Loop-Mediated Isothermal Amplification (LAMP) Primer Design and Assay Optimization

Transcription

1 Loop-Mediated Isothermal Amplification (LAMP) Primer Design and Assay Optimization Tony Rockweiler, Diagnostic Research Scientist, Lucigen March,

2 Agenda LAMP Overview Review the mechanics of LAMP Examine the primers required and their design Learn how to adjust software settings for better primer design Demonstrate the effects of optimizing primer design on LAMP assay results Explore additional ways to optimize LAMP assays

3 Introduction to LAMP 1. Amplification takes place at a single temperature (No need of a thermal cycler) 2. Uses a polymerase with high strand displacement activity (instead of Taq Polymerase) 3. Amplification is rapid (factorial as opposed to exponential in PCR) 4. Can be used for RNA templates by addition of reverse transcriptase (RT) or by using an enzyme with both RT and DNA polymerase activities

4 LAMP vs. PCR PCR LAMP 1. Requires temperature cycling Isothermal single temperature 2. Requires 2 primers Requires 6 primers 3. Slow: Typically >1hr Rapid: Typically <30 min 4. Typical yield ~ 0.2 mg Typical yield ~ mg 5. Not amenable to visual detection 6. Sensitive to sample matrix inhibitors Amenable to visual detection based on turbidity etc. Tolerant to sample matrix inhibitors 7. Can be multiplexed Difficult to multiplex

5 LAMP vs. PCR LAMP has Some Advantages Over PCR Advantages Rapid Sensitive and Specific Isothermal Less Instrument Constraints Disadvantages More Difficult Primer Design Most Detection Methods are not Sequence- specific Difficult to Run Multi-plex LAMP LAMP Products are not Suitable for Down Stream Applications (i.e. cloning, sequencing)

6 Applications LAMP is Ideal for Certain Applications LAMP is Applicable for: Detection Point-of-Care or Field Based Detection Limited Resource Settings Small Test Menu Rapid Testing LAMP is Inappropriate for: Large Test Menu Detection of Un-sequenced Targets

7 Use in Diagnostics Speed and Simplified Instruments Make LAMP Well-suited to MDx Applications Applications: Point of Care or Point of Collection (POC) testing Molecular diagnostics: e.g. infectious diseases, human or veterinary Food testing Environmental testing (e.g. Zika in mosquitos) Research applications (infectious disease research)

8 LAMP Workflow Easy with Low Complexity Instrumentation Sample Heat lysis/ NA extraction 5-15 min Amplification 30 min Detection Real time or end point

9 Detection of RNA (or DNA) Amplified by LAMP Fluorescent Detection Methods are More Sensitive Fluorescent Detection (dsdna binding Dye) Fluorescent Signal Signal Threshold Reaction Time TTRs (time where arrows cross threshold) Time to Result (TTR) Time to Threshold (TTT) or Time to Result (TTR) provides a quantitative measure of assay performance Fluorescent detection can be performed as: o End-point assay/measurement o Real-time measurement (shown on left)

10 LAMP Primers Inclusion of Loop Primers Improves LAMP Results Figure: FIP (Forward Inner Primer) F3 (Forward Outer Primer) FL (Forward Loop Primer) BIP (Backward Inner Primer) B3 (Backward Outer Primer) BL (Backward Loop Primer)

11 Amplification Intermediates Key Stem Loop DNA Structure Figure:

12 Amplification Products Generation of Multimeric DNAs with Inverted Repeats During Cycling Amplification Cycling Amplification Steps Figure:

13 Primer Design Overview Key Factors Include Tm, Length and Distances Primer(s) Length (mer) Tm ( C) Distances F3/B (F2/B2) nt F2/B Loop (F1C-F2) 40-60nt F1c/B1c FL/BL F2-F3 F1c-B1C 0-60nt 0-100nt

14 Basic Primer Design Guidelines Multiple Characteristics Influence Primer Performance Primers are specified 5 to 3, left to right % GC Content Amplicon 280 base pairs Avoid runs of 3 or more of one base, or dinucleotide repeats (e.g. ACCC or ATATATAT), both can cause mis-priming. Runs of 3 or more Gs (AGGG) may cause issues with synthesis and HPLC purification. Primer pairs should have similar Tms with a maximum difference of 5 C and should not be complementary to each other.

15 Basic Primer Design Guidelines continued Avoid regions of secondary structure; namely intra-primer homology (more than 3 bases that complement within the primer) or inter-primer homology (forward and reverse primers having complementary sequences). In general, select the largest ΔG value for dimer analysis minimum of 3.5 for optimal design. Select the smaller ΔG value for the ends of primers maximum of -4 for optimal design. (ΔG limits are suggestion for PrimerExplorer) For hairpins, the melting temperature (Tm) should be lower than the annealing temperature for the reaction; on average it should range between 55 C and 65 C. The Tm for the strongest hairpin should be at the very least 50 C and below the annealing temperature.

16 Additional Tips Poly T linkers- e.g. GGCACATGGTCCCGTTCCTGATTTTTTAGCGCCAGACGGGATTCG Some reports suggest the addition of a Poly T linker in the FIP and BIP between F2-F1C and B2-B1C can improve loop formation and reaction speed. Mutations Preferred not to have a mutation within a primer Primer location least impacted by having a mutation 5 ends of F3, B3, F2 and B2 3 ends of F1C and B1C Internal regions Degenerate Nucleotides A degenerate primer is a mix of oligonucleotide sequences in which some positions contain a number of possible bases.

17 Choosing Your Target Sequence Proper Selection Ensures the Reaction will Detect Exactly What is Desired Strain to Strain Variation Bacteria and viruses often have high sequence variation from strain to strain. To detect all strains of interest, select a footprint that is conserved across strains (variants) to avoid false negatives. Closely Related Organisms Closely related organisms likely to be found in the sample need to be evaluated and care taken not to choose a conserved gene that is very similar to avoid false positives.

18 To Detect Multiple Related Strains, Homologous Regions Across Strains Should be Chosen as Primer Design Targets

19 Primers Designed Across Heterogenous Region Will Decrease Sensitivity for Detecting Related Strains

20 Multiple Primers Sets or Degenerate Primers can be Used to Achieve Desired Multi-strain Detection IUPAC Code R R R Y

21 Avoiding Closely Related Organisms Use BLAST to Check for Specificity BLAST Blast analysis will show if the sequence you have picked is highly conserved across other organisms. BLAST however is limited in it will only analyze species where sequence data has been deposited and should not be relied upon for specificity. BLAST results Summary, Top 100 Hits LAMP Target % Coverage Total Score Expect Value Database Target Nontargetargetarget Non- Non- Target Target DENV E DENV 2 66 None 67.5 None None DENV 3 64 None 69.3 None 7.00E-04 None DENV 4 64 None 67.4 None 0.01 None ZIKAV E CHIKV 66 None None 5.00E-04 None Results: None of the non-specific targets has enough identity to cross react with the LAMP primer designs

22 Eiken - PrimerExplorer v5 Most Widely Used Software to Design LAMP Primers Available for free via a web based portal on Eiken s website ( ) Limitations Doesn t design loop primers concurrently; requires a second serial primer design execution. Occasionally doesn t allow for the design of one or both loop primers Allows for only up to 2000 bp sequences Doesn t support IUPAX characters other than ATCG, therefore doesn t handle multi-sequence alignments representations Limited to a single execution process Outputs only HTML

23 Eiken - PrimerExplorer v5 Uploading Your Target Sequence

24 Eiken - PrimerExplorer v5 Primer Design Settings

25 Eiken - PrimerExplorer v5 Avoiding Mutations/Mismatches in Your Primer Design

26 Eiken - PrimerExplorer v5 Common vs Specific Primers Common: When avoiding mutations is not possible, primers are designed allowing the inclusion of mutations. The inclusion at the following locations will allow for the detection of both mutant and wild type. 5 ends of F3, B3, F2 and B2 3 ends of F1C and B1C Internal regions Specific: When mutant and wild type need to be distinguished, primers are designed with the mutation in the locations below. 5 end of F1c or B1c 3 end of F2 or B2 3 end of F3 or B3

27 Eiken - PrimerExplorer v5 Common vs Specific Primers

28 Eiken - PrimerExplorer v5 Software Adjusts Primer Location Based on Design Settings Default designs Common designs Specific designs

29 Eiken - PrimerExplorer v5 Select the Largest ΔG Value for Dimerization

30 Eiken - PrimerExplorer v5 ΔG for the Ends of the Primers Less than -4 Should be Discarded Check the stability of the following regions to confirm that the ΔG is < -4.0 kcal/mol: the 3 end at the region F2 the 5 end at the region F1c the 3 end at the region B2 the 5 end at the region B1c

31 Eiken - PrimerExplorer v5 Designing Loop Primers

32 Eiken - PrimerExplorer v5 Designing Loop Primers

33 Eiken - PrimerExplorer v5 Select the largest ΔG value for dimerization

34 Eiken - PrimerExplorer v5 Select Loop Primers with the Highest 3 End Stability WINNER!

35 What if I don t get any designs or too many? Change Some of the Design Parameters 1. Change the distance between F3 and B3, and/or F1c and F2 2. Change the GC% setting 3. Change the target range by selecting on the sequence box and click on "within F2-B2" or "between F1c-B1c" (if you are setting the range) 4. Select a different target site

36 Eiken - PrimerExplorer v5 Selecting Detailed Setting Provides Design Parameter Flexibility

37 Premier Biosoft Alternative Design Software Provides a Simpler Solution Available for purchase Does not have the limitations of the Eiken Software Automatically interprets BLAST search results Free energies can be checked for multiplexing Local database and project to project management ( )

38 Lucigen LAMP Products Product Cat No. LavaLAMP DNA Master Mix / LavaLAMP DNA Component Kit / LavaLAMP RNA Master Mix / LavaLAMP RNA Component Kit / OmniAmp RNA & DNA LAMP Kit /2

39 LavaLAMP DNA/RNA Master Mixes Sensitive & Fast RNA LAMP in a Master Mix Format Master Mix Format: Streamlines reaction setup while reducing potential handling errors Minimal Optimization: Focuses optimization on the two critical reaction parameters - primer design and reaction temperature Lyophilization-ready: Avoids redesign of assays to remove components known to inhibit lyophilization all components are lyophilization-compatible Higher Reaction Temperature (68 C 74 C): Improves primer specificity and reduces background amplification depending on the target. Customizable: Once primers are optimized with the LavaLAMP Master Mix, we can work with you and your customers to generate bulk reagents that match their specific needs

40 LavaLAMP DNA/RNA Component Kits Fast, Sensitive, Thermostable LAMP in Fully Optimizable Kit Format C Reaction Temperature: Reduces background amplification and improves primer specificity depending on the target Lyophilization-ready: Component formulations enable generation of room temperature stable test kits through lyophilization Custom/Bulk Available: Custom volumes and dispensing available to match your specific requirements Equivalent Performance to the LavaLAMP DNA/RNA Master Mix When LavaLAMP DNA/RNA Component Kit and Master Mix reactions are formulated identically Provides a reference point same results when switching from the LavaLAMP DNA Master Mix or RNA Master Mix to either of the component kits for additional optimization experiments

41 LavaLAMP Enzymes vs. Bst-like Enzymes Enzymes have Different Temperature Optima PrimerExplorer ( ) LAMP Designer ( ) Both software were designed with Bst or Bst like enzyme in mind Bst and Gsp DNA polymerase works best around 60 C-65 C LavaLAMP enzymes works best around 68 C-74 C

42 Not All Primer Designs Work with Every Enzyme Time to Result (min) 70 Example 1: Published Primers No Template Control Positive Assay Temperature Time to Result (min) Example 2: Published Primers No Template Control Positive Assay Temperature

43 What is the optimum LAMP primer Tm for LavaLAMP Enzyme? Set I A, B, C Set II D, E, F Set III G, H, I Set IV J, K, L Set V M, N, O Set VI P, Q, R Set VII S, T, U F1c and B1c 59 C 61 C 63 C 65 C 67 C 69 C 71 C F3, F2, B3 and B2 54 C 56 C 58 C 60 C 62 C 64 C 66 C FL and BL 56 C 58 C 60 C 62 C 64 C 66 C 68 C Default settings, Normal GC Content

44 Positive Reactions by Assay Temperature Increased Tm Setpoint has Faster and More Consistent Times to Result for Positive Samples Across Multiple Designs Group I (Tm=59) Group IV (Tm=65) Group VII (Tm=71)

45 Negative Reactions by Assay Temperature Increased Tm Setpoint More Consistent Times to Result for Negative Samples Across Multiple Designs Group I (Tm=59) Group IV (Tm=65) Group VII (Tm=71)

46 TTR Difference (NEG-POS) by primer Tm Increased Tm Setpoint has Improved Resolution Between Negatives and Positives Better separation

47 What is the optimum LAMP primer Tm for LavaLAMP Enzyme? Increasing Tm Setpoints by as much as 6 can Improve Primer Designs Set I A, B, C Set II D, E, F Set III G, H, I Set IV J, K, L Set V M, N, O Set VI P, Q, R Set VII S, T, U F1c and B1c 59 C 61 C 63 C 65 C 67 C 69 C 71 C F3, F2, B3 and B2 54 C 56 C 58 C 60 C 62 C 64 C 66 C FL and BL 56 C 58 C 60 C 62 C 64 C 66 C 68 C Default settings, Normal GC Content

48 Goals for Optimization Faster Time to Result and Lower Background Amplification Increased reaction speed (faster TTR from POS) Decreased non-specific amplification (slower TTR from NEG) Increased separation between Positive and Negative TTR Improved sensitivity (Detect low copy inputs)

49 Factors for Optimization Multiple Factors Need to be Assessed Primers Design, Concentration, Ratio Reaction temperature Magnesium concentration Enzyme (concentration) Reaction ph Additives (e.g. Betaine or Triton)

50 Primer Screen/Temperature Optimization Not all Primer Designs are Guaranteed to Work 60 Primer Screen/Temp Opt 50 Time to Result (min) C 73.7 C 73 C 71.8 C 70.4 C 69.2 C 68.4 C 68 C 74 C 73.7 C 73 C 71.8 C 70.4 C 69.2 C 68.4 C 68 C 74 C 73.7 C 73 C 71.8 C 70.4 C 69.2 C 68.4 C 68 C 74 C 73.7 C 73 C 71.8 C 70.4 C 69.2 C 68.4 C 68 C 74 C 73.7 C 73 C 71.8 C 70.4 C 69.2 C 68.4 C 68 C 74 C 73.7 C 73 C 71.8 C 70.4 C 69.2 C 68.4 C 68 C NTC Pos NTC Pos NTC Pos Set 1 Set 2 Set 3

51 Optimizing Selected Primer Design Design of Experiments may help in Optimization Set Objective Use Results Select Variables Analyze and Interpret Results Select an Experimental Design Check Data Execute the Design

52 Summary LAMP is an isothermal nucleic acid amplification technique appropriate for detection in point-of-care or low resource settings when rapid detection is necessary. LAMP primer design is more complex and less predictable than PCR. Screening of multiple LAMP primer sets is necessary to identify a successful design. Discriminative target selection and subsequent LAMP primer design guidelines are necessary for the creation of highly sensitive and specific LAMP assays. Adjusting Tm setpoints during primer design to match the DNA polymerase s temperature optima can improve assay performance. Systematic optimization of the reaction conditions using Design of Experiments can expedite LAMP assay development.

53 Resources Available Publications: eslides: LAMP Webinar: Website: LAMP and Isothermal Amplification

54 Questions Please Do Not Hesitate to Contact Tech Support Lucigen Tech Support (608) am 5 pm central time Product Manager Karen Kleman, Ph.D. Product Manager, Amplification kkleman@lucigen.com Thank You for Listening-in Today!