Regulation of bacterial gene expression

Transcription

1 Regulation of bacterial gene expression

2 Gene Expression Gene Expression: RNA and protein synthesis DNA > RNA > Protein transcription translation! DNA replication only occurs in cells that are dividing! gene expression occurs in all cells all the time: cells are constructed of protein and require enzymes to function

3 Gene Expression! The expression of a gene into a protein occurs by:! 1) Transcription of a gene into RNA! Produces an RNA copy of the coding region of a gene! The RNA transcript may be the actual gene product (rrna, trna) or be translated into a polypeptide gene product (mrna)! 2) Translation of mrna transcript into polypeptide! accomplished by ribosomes with the help of trna

4

5 Bacterial genes are often organized in operons with short intergenic spacers Polycistronic mrna, that single mrna can code for several genes, but each gene has its own start and stop codons Gene A Gene B Gene C But neighbouring operons might be in opposite orientation in genome Gene 2 Gene 1 that is, genes are encoded on the other DNA strand 5 gatcgctctataggaggtgc ATGCAATGG 3 5 ATAGGACAT 3 TATCCTGTA ctagcgagatatcctccacg TACGTTACC 5 What are N-terminal sequences of proteins encoded by genes 1 and 2? Operons a unit made up of linked genes that is thought to regulate other genes responsible for protein synthesis.

6 Where would promoter(s) for genes 1 and 2 be located? Gene 2 Gene 1 Sometimes single bidirectional promoter for expression of genes encoded on opposite strands Eukaryotic genomes also sometimes have genes located close together but encoded on opposite strands bidirectional promoter?

7 HOW TO DEFINE A GENE? Prokaryotic gene sequence of DNA essential for specific function codes for protein or structural RNA mrna produced as a result of transcription is n o t m o d i f i e d i n prokaryotic cells. structural gene UTRs - untranslated regions which surround the coding sequence in a mrna Ribosomal binding site (RBS) is a sequence on mrna that is bound by the ribosome when initiating protein translation

8 Gene Expression Transcription Translation Prokaryotic Transcription and translation occur simultaneously (at the same time) in bacteria Transcription occurs in the cytoplasm. Translation of the mrna into proteins also occurs in the cytoplasm

9 Prokaryotic Gene Expression polycistronic mrna carrying multiple protein sequences (common in prokaryotes)

10 Eukaryotic gene Eukaryotic (but not prokaryotic) genes usually contain introns Eukaryotic cells modify mrna by RNA splicing, 5' end capping, and addition of a polya tail. Intron - non-coding sequences removed from pre-rna (by splicing) Exon - sequences that remain in mature RNA (mostly coding)

11 Gene Expression Monocistronic mrna carrying a single protein sequence (common in eukaryotes) Transcription Transcription occurs in the cell's nucleus Eukaryotic Translation Translation occurs in the cytoplasm mrna moves to the cytoplasm

12 Example of human pax6 gene Pax-6: Paired box protein Pax6 is a transcription factor present during embryonic development Lines: introns Bars: exons Human genes: Intron length: typically ~200 nt to > 10 kb Tall bars: coding exons Short bars: non-coding exons Exon length: typically nt Mercer Nat Rev Genet 10: 155, 2009

13 Structure of NF2 (neurofibromatosis type II) gene in different animals NF2 are symptoms of dysfunction of (hearing) nerve, which carries information about sound to the brain

14 Transcription! Transcription : synthesis of complementary strand of RNA from DNA template! RNA is synthesized as copy of a DNA gene except that T is replaced by U.The complement is produced from the template or antisense strand of the DNA gene! Sense strand of the DNA: ATGGTATTCTCCTATCGTTAA! Template/Antisense of the DNA gene: TACCATAAGAGGATAGCAATT! RNA: AUGGUAUUCUCCUAUCGUUAA

15 ! 5'GCGATATCGCAAA 3 DNA sense strand or positive (+) (nontemplate/coding) Complementary to the template strand.! 3'CGCTATAGCGTTT 5 DNA antisense strand or negative (-) (template/noncoding) Used as a template for transcription.! 5'GCGAUAUCGCAAA 3 mrna Sense transcript RNA strand that is transcribed from the noncoding (template/antisense) strand. Note: Except for the fact that all thymines are now uracils (T-->U), it is complementary to the noncoding (template/antisense) DNA strand (identical to the coding (nontemplate/ sense) DNA strand.! 3'CGCUAUAGCGUUU 5 mrna Antisense transcript RNA strand that is transcribed from the coding (nontemplate/sense) strand. Note: Except for the fact that all thymines are now uracils (T-->U), it is complementary to the coding (nontemplate/sense) DNA strand (identical to the noncoding (template/ antisense) DNA strand.

16 The difference between DNA and RNA

17 RNA content of a cell Immature Heterogeneous nuclear RNA The term hnrna is often used as a synonym for premrna Mature Small nuclear RNA Small nucleolar RNAs MicroRNA Small interfering RNA small regulatory RNAs small non-coding (nc) regulatory RNAs are also present in bacteria srnas

18 RNAs involved in protein synthesis Type Function Distribution mrna Codes for protein (RNA copy of a gene that encodes a polypeptide) All organisms rrna Translation (RNA that is a structural component of ribosomes) All organisms trna Translation (delivery of correct amino acids to ribosomes during translation) All organisms RNAs involved in post-transcriptional modification or DNA replication Type Function Distribution snrna Splicing and other functions Eukaryotes and archaea snorna Nucleotide modification of RNAs Eukaryotes and archaea Regulatory RNAs Type Function Distribution mirna Gene regulation Most eukaryotes sirna Gene regulation Most eukaryotes

19 ! Initiation Transcription! Promoter serves to target and orient RNA polymerase! RNA polymerase binds to the promoter of a gene! Once bind at promoter, RNA polymerase unzips DNA

20 Elongation! RNA is synthesized by complementary bas pairing o free nucleotides with the nucleotide bases on the template strand of DNA! The site of synthesis moves along DNA; DNA that has been transcribed rewinds! Transcription reaches the terminator RNA Polymerase Promoter Terminator

21 Termination! Caused by specific DNA sequences in the gene! RNA and RNA polymerase are released and the DNA helix reforms RNA Polymerase mrna Terminator

22 Overview of Transcription

23 Translation! Translation is the process of converting the mrna codon sequences into an amino acid sequence! Ribosomes are the organelle (in all cells) where proteins are synthesized (Ribosomes consist of a small (in E. coli, 30S) and larger (50S) subunits)! The smaller subunit has a binding site for the mrna. The larger subunit has two binding sites for trna.

24 Transfer RNA (trna! basically cloverleaf-shaped! At the top of the large loop are three bases, the anticodon, which is the complement of the codon! There are 61 different trnas, each having a different binding site for the amino acid and a different anticodon! Amino acid linkage to the proper trna is controlled by the aminoacyltrna synthetases. Energy for binding the amino acid to trna comes from ATP

25 Initiation! Components needed to begin translation come together (The intitator trna/mrna/small ribosomal unit is called the initiation complex. The larger subunit attaches to the initiation complex! On the assembled ribosome, a trna carrying the first amino acid is paired with start codon on the mrna! The initiator codon (AUG) codes for the amino acid methionine (Met). No transcription occurs without the AUG codon. Met is always the first amino acid in a polypeptide chain, although often it is removed after translation! A trna carrying the second amino acid approaches

26 Elongation! New trnas bring their amino acids to the open binding site on the ribosome/mrna complex, forming a peptide bond between the amino acids (The first amino acid joins to the second by a peptide bond), and the first trna is released! The complex then shifts along the mrna to the next triplet (3 nucleotides)! The ribosome continues to move along the mrna, and new amino acids are added to the polypeptide and the process continues

27 Termination! when the ribosome reaches a stop codon, the polypeptide is released! Finally, the last trna is released, and the ribosome comes apart. The released polypeptide forms a new protein! stop codon causes translation to end

28 Genetic Code! Codons code for a specific amino acid! 20 amino acids! 3 base code 4 bases (A,U,G,C)! 64 possible combinations ( 4 3 )! Amino acids are coded for by more than one codon! Genetic Code is Universal

29 Table of the Genetic Code

30 If the DNA sequence is: CATGCCTGGGCAATAG (transcription) The mrna copy is: CAUGCCUGGGCAAUAG (translation) The polypeptide is: *Met-Pro-Gly-Gln-(stop) *all proteins begin w/met And when analyzing DNA data obtained in the lab, initiation codon might be located outside the sequenced region R e m e m b e r t h a t although AUG is the standard initiation codon, there can also be AUG triplets within an ORF (Open reading frame) that contains no stop codons