Mechanism of action-1

Size: px
Start display at page:

Download "Mechanism of action-1"

Transcription

1 Mechanism of action-1 receptors: mediators of hormone action, membrane associated vs. intracellular receptors: measurements of receptor - ligand interaction, mechanism surface-receptors: kinases, phosphatases, GC activities, ligand-gated ion channels intracellular receptors:, thyroid, retinoid and arylhydrocarbon receptors 02 mechanism of thyroid, gonad and adrenal hormone action: gene by T3, P4,T, E2, ALD, COT and their receptors in addition, neuros mechanism of action : actions, actions at cell surface through their membrane receptors genetic control of hormone biosynthesis permissive action, / thyroid hormone endocrine pathologies, action mechanism a review using expression of a polypeptide hormone controlled by a liposoluble hormone Today s lecture afferent story line integrator center a reflex arc a base for a control model efferent story line S diagram for a control system as that present in a refrigerator E sensor negative feedback story line effector S E if story lines are linked through an integrator, then you have control Page 1

2 Today s lecture story line I suggest you put this information into a table YOU design!!! Membrane What does a cell membrane look like? What does a receptor look like? What does a receptor in a membrane look like? What does an enzyme look like? What does an enzyme in a membrane look like? What does an ion channel look like? What does an ion channel in a membrane look like? Page 2

3 All eceptors bound hormone ( H ) binding capacity How do hormones and receptors interact? What is affinity and what is specificity? What is a conformation change? What is the relation between binding and biological effect? What are spare receptors? k1 H + <------> H H * H = Scatchard plot bound / free H / H k2 k1 k2 = kd single binding slope = - 1 / kd capacity half saturation affinity = kd free hormone ( H ) double binding What is the life cycle of a hormone receptor? bound hormone ( H ) high affinity / low capacity low affinity / high capacity All eceptors number of occupied receptors per cell x Specific hormone binding % reduction in the number of receptors biological response as % of maximum Biological response hormone concentration (M) number of receptors occupied for maximal biological response (100%) Page 3

4 Membrane eceptors surface - receptors: kinases, phosphatases and GC activities, ligandgated ion channels, transport next lecture Transducer, comparator, amplifier, crosstalk Gs AC ---> camp ----> PKA ----> intermediaries pump channel enzyme Gi AC ---> camp ----> PKA ----> intermediaries nucleus Membrane eceptors E mna Golgi recycled or destroyed Lysosomes surface - receptors: kinases, phosphatases and GC activities, ligandgated ion channels, transport next lecture next lecture c e l l m e m b r a n e Transducer, comparator, amplifier, crosstalk Gs AC ---> camp ----> PKA ----> intermediaries pump channel enzyme Gi AC ---> camp ----> PKA ----> intermediaries Page 4

5 Nuclear eceptors gene, exons, introns cis - acting, trans - acting transcription, translation splicing NA cap polya tail Hormonal action can be regulated at the level of transcription, translation, NA turnover, protein turnover, and post - translational modification. Nuclear eceptor Structure NH 2 DNA binding region Hormone binding region COOH E P COT T T Vit D Page 5

6 Zinc Fingers Structure Transcription Factors Structure Page 6

7 Transcription and Acetylation Transcription and Methylation DNMT, DNA methyl! transferase! DNMT and a TF,! transcription factor! TGS, transcriptional! gene silencing! DNA methylation is a phenomenon occurring on the DNA known to consist of four bases. One of them, cytosine, exists in a "normal" and in a methylated version, ie with a methyl group attached, but only when directly followed by the base guanine. The consequences of methylation lie in the of gene expression: methylated cytosines in the promotor region of a gene lead to inactivation, thus acting as an "on" and "off" switch for genes. This is a naturally occurring mechanism to prevent all genes in a tissue/cell to be expressed at a time. As all cytosines in a CG context (ie in front of a guanine) are known, it is possible to analyze the patterns of methylated and unmethylated cytosines in the genome and to identify the pattern that is typical for a specific tissue and type of disease. Once differentially methylated cytosines for a certain disease are known, their detection enables an exact diagnosis at a very early stage, molecular classification and the likely reaction of a patient to treatment. Epis can obtain this information based on its robust proprietary technology.#! Page 7

8 Nuclear eceptor for Steroids H Intracellular receptors for s are transcription factors. Their Zn fingers are binding regions which attach to the promotor segment of DNA H H H HSP 90 HSP 90 Zn Zn H E Zn TATA box NA Pol II HSP 90 HSP 90 D N A Nuclear eceptor for T3 Hormone inactive transcription T3 empty binding site H E T3 co-repressor NH2 COOH TFIIB TATA box NA- Pol II D N A co-repressor active transcription T3 T3 H E T3 COOH NH2 TFIIB TATA box NA- Pol II D N A Page 8

9 Nuclear eceptor for T3 Hormone In its free state T3 binds to its HE as homo-dimer, or as a hetero-dimer with retinoid-x (e.g. Vit A). The carboxy-terminus of T3 interacts with TFIIB preventing the formation of a stable preinitiation complex and, together with a co-repressor, silences transcription. Upon T3 binding, its receptor undergoes a conformational change ( magic ), dissociation of the co-repressor, a decreased interaction of the T3 with the carboxy-terminus TFIIB and an increase interaction of the T3 amino-terminus with TFIIB. These changes facilitate TFIIB binding an assembly of a stable pre-initiation complex, the binding of NA polymerase II and the activation of transcription initiation. Efficiency, permissiveness Na / K pump camp ----> PKA ----> channel / enzyme AC Protein synthesis XX1 HE 5 3 E1 mna Cellular response S Steroid S > S DNA additional transcription factor Page 9

10 Permissive Action Action on specific mna synthesis could cause an increase in the number of membrane receptors, which might increase the production of cyclic nucleotides, thus leading to an increase cellular response to hormones acting on the plasmalemma. Thyroid or hormones could increase or decrease the amount of cyclic nucleotide - dependent protein kinases PK or amount of substrate available for phosphorylation by camp or cgmp - dependent PK. Thyroid and hormones could enhance the synthesis of a protein that could act as an inhibitor of another protein (e.g.. phosphoprotein phosphatase) whose action is antagonistic to cyclic nucleotide action. Pathologies Theoretically, genetic pathologies can be associated with each step of the biosynthetic pathway leading to the production of a particular enzyme or protein. congenital adrenal hyperplasia due to gene deletion or to point mutation of the 21 - hydroxylase enzyme ( beard lady ). testicular feminization due to point mutations scattered throughout the androgen receptor gene, cause decrease amounts of functional androgen receptors, altered sexual differentiation &feed-back ( beware of single bars ). Vit D - dependent rickets due to a single point mutation in tip of one of thedna - Zn fingers binding domain of Vit D receptor, thus making it unable to interact and transcriptionally regulate Vit D - responsive genes ( link to rickets and osteoporosis ). Page 10

11 eview of the mechanism of action of intracellular receptors in For example, lecture) peptide out Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Page 11

12 Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Page 12

13 Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) Consensus gene encoding a prototypical peptide hormone Page 13

14 Consensus gene encoding a prototypical peptide hormone For example, in lecture) peptide out Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) peptide out Consensus gene encoding a prototypical peptide hormone Page 14

15 Consensus gene encoding a prototypical peptide hormone For example, in lecture) peptide out Consensus gene encoding a prototypical peptide hormone Consensus gene encoding a prototypical peptide hormone For example, in lecture) peptide out Consensus gene encoding a prototypical peptide hormone Page 15

16 Endocrine Physiology levels of organization! structure! - function! homeostatic!! Potential control points for of gene expression in hormone production effector hormone Page 16

17 Models for activation of gene expression Cis model consensus gene Trans model Mechanisms of transcriptional repression Competition Sequestration Quenching / tethering Active ( or fat Albert and the buck - buck game ) Page 17

18 Activation of specific transcription factors by s Cell-surface receptor coupled signal transduction pathways involved in activation of nuclear transcription factors Page 18

19 Cell-surface receptor coupled signal transduction pathways involved in activation of nuclear transcription factors Page 19

Mechanism of action-1

Mechanism of action-1 Mechanism of action-1 receptors: mediators of hormone action, membrane associated vs. intracellular receptors: measurements of receptor - ligand interactions, regulation mechanisms surface - receptors:

More information

Section C: The Control of Gene Expression

Section C: The Control of Gene Expression Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from

More information

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.

CELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone

More information

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268

DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268 DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:

More information

Control of Eukaryotic Gene Expression (Learning Objectives)

Control of Eukaryotic Gene Expression (Learning Objectives) Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Quick Review of Protein Synthesis

Quick Review of Protein Synthesis Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help

More information

Genetics Biology 331 Exam 3B Spring 2015

Genetics Biology 331 Exam 3B Spring 2015 Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

30 Gene expression: Transcription

30 Gene expression: Transcription 30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression 1 How Gene Regulation Works 2 Control of Gene Expression Controlling gene expression is often accomplished by controlling transcription initiation Regulatory proteins bind to

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

GENETICS - CLUTCH CH.10 TRANSCRIPTION.

GENETICS - CLUTCH CH.10 TRANSCRIPTION. !! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types

More information

Lecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex

Lecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription

More information

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Synthetic cells: do bacteria need all its genes? No.

Synthetic cells: do bacteria need all its genes? No. NO NEED TO REFER TO THE SLIDES. بسم هللا الرحمن الرحيم Do we need all the non coding regions of the DNA? Two weeks ago, they discovered that the genome of a plant is very small (recall that plant genome

More information

Molecular Biology (BIOL 4320) Exam #1 March 12, 2002

Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.

More information

Gene Expression and Regulation - 1

Gene Expression and Regulation - 1 Gene Expression and Regulation - 1 We have been discussing the molecular structure of DNA and its function in DNA replication and in transcription. Earlier we discussed how genes interact in transmission

More information

REGULATION OF GENE EXPRESSION

REGULATION OF GENE EXPRESSION REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the

More information

Chapter 11. Transcription. The biochemistry and molecular biology department of CMU

Chapter 11. Transcription. The biochemistry and molecular biology department of CMU Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes

32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes 3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific

More information

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory

Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites

17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites

More information

Gene Expression. Lesson 6

Gene Expression. Lesson 6 Gene Expression Lesson 6 Regulation of gene expression Gene regulation turning on or off specific genes depending on the requirements of an organism Housekeeping genes are always switched on (vital life

More information

Gene expression DNA RNA. Protein DNA. Replication. Initiation Elongation Processing Export. DNA RNA Protein. Transcription. Degradation.

Gene expression DNA RNA. Protein DNA. Replication. Initiation Elongation Processing Export. DNA RNA Protein. Transcription. Degradation. Gene expression DNA RNA Protein DNA DNA Degradation RNA Degradation Protein Replication Transcription Translation Initiation Elongation Processing Export Initiation Elongation Processing Targeting Chapter

More information

Gene Expression: From Genes to Proteins

Gene Expression: From Genes to Proteins The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

REGULATION OF GENE EXPRESSION

REGULATION OF GENE EXPRESSION REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

Transcription & post transcriptional modification

Transcription & post transcriptional modification Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity

More information

Introduction to Genome Biology

Introduction to Genome Biology Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure

More information

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11 Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Biol 3301 Genetics Exam #2A October 26, 2004

Biol 3301 Genetics Exam #2A October 26, 2004 Biol 3301 Genetics Exam #2A October 26, 2004 This exam consists of 40 multiple choice questions worth 2.5 points each, for a total of 100 points. Good luck. Name SS# 1. Which of the following statements

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Chapter 3. DNA, RNA, and Protein Synthesis

Chapter 3. DNA, RNA, and Protein Synthesis Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription

More information

Differential Gene Expression

Differential Gene Expression Developmental Biology Biology 4361 Differential Gene Expression October 13, 2005 core transcription initiation site 5 promoter 3 TATAT +1 upstream downstream Basal transcription factors (eukaryotes) TFIID

More information

Transcription. By : Lucia Dhiantika Witasari M.Biotech., Apt

Transcription. By : Lucia Dhiantika Witasari M.Biotech., Apt Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

7.06 Cell Biology QUIZ #3

7.06 Cell Biology QUIZ #3 Recitation Section: 7.06 Cell Biology QUIZ #3 This is an open book exam, and you are allowed access to books and notes, but not computers or any other types of electronic devices. Please write your answers

More information

The Stringent Response

The Stringent Response The Stringent Response When amino acids are limiting a response is triggered to shut down a wide range of biosynthetic processes This process is called the Stringent Response It results in the synthesis

More information

Regulation of Gene Expression

Regulation of Gene Expression Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Gene regulation V Biochemistry 302. March 6, 2006

Gene regulation V Biochemistry 302. March 6, 2006 Gene regulation V Biochemistry 302 March 6, 2006 Common structural motifs associated with transcriptional regulatory proteins Helix-turn-helix Prokaryotic repressors and activators Eukaryotic homeodomain

More information

Structure/function relationship in DNA-binding proteins

Structure/function relationship in DNA-binding proteins PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA

More information

Translation Mechanisms

Translation Mechanisms Translation Mechanisms Biology I Hayder A. Giha Translation The translation is the process of protein synthesis, where information in nucleotides sequences of a mrna is translated into amino acids sequence

More information

EUKARYOTIC GENE CONTROL

EUKARYOTIC GENE CONTROL EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic

More information

C2006/F2402 '14 OUTLINE OF LECTURE #12

C2006/F2402 '14 OUTLINE OF LECTURE #12 C2006/F2402 '14 OUTLINE OF LECTURE #12 (c) 2014 Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 03/04/2014 03:24 PM Handouts: 12-A -- mrna processing 12-B -- Alternative processing

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

Judy Wieber. Department of Computational Biology. May 28, 2008

Judy Wieber. Department of Computational Biology. May 28, 2008 Review III: Cellular Processes Judy Wieber BBSI @ Pitt 2008 Department of Computational Biology University it of Pittsburgh School of Medicine i May 28, 2008 Outline Metabolism Cell cycle Transcription

More information

Chapter 18: Regulation of Gene Expression

Chapter 18: Regulation of Gene Expression Chapter 18: Regulation of Gene Expression Regulation of Metabolism Shuts off transcription Types of Feedback Negative feedback = body s response is to reduce the stimulus Ex: regulation of body temp, blood

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Chapter 4: How Cells Work

Chapter 4: How Cells Work Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:

More information

Chapter 4: How Cells Work

Chapter 4: How Cells Work Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription: Sending the

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

GENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/

GENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/ 1 GENES AND CHROMOSOMES V Lecture 7 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University 2 CELL NUCLEUS AND THE CONTROL OF GENE EXPRESSION An Overview of Gene Regulation in Eukaryotes

More information

Chapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017

Chapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017 Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

M1 - Biochemistry. Nucleic Acid Structure II/Transcription I

M1 - Biochemistry. Nucleic Acid Structure II/Transcription I M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) to allow RNA polymerase continuous access

Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) to allow RNA polymerase continuous access Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) 1 This print-out should have 34 questions. Multiple-choice questions may continue on the next column or page find all choices

More information

Control of Metabolic Processes

Control of Metabolic Processes Control of Metabolic Processes Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College As described earlier, the metabolic processes occurring within living organisms (glycolysis, respiration,

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Chapter 14 Regulation of Transcription

Chapter 14 Regulation of Transcription Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription

More information

Chapter 3 Nucleic Acids, Proteins, and Enzymes

Chapter 3 Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Molecular Genetics of Disease and the Human Genome Project

Molecular Genetics of Disease and the Human Genome Project 9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit

More information

Chapter 2. An Introduction to Genes and Genomes

Chapter 2. An Introduction to Genes and Genomes PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION

More information

DOWNLOAD OR READ : EXAMPLES OF REGULATORY PROTEINS THAT CONTROL THE CELL CYCLE PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : EXAMPLES OF REGULATORY PROTEINS THAT CONTROL THE CELL CYCLE PDF EBOOK EPUB MOBI DOWNLOAD OR READ : EXAMPLES OF REGULATORY PROTEINS THAT CONTROL THE CELL CYCLE PDF EBOOK EPUB MOBI Page 1 Page 2 examples of regulatory proteins that control the cell cycle examples of regulatory proteins

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information