We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method

Size: px
Start display at page:

Download "We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method"

Transcription

1 Supplementary Material and Methods Quantitative RT-PCR (qrt-pcr) We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma cell lines and melanocytic tumors from RET-mice in accordance with the method previously described (10). The primer sequences for murine total Espin (detection of all Espin isoforms) were 5 -GCCTGGAGACGAGACAT-3 (forward) and 5 -AAGATGACCTGTCGCTG-3 (reverse) and those for glyceraldehydes-3-phosphate dehydrogenase (Gapdh) were 5 -CAAGAAGGTGAAGCA-3 (forward) and 5 -CCAGGAAATGAGCTTGCAC-3 (reverse). To clarify the expression of Espin isoforms, pairs of specific probes (Universal Probe Library: Roche) and primers were prepared. The Universal Probe Library system is based on TaqMan Probe technology. The expression levels of Espin isoforms and total Espin measured by real-time qrt-pcr were adjusted by the expression level of Gapdh. The probe and primer sequences were indicated probe number 83, 5 -TGCAGTGGCTGCTCACAC-3 (forward) and 5 -GGACTGTGGCACCAGAGTTATC-3 (reverse) for primer set 1, probe number 32, 5 -GAGGTGGACTCGCTCAAGG-3 (forward) and 5 -GCTTTGGAGTCCGCTGAG-3 (reverse) for primer set 2A-A, probe number 96, 5 -GGAGGTGGACTCGCTCAA-3 (forward) and 5 -CTCCGAATCCTGCCTGAG-3 (reverse) for primer set 2B-B, probe number 102, 5 -TCTAGGTGGGGGCCGTAT-3 (forward) and 5 -GTCGGCTTCAGGCTCTTG -3 (reverse) for primer set 4, and probe number 9, 5 -AGCTTGTCATCAACGGGAAG-3 (forward) and 5 -TTTGATGTTAGTGGGGTCTCG-3 (reverse) for primer set for Gapdh. Construction of plasmids. 1

2 Murine Espin-3A full-length cdna (GeneBank accession number: AY587570) was obtained by RT-PCR using KOD FX high fidelity DNA polymerase (TOYOBO) from RNAs extracted from the murine melanoma cell line B16F1 and murine testis organ. The Espin-3A cdna was inserted into Entry-Vector and converted to several expression vectors using the Gateway system (Invitrogen) according to the manufacturer s protocol. The p-dest17 (N-terminus 6xHis-Tag) expression vector was used for E. coli (DH5α and BL21) expression. All plasmids were sequenced. Immunoblotting. Western blotting was performed by the method previously described (Thang ND., PLoS One. 2011;6:e25636.). An anti-espin-ru rabbit polyclonal antibody was developed using peptides (SSSSTGSTKSFN) in this study (Supplementary Fig. S1). The anti-espin-ru rabbit polyclonal antibody recognized the sequences between exon r and u except for exon s and t products in Espin (Supplementary Figure S1), which are common in humans and mice. The sequences of exon s were original sequences in Espin isoforms 1, 2A and 2B. The peptides of exon t were original sequences in Espin isoform 4. Therefore, this antibody can detect only Espin isoforms 2A 2B 3A and 3B. The antibody IgG species were purified by using a Melon Gel IgG purification Kit (PIERCE) according to the manufacturer s protocol. Detection of Espin-3A protein by the antibody was confirmed (Supplemental Figure 3). Rabbit polyclonal antibodies against phosphorylated tyrosine 397 in FAK (Invitrogen) and phosphorylated tyrosine 181 in Paxillin (EPITOMICS) and mouse monoclonal antibodies against Gapdh (Cell Signaling Technology, Inc.), FAK (BD Transducton Laboratories), Vinculin (SIGMA) and Paxillin (BD) were used as primary antibodies. For detection of 6xHis fusion protein, a Universal His Western blot Kit (Clontech) was used according to the manufacturer s protocol. Densitometric evaluation 2

3 was performed using the software program WinROOF (MITANI Corporation) according to the method previously described (Yajima I et al., Arch Toxicol. 2012;86: ). Establishment of shrna-stable clones. Stable Espin knockdown clones were established by the method previously described (Song JH et al., Cancer Res. 2007;67: ) with some modifications. Briefly, Mel-ret cells were transfected with prnat-u6.1/neo sirna expression plasmid (GeneScript Corporation) containing a GFP expression gene with either sirna targeting Espin or a scrambled control sequence. The targeted sirna sequences were 5 -CAACGGGUGAUAACUCAGAGCUUCU-3 for the murine Espin sirna sequence and 5 - CAAGUGGAAUAACUCCGAGUGCUCU-3 for the control sirna sequence (only sense sequences shown). GFP-positive cells were collected by a cell sorter (Becton-Dickison) after selection of stable clones. Rho kinase activity determined by a pull-down assay Pull down assays were performed by using RhoA and Rac1 Activation Assay Kits (CELL BIOLABS) according to the manufacturer s protocol. shrna stably expressed Mel-ret cells were seeded on type I collagen (10 µg/ml)-coated 10 cm culture plates. The subconfluent cells were lysed, and then GTP-bound active RhoA was pulled down by Rhotekin Rho-binding domain agarose beads and GTP-bound active Rac1 was pulled down by PAK1 p21-binding domain agarose beads. Cell lysates in a buffer (25mM HEPES ph 7.5, 150 mm NaCl, 1% Nonidet P-40, 10 mm MgCl2, 1 mm EDTA, 2% glycerol) plus protease inhibitors and the pull-down fraction were separated on 12% SDS-polyacrylamide gels, transferred to nitrocellulose membranes, and then immunoblotted with anti-rhoa and anti-rac1 mouse monoclonal antibodies. 3

4 Immunofluoresense Mel-ret cells were plated on type I collagen (10 µg/ml)-coated glass dishes (Nunc). Cells were fixed with 4% paraformaldehyde (PFA) in posphate buffered saline (PBS) and treated with 0.1% Triton X-100/PBS followed by blocking with 1% bovine serum albumin/pbs. Cells were labeled with anti-espin-ru polyclonal antibody diluted 1: 100 and then labeled with Alexa-488 conjugated anti-rabbit IgG secondary antibody diluted 1: 1000 (Invitrogen). Cell cytoskeleton F-actin was labeled with Alexa-568-conjugated phalloidin. Fluorescence was examined using a confocal laser-scanning microscope (Fluoview FV1000 software, Olympus MF1000). Alexa568 signal (red) was converted to magenta color by Adobe Photoshop software. Immunohistochemical staining Immunohistochemical staining was performed on formalin-fixed, paraffin-embedded sections (3 µm in thickness) of human melanocytic nevi and melanoma. Human tissue array slides were deparaffinized in xylene and dehydrated through a graded series of alcohols and then boiled at 95 degrees in 0.01 M citrate acid buffer (ph6.0) for 20 minutes. For de-melanization, slides were treated with 0.25% KMnO4 in H2O for 60 minutes and then treated with 5% oxalic acid for 5 minutes. The slides were incubated in 3% H2O2 in methanol for 15 minutes and were blocked by 1.5% normal goat serum in PBS for 20 minutes. Anti-Espin-ru polyclonal antibody was diluted at 1:50 for 60-minute incubation. Biotinylated anti-rabbit IgG secondary antibody was reacted at a dilution of 1:150 for 30 minutes. Then the slides were stained using the avidin-biotin complex immunoperoxidase method (Vector VIP substrate kit: Vector). Counterstaining was performed using methyl green (Vector). Slides were rinsed with PBS after each stage of the 4

5 procedure. Visible tumors (GFP-positive) and the lungs were excised for histological examination on our xenograft study. Harvested tissues were fixed in 4% PFA, embedded in paraffin and sectioned at 5 μm, and then HE staining was performed. Statistical analysis Statistical analysis in this study was performed according to the method previously described (Kato M et al., Cancer Epidemiol Biomarkers Prev 2011;20: ). Results from more than three independent experiments in each group were statistically analyzed by Student's t-test. In the case of ESPIN immunohistochemistry in human melanocytic lesions, statistical significance of ratio was determined by Fisher s exact test. We used the SPSS (version 18) software package (SPSS Japan Inc.) for statistical analyses, and the significance level was set at p<

Cdc42 Activation Assay Kit

Cdc42 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Supplemental data. Supplemental Materials and Methods

Supplemental data. Supplemental Materials and Methods Supplemental data Supplemental Materials and Methods Transfection of plasmid. Transfection of plasmids into FRTL5 cells was performed using Lipofectamine LTX with Plus reagent (Invitrogen) according to

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

Gα 13 Activation Assay Kit

Gα 13 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product

More information

Arf6 Activation Assay Kit

Arf6 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product

More information

RhoC Activation Assay Kit

RhoC Activation Assay Kit Product Manual RhoC Activation Assay Kit Catalog Number STA-403-C 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1

More information

Rab5 Activation Assay Kit

Rab5 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,

More information

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification

More information

Description of supplementary material file

Description of supplementary material file Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information

More information

Gα i Activation Assay Kit

Gα i Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product

More information

RheB Activation Assay Kit

RheB Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides Supplementary Note Rationale for Morpholino based inhibition of Nodal expression Nodal expression was directly inhibited using antisense Morpholino oligonucleotides (MO Nodal ) fluorescently labeled with

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 κ 100 µl,

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding

More information

A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm

A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm Supplementary Material and Methods Real-time luciferase gene expression in A549-luc cells A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm dishes (100,000 cells/dish),

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK

More information

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology

More information

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

Supporting Information

Supporting Information Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased

More information

Rapid and sensitive determination of recombinant protein expression

Rapid and sensitive determination of recombinant protein expression APPLIAION NOE Pro-Detect Rapid assays Rapid and sensitive determination of recombinant protein expression Introduction Recombinant protein expression and purification is a multistep process that includes:

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom

More information

For Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2,

For Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2, Western blot assay For Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2, 150 mm NaCl, 1% NP40, 0.1% SDS, 0.5% DOC, 1 mm PMSF, 25 mm MgCl 2, and supplemented with a phosphatase

More information

supplementary information

supplementary information DOI: 10.1038/ncb1862 Figure S1 Identification of SCAI as a Dia1 associating factor. (a) Identification of SCAI (Riken cdna 930041I02) as a Dia1-FH3 interacting protein. Mouse brain lysate was incubated

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

More information

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin- Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,

More information

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.

More information

1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml

1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml Western Blot Antibodies: 1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml 2. Goat Anti-human LAP (TGF-b1) Antibody, R&D Systems (cat #AF-246-NA), 0.1-0.2 ug/ml 3. Rabbit

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

More information

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for

More information

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive

More information

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were

More information

Supplementary Material - Methods

Supplementary Material - Methods Novel Protein-Protein Interactions in the Schizophrenia interactome Supplementary Material - Methods Experimental validations of predicted interactions Table S1-1: Protein pairs that were validated by

More information

Supporting Information

Supporting Information Supporting Information Deng et al. 10.1073/pnas.1515692112 SI Materials and Methods FPLC. All fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20),

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Anti-HB-EGF (Human) mab

Anti-HB-EGF (Human) mab Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1

More information

SUPPLEMENTARY INFORMATION FIGURE 1 - 1

SUPPLEMENTARY INFORMATION FIGURE 1 - 1 SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant

More information

Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:

Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures: Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:

More information

ab G alpha i Activation Assay Kit

ab G alpha i Activation Assay Kit ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version

More information

Hypoxyprobe Plus Kit

Hypoxyprobe Plus Kit Updated 2017 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Plus Kit (HPI Part # HP2-XXX) Kit contents: Solid pimonidazole HCl (Hypoxyprobe

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

Post-translational modification

Post-translational modification Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample

More information

Checkpoint Kinase Activity Immunoblot Kit

Checkpoint Kinase Activity Immunoblot Kit Product Manual Checkpoint Kinase Activity Immunoblot Kit Catalog Number STA- 413 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a protein phosphatase responsible

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Svegliati Baroni S, Santillo M, Bevilacqua F, et al. Stimulatory

More information

supplementary information

supplementary information DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized cells were

0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized cells were 1 Supplementary Methods Immunohistochemistry EBC-1 cells were fixed in 4% paraformaldehyde for 15 min at room temperature, followed by 0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Scher HI, Lu D, Schreiber NA, et al. Association of on circulating tumor cells as a treatment-specific biomarker with outcomes and survival in castration-resistant prostate

More information

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1, Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected

More information

Hypoxyprobe -1 Green Kit Kit contents:

Hypoxyprobe -1 Green Kit Kit contents: Updated 2015 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe -1 Green Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC conjugated

More information

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

More information

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq

More information

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

Anti-p62 C-terminal pab

Anti-p62 C-terminal pab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-p62 C-terminal pab CODE No. CLONALITY Polyclonal ISOTYPE Guinea pig Ig, affinity purified QUANTITY 100 µl SOURCE IMMUNOGEN FORMURATION

More information

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells

A Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)

More information

Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature

Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody

More information

Journal of Cell Science Supplementary Material

Journal of Cell Science Supplementary Material 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

More information