Mechanism of action-1
|
|
- Branden King
- 5 years ago
- Views:
Transcription
1 Mechanism of action-1 receptors: mediators of hormone action, membrane associated vs. intracellular receptors: measurements of receptor - ligand interaction, mechanism surface-receptors: kinases, phosphatases, GC activities, ligand-gated ion channels intracellular receptors:, thyroid, retinoid and arylhydrocarbon receptors 02 mechanism of thyroid, gonad and adrenal hormone action: gene by T3, P4,T, E2, ALD, COT and their receptors in addition, neuros mechanism of action : actions, actions at cell surface through their membrane receptors genetic control of hormone biosynthesis permissive action, / thyroid hormone endocrine pathologies, action mechanism a review using expression of a polypeptide hormone controlled by a liposoluble hormone Today s lecture afferent story line integrator center a reflex arc a base for a control model efferent story line S diagram for a control system as that present in a refrigerator E sensor negative feedback story line effector S E if story lines are linked through an integrator, then you have control Page 1
2 Today s lecture story line I suggest you put this information into a table YOU design!!! Membrane What does a cell membrane look like? What does a receptor look like? What does a receptor in a membrane look like? What does an enzyme look like? What does an enzyme in a membrane look like? What does an ion channel look like? What does an ion channel in a membrane look like? Page 2
3 All eceptors bound hormone ( H ) binding capacity How do hormones and receptors interact? What is affinity and what is specificity? What is a conformation change? What is the relation between binding and biological effect? What are spare receptors? k1 H + <------> H H * H = Scatchard plot bound / free H / H k2 k1 k2 = kd single binding slope = - 1 / kd capacity half saturation affinity = kd free hormone ( H ) double binding What is the life cycle of a hormone receptor? bound hormone ( H ) high affinity / low capacity low affinity / high capacity All eceptors number of occupied receptors per cell x Specific hormone binding % reduction in the number of receptors biological response as % of maximum Biological response hormone concentration (M) number of receptors occupied for maximal biological response (100%) Page 3
4 Membrane eceptors surface - receptors: kinases, phosphatases and GC activities, ligandgated ion channels, transport next lecture Transducer, comparator, amplifier, crosstalk Gs AC ---> camp ----> PKA ----> intermediaries pump channel enzyme Gi AC ---> camp ----> PKA ----> intermediaries nucleus Membrane eceptors E mna Golgi recycled or destroyed Lysosomes surface - receptors: kinases, phosphatases and GC activities, ligandgated ion channels, transport next lecture next lecture c e l l m e m b r a n e Transducer, comparator, amplifier, crosstalk Gs AC ---> camp ----> PKA ----> intermediaries pump channel enzyme Gi AC ---> camp ----> PKA ----> intermediaries Page 4
5 Nuclear eceptors gene, exons, introns cis - acting, trans - acting transcription, translation splicing NA cap polya tail Hormonal action can be regulated at the level of transcription, translation, NA turnover, protein turnover, and post - translational modification. Nuclear eceptor Structure NH 2 DNA binding region Hormone binding region COOH E P COT T T Vit D Page 5
6 Zinc Fingers Structure Transcription Factors Structure Page 6
7 Transcription and Acetylation Transcription and Methylation DNMT, DNA methyl! transferase! DNMT and a TF,! transcription factor! TGS, transcriptional! gene silencing! DNA methylation is a phenomenon occurring on the DNA known to consist of four bases. One of them, cytosine, exists in a "normal" and in a methylated version, ie with a methyl group attached, but only when directly followed by the base guanine. The consequences of methylation lie in the of gene expression: methylated cytosines in the promotor region of a gene lead to inactivation, thus acting as an "on" and "off" switch for genes. This is a naturally occurring mechanism to prevent all genes in a tissue/cell to be expressed at a time. As all cytosines in a CG context (ie in front of a guanine) are known, it is possible to analyze the patterns of methylated and unmethylated cytosines in the genome and to identify the pattern that is typical for a specific tissue and type of disease. Once differentially methylated cytosines for a certain disease are known, their detection enables an exact diagnosis at a very early stage, molecular classification and the likely reaction of a patient to treatment. Epis can obtain this information based on its robust proprietary technology.#! Page 7
8 Nuclear eceptor for Steroids H Intracellular receptors for s are transcription factors. Their Zn fingers are binding regions which attach to the promotor segment of DNA H H H HSP 90 HSP 90 Zn Zn H E Zn TATA box NA Pol II HSP 90 HSP 90 D N A Nuclear eceptor for T3 Hormone inactive transcription T3 empty binding site H E T3 co-repressor NH2 COOH TFIIB TATA box NA- Pol II D N A co-repressor active transcription T3 T3 H E T3 COOH NH2 TFIIB TATA box NA- Pol II D N A Page 8
9 Nuclear eceptor for T3 Hormone In its free state T3 binds to its HE as homo-dimer, or as a hetero-dimer with retinoid-x (e.g. Vit A). The carboxy-terminus of T3 interacts with TFIIB preventing the formation of a stable preinitiation complex and, together with a co-repressor, silences transcription. Upon T3 binding, its receptor undergoes a conformational change ( magic ), dissociation of the co-repressor, a decreased interaction of the T3 with the carboxy-terminus TFIIB and an increase interaction of the T3 amino-terminus with TFIIB. These changes facilitate TFIIB binding an assembly of a stable pre-initiation complex, the binding of NA polymerase II and the activation of transcription initiation. Efficiency, permissiveness Na / K pump camp ----> PKA ----> channel / enzyme AC Protein synthesis XX1 HE 5 3 E1 mna Cellular response S Steroid S > S DNA additional transcription factor Page 9
10 Permissive Action Action on specific mna synthesis could cause an increase in the number of membrane receptors, which might increase the production of cyclic nucleotides, thus leading to an increase cellular response to hormones acting on the plasmalemma. Thyroid or hormones could increase or decrease the amount of cyclic nucleotide - dependent protein kinases PK or amount of substrate available for phosphorylation by camp or cgmp - dependent PK. Thyroid and hormones could enhance the synthesis of a protein that could act as an inhibitor of another protein (e.g.. phosphoprotein phosphatase) whose action is antagonistic to cyclic nucleotide action. Pathologies Theoretically, genetic pathologies can be associated with each step of the biosynthetic pathway leading to the production of a particular enzyme or protein. congenital adrenal hyperplasia due to gene deletion or to point mutation of the 21 - hydroxylase enzyme ( beard lady ). testicular feminization due to point mutations scattered throughout the androgen receptor gene, cause decrease amounts of functional androgen receptors, altered sexual differentiation &feed-back ( beware of single bars ). Vit D - dependent rickets due to a single point mutation in tip of one of thedna - Zn fingers binding domain of Vit D receptor, thus making it unable to interact and transcriptionally regulate Vit D - responsive genes ( link to rickets and osteoporosis ). Page 10
11 eview of the mechanism of action of intracellular receptors in For example, lecture) peptide out Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Page 11
12 Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Page 12
13 Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Page 13
14 Consensus gene encoding a prototypical peptide hormone For example, in lecture) peptide out Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) peptide out Consensus gene encoding a prototypical peptide hormone Page 14
15 Consensus gene encoding a prototypical peptide hormone For example, in lecture) peptide out Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) peptide out Consensus gene encoding a prototypical peptide hormone Page 15
16 Endocrine Physiology levels of organization! structure! - function! homeostatic!! Potential control points for of gene expression in hormone production effector hormone Page 16
17 Models for activation of gene expression Cis model consensus gene Trans model Mechanisms of transcriptional repression Competition Sequestration Quenching / tethering Active ( or fat Albert and the buck - buck game ) Page 17
18 Activation of specific transcription factors by s Cell-surface receptor coupled signal transduction pathways involved in activation of nuclear transcription factors Page 18
19 Cell-surface receptor coupled signal transduction pathways involved in activation of nuclear transcription factors Page 19
Mechanism of action-1
Mechanism of action-1 receptors: mediators of hormone action, membrane associated vs. intracellular receptors: measurements of receptor - ligand interactions, regulation mechanisms surface - receptors:
More informationSection C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
More informationCELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone
More informationChapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes
Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationDNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268
DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:
More informationControl of Eukaryotic Gene Expression (Learning Objectives)
Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of
More informationCHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationQuick Review of Protein Synthesis
Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help
More informationGenetics Biology 331 Exam 3B Spring 2015
Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More information30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationControl of Gene Expression
Control of Gene Expression 1 How Gene Regulation Works 2 Control of Gene Expression Controlling gene expression is often accomplished by controlling transcription initiation Regulatory proteins bind to
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationLecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex
Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription
More informationCHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES
CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationSynthetic cells: do bacteria need all its genes? No.
NO NEED TO REFER TO THE SLIDES. بسم هللا الرحمن الرحيم Do we need all the non coding regions of the DNA? Two weeks ago, they discovered that the genome of a plant is very small (recall that plant genome
More informationMolecular Biology (BIOL 4320) Exam #1 March 12, 2002
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.
More informationGene Expression and Regulation - 1
Gene Expression and Regulation - 1 We have been discussing the molecular structure of DNA and its function in DNA replication and in transcription. Earlier we discussed how genes interact in transmission
More informationREGULATION OF GENE EXPRESSION
REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the
More informationChapter 11. Transcription. The biochemistry and molecular biology department of CMU
Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More information32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes
3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific
More informationGene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory
Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More information17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites
More informationGene Expression. Lesson 6
Gene Expression Lesson 6 Regulation of gene expression Gene regulation turning on or off specific genes depending on the requirements of an organism Housekeeping genes are always switched on (vital life
More informationGene expression DNA RNA. Protein DNA. Replication. Initiation Elongation Processing Export. DNA RNA Protein. Transcription. Degradation.
Gene expression DNA RNA Protein DNA DNA Degradation RNA Degradation Protein Replication Transcription Translation Initiation Elongation Processing Export Initiation Elongation Processing Targeting Chapter
More informationGene Expression: From Genes to Proteins
The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationREGULATION OF GENE EXPRESSION
REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationTranscription & post transcriptional modification
Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity
More informationIntroduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
More informationResources. This lecture Campbell and Farrell's Biochemistry, Chapter 11
Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationBiol 3301 Genetics Exam #2A October 26, 2004
Biol 3301 Genetics Exam #2A October 26, 2004 This exam consists of 40 multiple choice questions worth 2.5 points each, for a total of 100 points. Good luck. Name SS# 1. Which of the following statements
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationChapter 3. DNA, RNA, and Protein Synthesis
Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription
More informationDifferential Gene Expression
Developmental Biology Biology 4361 Differential Gene Expression October 13, 2005 core transcription initiation site 5 promoter 3 TATAT +1 upstream downstream Basal transcription factors (eukaryotes) TFIID
More informationTranscription. By : Lucia Dhiantika Witasari M.Biotech., Apt
Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More information7.06 Cell Biology QUIZ #3
Recitation Section: 7.06 Cell Biology QUIZ #3 This is an open book exam, and you are allowed access to books and notes, but not computers or any other types of electronic devices. Please write your answers
More informationThe Stringent Response
The Stringent Response When amino acids are limiting a response is triggered to shut down a wide range of biosynthetic processes This process is called the Stringent Response It results in the synthesis
More informationRegulation of Gene Expression
Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationGene regulation V Biochemistry 302. March 6, 2006
Gene regulation V Biochemistry 302 March 6, 2006 Common structural motifs associated with transcriptional regulatory proteins Helix-turn-helix Prokaryotic repressors and activators Eukaryotic homeodomain
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationTranslation Mechanisms
Translation Mechanisms Biology I Hayder A. Giha Translation The translation is the process of protein synthesis, where information in nucleotides sequences of a mrna is translated into amino acids sequence
More informationEUKARYOTIC GENE CONTROL
EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationSCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318
SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic
More informationC2006/F2402 '14 OUTLINE OF LECTURE #12
C2006/F2402 '14 OUTLINE OF LECTURE #12 (c) 2014 Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 03/04/2014 03:24 PM Handouts: 12-A -- mrna processing 12-B -- Alternative processing
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationUnit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationJudy Wieber. Department of Computational Biology. May 28, 2008
Review III: Cellular Processes Judy Wieber BBSI @ Pitt 2008 Department of Computational Biology University it of Pittsburgh School of Medicine i May 28, 2008 Outline Metabolism Cell cycle Transcription
More informationChapter 18: Regulation of Gene Expression
Chapter 18: Regulation of Gene Expression Regulation of Metabolism Shuts off transcription Types of Feedback Negative feedback = body s response is to reduce the stimulus Ex: regulation of body temp, blood
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription: Sending the
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationGENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/
1 GENES AND CHROMOSOMES V Lecture 7 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University 2 CELL NUCLEUS AND THE CONTROL OF GENE EXPRESSION An Overview of Gene Regulation in Eukaryotes
More informationChapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationM1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationVersion 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) to allow RNA polymerase continuous access
Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) 1 This print-out should have 34 questions. Multiple-choice questions may continue on the next column or page find all choices
More informationControl of Metabolic Processes
Control of Metabolic Processes Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College As described earlier, the metabolic processes occurring within living organisms (glycolysis, respiration,
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationChapter 14 Regulation of Transcription
Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription
More informationChapter 3 Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
More informationDifferential Gene Expression
Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationDOWNLOAD OR READ : EXAMPLES OF REGULATORY PROTEINS THAT CONTROL THE CELL CYCLE PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : EXAMPLES OF REGULATORY PROTEINS THAT CONTROL THE CELL CYCLE PDF EBOOK EPUB MOBI Page 1 Page 2 examples of regulatory proteins that control the cell cycle examples of regulatory proteins
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More information