenic Vibrio parahaemolyticus in Southern Italian shellfish, Food Control, 19, Gugliandolo C., Carbone M., Fera M.T., Irrera G.P., Maugeri T.L., Occurrence of potentially pathogenic vibrios in the marine environment of the Straits of Messina (Italy), Mar. Poll. Bull., 50, Gugliandolo C., Irrera G.P., Lentini V., Maugeri T.L., Pathogenic Vibrio, Aeromonas and Arcobacter spp. associated with copepods in the Straits of Messina (Italy), Mar. Poll. Bull., 56, Gugliandolo C., Lentini V., Fera M.T., La Camera E., Maugeri T.L., Water quality and ecological status of the Alcantara River estuary (Italy), New Microbiologica, 32, Janda J.M., Abbott S.L., The Genus Aeromonas: Taxonomy, pathogenicity, and infection, Clin. Microbiol. Rev., 23, Kaniga K., Tucker S., Trollinger D., Galán J.E., Homologs of the Shigella IpaB and IpaC invasins are required for Salmonella typhimurium entry into cultured epithelial cells, J. Bacteriol., 177, Kim M.S., Jeong H.D., Development of 16S rrna targeted PCR methods for the detection and differentiation of Vibrio vulnificus in marine environments, Aquaculture, 193, Kong R.Y.C., Lee S.K.Y., Law T.W.F., Law S.H.W., Wu R.S.S., Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR, Water Res., 36, Lee C.Y., Pan S.F., Chen C.H., Sequence of a cloned pr72h fragment and its use for detection of Vibrio parahaemolyticus in shellfish with the PCR, Appl. Environ. Microbiol., 61, Maugeri T.L., Caccamo D., Gugliandolo C., Potentially pathogenic vibrios in brackish waters and mussels, J. Appl. Microbiol., 89, Maugeri T.L., Carbone M., Fera M.T., Irrera G.P., Gugliandolo C., Distribution of potentially pathogenic bacteria as free living and plankton associated in a marine coastal zone, J. Appl. Microbiol., 97, Maugeri T.L., Carbone M., Fera M.T., Gugliandolo C., Detection and differentiation of Vibrio vulnificus in seawater and plankton of a coastal zone of the Mediterranean Sea, Res. Microbiol., 157, Morris J.G. Jr., Cholera and other types of vibriosis: a story of human pandemics and oysters on the half shell, Clin. Infect. Dis., 37, Overbye L.J., Sandkvist M., Bagdasarian M., Genes required for extracellular secretion of enterotoxin are clustered in Vibrio cholerae, Gene, 132, Thompson F.L., Lida T., Swing J., Biodiversity of vibrios, Microbiol. Mol. Biol. Rev., 68, Wright A.C., Hill R.T., Johnson J.A., Roghman M.C., Colwell R.R., Morris J.G., Distribution of Vibrio vulnificus in the Chesapeake Bay estuaries, Appl. Environ. Microbiol., 62, Wright A.C., Garrido V., Debuex G., Farrell-Evans M., Mudbidri A.A., Otwell W.S., Evaluation of postharvest-processed oysters by using PCR-based most-probable-number enumeration of Vibrio vulnificus bacteria, Appl. Environ. Microbiol., 73,